Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
NZ_FZZH01000183 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000164 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000187 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000033 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 3 | 6 | 0 | 0 | |
NZ_FZZH01000145 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000110 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000204 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000210 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000150 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000118 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000071 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000006 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000096 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000052 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000067 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000130 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000188 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000080 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000222 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000093 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000135 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000154 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000181 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000190 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000062 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000175 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000206 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000134 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000192 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000055 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000022 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000160 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000086 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000014 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000179 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000102 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000185 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000087 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000116 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000070 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000046 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000005 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000017 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000191 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000075 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000003 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 2 | |
NZ_FZZH01000176 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000139 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000148 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000166 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000172 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000205 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000058 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000111 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000034 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000019 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000008 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000079 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000024 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000081 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000068 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000090 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000211 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000013 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000054 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000122 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000171 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000128 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000085 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000026 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000076 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000194 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000011 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000143 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000147 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000229 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000037 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000082 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000109 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000002 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000159 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000031 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000142 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000193 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000209 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000216 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000035 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000032 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000214 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000020 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000170 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000121 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000112 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000045 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000169 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000025 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000042 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000208 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000173 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000167 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000028 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000001 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
NZ_FZZH01000061 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000196 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000065 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000049 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000180 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000226 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000012 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000153 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000040 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000069 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000050 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000018 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000223 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000137 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000120 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000225 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000104 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000182 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000124 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000098 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000113 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000136 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000009 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000044 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000103 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000072 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000162 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000036 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000218 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000091 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000106 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000047 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000177 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000126 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000099 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 0 | 0 | |
NZ_FZZH01000060 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000048 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000115 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000057 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000220 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000197 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000095 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000227 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000149 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000117 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000202 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000186 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000146 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000100 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000094 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000201 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000213 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000165 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000092 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000228 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000123 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000224 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000016 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000217 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000056 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000155 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000184 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000108 