Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026965 Staphylococcus aureus strain FDAARGOS_2 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP026964 Staphylococcus aureus strain FDAARGOS_2 chromosome, complete genome 14 crisprs WYL,csa3,DEDDh,cas3,DinG 6 9 8 1
CP026967 Staphylococcus aureus strain FDAARGOS_2 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP026966 Staphylococcus aureus strain FDAARGOS_2 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. CP026964
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_1 107694-107785 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_2 806401-806574 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_3 938832-938939 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_4 1079074-1079152 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_5 1246017-1246102 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_6 1357528-1357609 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_8 1884559-1884711 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_9 2307826-2307911 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_10 2318658-2318750 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_11 2395512-2395763 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_12 2476061-2476153 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_13 2654339-2654420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_14 2703162-2703243 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026964_15 2750587-2750667 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 474007-474022 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 474063-474078 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 489290-489305 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 489562-489577 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 971758-971773 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1211757-1211772 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1581564-1581579 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1918919-1918934 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2093631-2093646 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2179082-2179097 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2183479-2183494 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2391682-2391697 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2492333-2492348 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2702890-2702905 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2737983-2737998 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2738039-2738054 0 1.0
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 474083-474108 0 1.0
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 474119-474134 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1592375-1592390 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1741714-1741729 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1798722-1798737 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 1904372-1904387 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2136897-2136912 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2359008-2359023 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2745244-2745259 1 0.938
CP026964_2 2.2|806524|16|CP026964|PILER-CR 806524-806539 16 CP026964.1 2782141-2782156 1 0.938
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 474027-474052 1 0.962
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 2702860-2702885 1 0.962
CP026964_14 14.1|2703186|34|CP026964|CRISPRCasFinder 2703186-2703219 34 CP026964.1 2093659-2093692 1 0.971
CP026964_14 14.1|2703186|34|CP026964|CRISPRCasFinder 2703186-2703219 34 CP026964.1 2183433-2183466 1 0.971
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 396395-396423 1 0.966
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 1741766-1741794 1 0.966
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 2053623-2053651 1 0.966
CP026964_5 5.1|1246047|26|CP026964|CRISPRCasFinder 1246047-1246072 26 CP026964.1 2391702-2391727 2 0.923
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 2738009-2738034 2 0.923
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 2782105-2782130 2 0.923
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 2782161-2782186 2 0.923
CP026964_9 9.1|2307856|26|CP026964|CRISPRCasFinder 2307856-2307881 26 CP026964.1 2782217-2782242 2 0.923
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 CP026964.1 1477610-1477638 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 489338-489366 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 597386-597414 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 597444-597472 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 1918967-1918995 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 2391623-2391651 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 2654405-2654433 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 2703149-2703177 2 0.931
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 CP026964.1 2745179-2745207 2 0.931

1. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 474007-474022, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

2. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 474063-474078, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

3. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 489290-489305, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

4. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 489562-489577, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

5. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 971758-971773, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

6. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1211757-1211772, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

7. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1581564-1581579, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

8. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1918919-1918934, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

9. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2093631-2093646, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

10. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2179082-2179097, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

11. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2183479-2183494, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

12. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2391682-2391697, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

13. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2492333-2492348, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

14. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2702890-2702905, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

15. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2737983-2737998, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

16. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2738039-2738054, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

17. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 474083-474108, mismatch: 0, identity: 1.0

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
**************************

18. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 474119-474134, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcatacaataatg	Protospacer
***** **********

19. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1592375-1592390, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacgataatg	Protospacer
*********.******

20. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1741714-1741729, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagctttcaataatg	Protospacer
******* ********

21. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1798722-1798737, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttactataatg	Protospacer
********* ******

22. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 1904372-1904387, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacgataatg	Protospacer
*********.******

23. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2136897-2136912, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

24. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2359008-2359023, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

25. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2745244-2745259, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacgataatg	Protospacer
*********.******

26. spacer 2.2|806524|16|CP026964|PILER-CR matches to position: 2782141-2782156, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagctaacaataatg	Protospacer
****** *********

27. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 474027-474052, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
************.*************

28. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 2702860-2702885, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
************.*************

29. spacer 14.1|2703186|34|CP026964|CRISPRCasFinder matches to position: 2093659-2093692, mismatch: 1, identity: 0.971

atgggccccaacaaagagaaattggattctcaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
*****************************.****

30. spacer 14.1|2703186|34|CP026964|CRISPRCasFinder matches to position: 2183433-2183466, mismatch: 1, identity: 0.971

atgggccccaacaaagagaaattggattctcaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
*****************************.****

31. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 396395-396423, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaagcaatgca	Protospacer
*********************.*******

32. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 1741766-1741794, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacagacaatgca	Protospacer
********************.********

33. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 2053623-2053651, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacagacaatgca	Protospacer
********************.********

34. spacer 5.1|1246047|26|CP026964|CRISPRCasFinder matches to position: 2391702-2391727, mismatch: 2, identity: 0.923

cggggccccaacatagaaggtgacga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
*************.***** ******

35. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 2738009-2738034, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtcagcttctgtgttggggccccg	Protospacer
***.********.*************

36. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 2782105-2782130, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgcttttatgttggggccccg	Protospacer
***** ****.***************

37. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 2782161-2782186, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtctgcttctatgttggggccccg	Protospacer
***.* ********************

38. spacer 9.1|2307856|26|CP026964|CRISPRCasFinder matches to position: 2782217-2782242, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ******.*************

39. spacer 11.4|2395708|29|CP026964|CRT matches to position: 1477610-1477638, mismatch: 2, identity: 0.931

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
ctgtagaaattggtgttccaatttctcta	Protospacer
**** ********** *************

40. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 489338-489366, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

41. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 597386-597414, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

42. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 597444-597472, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

43. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 1918967-1918995, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

44. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 2391623-2391651, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcaaaaagaaattctacagacaatgca	Protospacer
****.***************.********

45. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 2654405-2654433, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

46. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 2703149-2703177, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

47. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to position: 2745179-2745207, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaatttctacagacaatgca	Protospacer
************ *******.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026964_7 7.1|1798780|27|CP026964|CRISPRCasFinder 1798780-1798806 27 KM359505 Prochlorococcus phage P-TIM68, complete genome 102710-102736 5 0.815
CP026964_11 11.1|2395539|29|CP026964|CRT 2395539-2395567 29 KY971610 Pseudomonas phage PspYZU05, complete genome 73941-73969 6 0.793
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MH051913 Enterobacteria phage vB_EcoM_IME281, complete genome 39126-39154 6 0.793
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MT682711 Escherichia phage vB_EcoM_FB, complete genome 135624-135652 6 0.793
CP026964_8 8.4|1884666|29|CP026964|PILER-CR 1884666-1884694 29 MT889391 Mycobacterium phage MiniMac, complete genome 11249-11277 7 0.759
CP026964_8 8.4|1884666|29|CP026964|PILER-CR 1884666-1884694 29 MT889383 Mycobacterium phage MiniLon, complete genome 11248-11276 7 0.759
CP026964_8 8.4|1884666|29|CP026964|PILER-CR 1884666-1884694 29 KT281791 Mycobacterium phage Lolly9, complete genome 11248-11276 7 0.759
CP026964_11 11.1|2395539|29|CP026964|CRT 2395539-2395567 29 MT782071 Escherichia phage JN02, complete genome 83703-83731 7 0.759
CP026964_11 11.2|2395595|29|CP026964|CRT 2395595-2395623 29 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 268762-268790 7 0.759
CP026964_11 11.2|2395595|29|CP026964|CRT 2395595-2395623 29 MN856116 Myoviridae sp. isolate 525, complete genome 4988-5016 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MK295203 Escherichia phage vB_EcoM_005, complete genome 6681-6709 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MH051917 Enterobacteria phage vB_EcoM_IME341, complete genome 39726-39754 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 NC_014260 Enterobacteria phage IME08, complete genome 136112-136140 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MK234886 Escherichia phage AnYang, complete genome 100563-100591 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 HM071924 Enterobacteria phage IME08, complete sequence 136112-136140 7 0.759
CP026964_15 15.1|2750613|29|CP026964|CRISPRCasFinder 2750613-2750641 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 198297-198325 8 0.724
CP026964_11 11.4|2395708|29|CP026964|CRT 2395708-2395736 29 KY653116 Staphylococcus phage IME1318_01, complete genome 21349-21377 8 0.724
CP026964_6 6.1|1357553|32|CP026964|CRISPRCasFinder 1357553-1357584 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 41454-41485 9 0.719
CP026964_8 8.2|1884645|32|CP026964|CRISPRCasFinder 1884645-1884676 32 MT889383 Mycobacterium phage MiniLon, complete genome 11248-11279 9 0.719
CP026964_8 8.2|1884645|32|CP026964|CRISPRCasFinder 1884645-1884676 32 KT281791 Mycobacterium phage Lolly9, complete genome 11248-11279 9 0.719
CP026964_6 6.1|1357553|32|CP026964|CRISPRCasFinder 1357553-1357584 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 296489-296520 10 0.688
CP026964_11 11.3|2395651|30|CP026964|CRT 2395651-2395680 30 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 166038-166067 10 0.667