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000125 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000074 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000157 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000131 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000105 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000140 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000039 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000132 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000059 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000138 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000199 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000156 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000174 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000158 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000200 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000004 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000041 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000088 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000207 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000053 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000077 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000027 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000101 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000127 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000221 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000089 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000198 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000051 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000168 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000007 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000083 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000129 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000107 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000029 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000152 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000212 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000038 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000161 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000163 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000178 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000021 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000114 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000084 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000189 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000141 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000015 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000151 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000078 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000030 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000023 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000133 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000144 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000219 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000066 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000119 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000215 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000064 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000043 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000010 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000203 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000073 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000195 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000063 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_FZZH01000097 | Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 58079 : 67292 | 9 | Burkholderia_phage(28.57%) | NA |
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
NZ_FZZH01000099_1 | 5514-5544 | 31 | NZ_CP018385 | Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence | 64466-64496 | 8 | 0.742 | |
NZ_FZZH01000099_1 | 5514-5544 | 31 | NZ_CP020952 | Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence | 382796-382826 | 9 | 0.71 | |
NZ_FZZH01000099_1 | 5514-5544 | 31 | NC_011368 | Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence | 1029393-1029423 | 9 | 0.71 | |
NZ_FZZH01000099_1 | 5514-5544 | 31 | NZ_CP054028 | Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence | 548485-548515 | 9 | 0.71 | |
NZ_FZZH01000099_1 | 5514-5544 | 31 | NZ_CP035000 | Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence | 227234-227264 | 9 | 0.71 |
tgaatccgaacgcgtccgcacggaaacctat CRISPR spacer gcaatccgaacacgtcggcacggaaggcaag Protospacer *********.**** ********. * *
tgaatccgaacgcgtccgcacggaaacctat CRISPR spacer gagatccgaccgcatccgcacggaaaaatca Protospacer ..****** ***.************ *
tgaatccgaacgcgtccgcacggaaacctat CRISPR spacer cagatccgaccgcatccgcacggaaaagtcg Protospacer ...****** ***.************ *
tgaatccgaacgcgtccgcacggaaacctat CRISPR spacer cagatccgaccgcatccgcacggaaaaatcg Protospacer ...****** ***.************ *
tgaatccgaacgcgtccgcacggaaacctat CRISPR spacer cagatccgatcgcatccgcacggaaaagtca Protospacer ...****** ***.************ *
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
NZ_FZZH01000033_1 | 18264-18959 | orTypeII |
NA
|
10 spacers
|
cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
NZ_FZZH01000033_1 | 18300-18329 | 30 | NZ_FZZH01000020.1 | 8626-8655 | 0 | 1.0 | |
NZ_FZZH01000033_1 | 18432-18461 | 30 | NZ_FZZH01000010.1 | 19796-19825 | 0 | 1.0 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | NZ_FZZH01000026.1 | 5119-5148 | 1 | 0.967 |
acgccgccaacctagtccacgactttgaaa CRISPR spacer acgccgccaacctagtccacgactttgaaa Protospacer ******************************
tccacaggtttgttcaagccttagattttg CRISPR spacer tccacaggtttgttcaagccttagattttg Protospacer ******************************
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer gctcgccgcctgaataacggcgacaggtgt Protospacer *************************.****
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
NZ_FZZH01000033_1 | 18762-18791 | 30 | LR134122 | Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 | 383290-383319 | 4 | 0.867 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KX274135 | Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence | 31353-31382 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP013618 | Staphylococcus aureus strain RIVM1295 plasmid pRIVM1295-2, complete sequence | 1551-1580 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP013626 | Staphylococcus aureus strain RIVM4296 plasmid pRIVM4296, complete sequence | 2156-2185 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP029170 | Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence | 2687-2716 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP053078 | Staphylococcus aureus strain SA01 plasmid pSA01-04, complete sequence | 703-732 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MH785226 | Staphylococcus aureus strain ph1 plasmid pRIVM1295-2, complete sequence | 1495-1524 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_006872 | Clostridium perfringens plasmid pBCNF5603 DNA, complete sequence | 7436-7465 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP013044 | Clostridium perfringens strain JP55 plasmid pJFP55J, complete sequence | 7436-7465 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | KY554772 | Lactococcus phage AM5, complete genome | 19184-19213 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_049856 | Lactococcus phage AM4, complete genome | 101726-101755 | 6 | 0.8 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | MT261384 | Salmonella virus PAT1, complete genome | 13324-13353 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | MT580116 | Salmonella phage 65FD, complete genome | 29662-29691 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | MT580117 | Salmonella phage 66FD, complete genome | 20500-20529 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | NC_004775 | Enterobacteria phage epsilon15, complete genome | 29581-29610 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | NZ_CP038636 | Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence | 976136-976165 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18498-18527 | 30 | MK448946 | Streptococcus phage Javan456, complete genome | 30249-30278 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18564-18593 | 30 | NZ_CP034782 | Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence | 118054-118083 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT074137 | Bacteroides phage DAC16, complete genome | 19475-19504 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT074142 | Bacteroides phage DAC23, complete genome | 20325-20354 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT074141 | Bacteroides phage DAC22, complete genome | 21167-21196 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT074139 | Bacteroides phage DAC19, complete genome | 21079-21108 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT074140 | Bacteroides phage DAC20, complete genome | 21079-21108 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KY399975 | Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence | 21245-21274 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KY399974 | Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence | 21245-21274 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042356 | Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence | 10150-10179 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KJ812998 | Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence | 19475-19504 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KP900016 | Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence | 39956-39985 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KP868647 | Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence | 21246-21275 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP029731 | Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence | 107066-107095 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KC887916 | Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence | 19475-19504 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_025184 | Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence | 100608-100637 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP044035 | Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence | 107510-107539 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_004974 | Fusobacterium nucleatum plasmid pFN1, complete sequence | 5690-5719 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_021501 | Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence | 10148-10177 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MK933278 | Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence | 100608-100637 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP053690 | Arthrobacter citreus strain NEB 577 plasmid pAciIRM, complete sequence | 6015-6044 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP013337 | Fusobacterium hwasookii ChDC F206 plasmid, complete sequence | 231-260 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP053470 | Fusobacterium nucleatum strain Fn12230 plasmid pFN1, complete sequence | 1183-1212 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MH909345 | Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence | 51401-51430 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MG462729 | Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence | 19476-19505 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042350 | Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence | 10149-10178 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042354 | Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence | 10101-10130 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042353 | Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence | 9569-9598 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042351 | Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence | 9569-9598 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042352 | Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence | 9569-9598 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF042357 | Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence | 9763-9792 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_LR594660 | Variovorax sp. PBL-H6 plasmid 2 | 269294-269323 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_LR594667 | Variovorax sp. SRS16 plasmid 2 | 531080-531109 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP011450 | Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence | 332039-332068 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_LR594672 | Variovorax sp. PBL-E5 plasmid 2 | 531213-531242 | 7 | 0.767 | |
NZ_FZZH01000033_1 | 18432-18461 | 30 | CP041751 | Bacillus paranthracis strain NCCP 14796 plasmid unnamed1, complete sequence | 47076-47105 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18564-18593 | 30 | NZ_AP022333 | Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence | 172995-173024 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_KT373969 | Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence | 14709-14738 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_013653 | Staphylococcus aureus plasmid pPR9, complete sequence | 39382-39411 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_018967 | Staphylococcus aureus plasmid p18813-P03, complete sequence | 15848-15877 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_020535 | Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence | 24142-24171 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF580438 | Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence | 33848-33877 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_MF580438 | Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence | 37198-37227 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP044414 | Lactobacillus sp. JM1 plasmid unnamed2, complete sequence | 42032-42061 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP008839 | Lactobacillus gasseri DSM 14869 plasmid pEB01-1, complete sequence | 7298-7327 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MT774392 | CrAssphage cr128_1, complete genome | 6145-6174 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MN693954 | Marine virus AFVG_250M569, complete genome | 33564-33593 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP044544 | Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence | 117782-117811 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP013856 | Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence | 114106-114135 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP021033 | Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence | 507403-507432 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP022367 | Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence | 1875444-1875473 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP020952 | Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence | 699902-699931 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_HG938354 | Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence | 478670-478699 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_HG938356 | Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence | 518238-518267 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_AP022607 | Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 | 727314-727343 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP019318 | Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-6, complete sequence | 25593-25622 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP043441 | Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence | 1838636-1838665 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP011869 | Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence | 2542-2571 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18894-18923 | 30 | NZ_CP031709 | Acinetobacter wuhouensis strain WCHA60 plasmid p1_010060, complete sequence | 6094-6123 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18894-18923 | 30 | NZ_CP015617 | Acinetobacter schindleri strain ACE plasmid p2AsACE, complete sequence | 2623-2652 | 8 | 0.733 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NZ_CP020426 | Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence | 34537-34566 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | NC_015688 | Clostridium acetobutylicum DSM 1731 plasmid pSMBb, complete sequence | 1542-1571 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | KY554766 | Lactococcus phage AM6, complete genome | 15064-15093 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | CP011970 | Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence | 87434-87463 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | LN681537 | Clostridium phage phiCD211, complete genome | 96296-96325 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | KY554767 | Lactococcus phage AM7, complete genome | 15064-15093 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP046723 | Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence | 344141-344170 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP016890 | Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence | 265345-265374 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP034470 | Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence | 517584-517613 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP034149 | Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence | 317429-317458 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP034475 | Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence | 289164-289193 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP031650 | Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence | 176873-176902 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP030828 | Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence | 233390-233419 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18762-18791 | 30 | NZ_CP025550 | Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence | 15027-15056 | 9 | 0.7 | |
NZ_FZZH01000033_1 | 18696-18725 | 30 | MF417875 | Uncultured Caudovirales phage clone 10S_11, partial genome | 37465-37494 | 10 | 0.667 |
-ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gacctg-cggcagcgtcgatgacggcaaaag Protospacer **** **** *********.*********
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaataaagaagaattgaataaattactt Protospacer * . ***********.*********** *
tggcataaagaagaactgaataaattaagt CRISPR spacer tccaaaaaagaagaactaaataaatttagt Protospacer * * ***********.******** ***
tggcataaagaagaactgaataaattaagt CRISPR spacer tccaaaaaagaagaactaaataaatttagt Protospacer * * ***********.******** ***
tggcataaagaagaactgaataaattaagt CRISPR spacer ctgctaaaagaagaactaaaaaaattaagt Protospacer . ** ***********.** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer ctgctaaaagaagaactaaaaaaattaagt Protospacer . ** ***********.** *********
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer catcgccgccggagtaacggcgacaacctt Protospacer ******** **.************ . *
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer catcgccgccggagtaacggcgacaacctt Protospacer ******** **.************ . *
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer catcgccgccggagtaacggcgacaacctt Protospacer ******** **.************ . *
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer catcgccgccggagtaacggcgacaacctt Protospacer ******** **.************ . *
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer gctcgccgcctgaagcacggcgagcggctt Protospacer ************** ******* .*. *
gctcgccgcctgaataacggcgacaagtgt CRISPR spacer cctacccgcctgaatatcggcgacgagttc Protospacer ** *********** *******.*** .