1. spacer 7.1|1798780|27|CP026964|CRISPRCasFinder matches to KM359505 (Prochlorococcus phage P-TIM68, complete genome) position: , mismatch: 5, identity: 0.815

ggtctgtagaatttcttttcgaaattc	CRISPR spacer
gatctgtataatttcttttggaaatag	Protospacer
*.****** ********** *****  

2. spacer 11.1|2395539|29|CP026964|CRT matches to KY971610 (Pseudomonas phage PspYZU05, complete genome) position: , mismatch: 6, identity: 0.793

ctgttgaaattggtgacccaatttctcta	CRISPR spacer
ctgttcaaattggtgaccctatttcatgt	Protospacer
***** ************* ***** .  

3. spacer 11.4|2395708|29|CP026964|CRT matches to MH051913 (Enterobacteria phage vB_EcoM_IME281, complete genome) position: , mismatch: 6, identity: 0.793

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggca	Protospacer
* **************** ****.*  .*

4. spacer 11.4|2395708|29|CP026964|CRT matches to MT682711 (Escherichia phage vB_EcoM_FB, complete genome) position: , mismatch: 6, identity: 0.793

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggca	Protospacer
* **************** ****.*  .*

5. spacer 8.4|1884666|29|CP026964|PILER-CR matches to MT889391 (Mycobacterium phage MiniMac, complete genome) position: , mismatch: 7, identity: 0.759

agctgaccaaaagtcagatttcaataatg	CRISPR spacer
tcaggacctaaagtcagatttcaagaagg	Protospacer
    **** *************** ** *

6. spacer 8.4|1884666|29|CP026964|PILER-CR matches to MT889383 (Mycobacterium phage MiniLon, complete genome) position: , mismatch: 7, identity: 0.759

agctgaccaaaagtcagatttcaataatg	CRISPR spacer
tcaggacctaaagtcagatttcaagaagg	Protospacer
    **** *************** ** *

7. spacer 8.4|1884666|29|CP026964|PILER-CR matches to KT281791 (Mycobacterium phage Lolly9, complete genome) position: , mismatch: 7, identity: 0.759

agctgaccaaaagtcagatttcaataatg	CRISPR spacer
tcaggacctaaagtcagatttcaagaagg	Protospacer
    **** *************** ** *

8. spacer 11.1|2395539|29|CP026964|CRT matches to MT782071 (Escherichia phage JN02, complete genome) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgacccaatttctcta	CRISPR spacer
ccgttcaaatgggtgacccaatttcatgc	Protospacer
*.*** **** ************** .  

9. spacer 11.2|2395595|29|CP026964|CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.759

ttgttggaattggtgatcctatttctctc	CRISPR spacer
ttgttggaattggtggtccaattaatgaa	Protospacer
***************.*** ***  *   

10. spacer 11.2|2395595|29|CP026964|CRT matches to MN856116 (Myoviridae sp. isolate 525, complete genome) position: , mismatch: 7, identity: 0.759

ttgttggaattggtgatcctatttctctc	CRISPR spacer
ttgttggaattggttttcctattgtttct	Protospacer
**************  ******* .*...

11. spacer 11.4|2395708|29|CP026964|CRT matches to MK295203 (Escherichia phage vB_EcoM_005, complete genome) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggcg	Protospacer
* **************** ****.*  ..

12. spacer 11.4|2395708|29|CP026964|CRT matches to MH051917 (Enterobacteria phage vB_EcoM_IME341, complete genome) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggcg	Protospacer
* **************** ****.*  ..

13. spacer 11.4|2395708|29|CP026964|CRT matches to NC_014260 (Enterobacteria phage IME08, complete genome) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggcg	Protospacer
* **************** ****.*  ..

14. spacer 11.4|2395708|29|CP026964|CRT matches to MK234886 (Escherichia phage AnYang, complete genome) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggcg	Protospacer
* **************** ****.*  ..

15. spacer 11.4|2395708|29|CP026964|CRT matches to HM071924 (Enterobacteria phage IME08, complete sequence) position: , mismatch: 7, identity: 0.759

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
cggttgaaattggtgatcgaattccggcg	Protospacer
* **************** ****.*  ..

16. spacer 15.1|2750613|29|CP026964|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
cacttagaagaaatcctacaaacaatgca	Protospacer
. .. *.*******.**************

17. spacer 11.4|2395708|29|CP026964|CRT matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 8, identity: 0.724

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
agcctgaaattgatgatgcaatttctcgc	Protospacer
   .********.**** *********  

18. spacer 11.4|2395708|29|CP026964|CRT matches to KY653116 (Staphylococcus phage IME1318_01, complete genome) position: , mismatch: 8, identity: 0.724

ctgttgaaattggtgatccaatttctcta	CRISPR spacer
agcgtgaaattggtggtccaatatctcgt	Protospacer
    ***********.****** ****  

19. spacer 6.1|1357553|32|CP026964|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719

aaaagtaggagcgcctgcgctaagcgcatgca	CRISPR spacer
tggaggtggagcgcctgcgcaaggcgcatgag	Protospacer
 ..**  ************* *.******* .

20. spacer 8.2|1884645|32|CP026964|CRISPRCasFinder matches to MT889383 (Mycobacterium phage MiniLon, complete genome) position: , mismatch: 9, identity: 0.719

agctgaccaaaagtcagatttcaataatgtgc	CRISPR spacer
tcaggacctaaagtcagatttcaagaaggggt	Protospacer
    **** *************** ** * *.

21. spacer 8.2|1884645|32|CP026964|CRISPRCasFinder matches to KT281791 (Mycobacterium phage Lolly9, complete genome) position: , mismatch: 9, identity: 0.719

agctgaccaaaagtcagatttcaataatgtgc	CRISPR spacer
tcaggacctaaagtcagatttcaagaaggggt	Protospacer
    **** *************** ** * *.

22. spacer 6.1|1357553|32|CP026964|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aaaagtaggagcgcctgcgctaagcgcatgca	CRISPR spacer
tcgaagccgagcgcctgcgcgtagcgcatgcg	Protospacer
  .*.   ************  *********.

23. spacer 11.3|2395651|30|CP026964|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 10, identity: 0.667

tttgtatgctgacttttcgccagcttctgt	CRISPR spacer
aaatcggactgatttttcgccagcttctgc	Protospacer
    .. .****.****************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5814 : 13635 10 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_2 1479823 : 1537614 75 Staphylococcus_phage(95.38%) terminase,tail,portal,protease,holin,head,integrase,capsid attL 1483778:1483795|attR 1530234:1530251
DBSCAN-SWA_3 1630929 : 1736795 104 Staphylococcus_phage(93.22%) protease,bacteriocin,transposase,tRNA NA
DBSCAN-SWA_4 1860467 : 1869510 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 2482450 : 2490923 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2509777 : 2528810 23 Staphylococcus_phage(33.33%) bacteriocin,protease,holin NA
DBSCAN-SWA_7 2534775 : 2584740 66 Staphylococcus_phage(83.33%) tail,terminase,portal,protease,holin,head,integrase,capsid attL 2537115:2537141|attR 2581869:2581895
DBSCAN-SWA_8 2779027 : 2793758 18 uncultured_Caudovirales_phage(50.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP026964.1|AVG67977.1|2790073_2790175_-|hypothetical-protein 2790073_2790175_- 33 aa aa NA NA NA 2779027-2793758 yes