cgcccgagattttcgccattggtataattt CRISPR spacer tgcccgatatcttcgccattggtaaaggct Protospacer .****** **.************* *. .*
tggcataaagaagaactgaataaattaagt CRISPR spacer ttatctaaagaagaattgattaaattaaga Protospacer * .. **********.*** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer ttatctaaagaagaattgattaaattaaga Protospacer * .. **********.*** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer ttatctaaagaagaattgattaaattaaga Protospacer * .. **********.*** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer ttatctaaagaagaattgattaaattaaga Protospacer * .. **********.*** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer ttatctaaagaagaattgattaaattaaga Protospacer * .. **********.*** *********
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcata-aagaagaactgaataaattaagt CRISPR spacer -agaatgcaagaagaactaaataaattaaaa Protospacer .* **. **********.**********.
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer ttaaatcaagaagaactgaataatttatat Protospacer * . ** **************** *** .*
tggcata-aagaagaactgaataaattaagt CRISPR spacer -agaatgcaagaagaactaaataaattaaaa Protospacer .* **. **********.**********.
tggcata-aagaagaactgaataaattaagt CRISPR spacer -agaatgcaagaagaactaaataaattaaaa Protospacer .* **. **********.**********.
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
tggcataaagaagaactgaataaattaagt CRISPR spacer tgtcataaagaagaacttaataatatattc Protospacer ** ************** ***** ** .
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gcttctcggctgcgtcgatggcgataaagc Protospacer *.* ******************..***.
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gcttctcggctgcgtcgatggcgataaagc Protospacer *.* ******************..***.
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer cttcgtcggcagcgacgatggcggcaatac Protospacer *...****** *** ************ *
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gcttctcggctgcgtcgatggcgataaagc Protospacer *.* ******************..***.
tccacaggtttgttcaagccttagattttg CRISPR spacer tatccaggtttgttcaaaccctagattaaa Protospacer * . *************.**.****** .
cgcccgagattttcgccattggtataattt CRISPR spacer tggccgaaattttcgtcattggtatagagg Protospacer .* ****.*******.**********.
tggcataaagaagaactgaataaattaagt CRISPR spacer aaaatgaaagaagaactgaataaagtaaat Protospacer .. ****************** ***.*
tggcataaagaagaactgaataaattaagt CRISPR spacer aaaatgaaagaagaactgaataaagtaaat Protospacer .. ****************** ***.*
tggcataaagaagaactgaataaattaagt CRISPR spacer aaaatgaaagaagaactgaataaagtaaat Protospacer .. ****************** ***.*
tggcataaagaagaactgaataaattaagt CRISPR spacer aaaatgaaagaagaactgaataaagtaaat Protospacer .. ****************** ***.*
tggcataaagaagaactgaataaattaagt CRISPR spacer tatttagaagaggaactgaataaattaaat Protospacer *. . .****.****************.*
tggcataaagaagaactgaataaattaagt CRISPR spacer tatttagaagaggaactgaataaattaaat Protospacer *. . .****.****************.*
tggcataaagaagaactgaataaattaagt CRISPR spacer gatgttaaagcagaactaaataaattaaat Protospacer . ***** ******.**********.*
tggcataaagaagaactgaataaattaagt CRISPR spacer gatgttaaagcagaactaaataaattaaat Protospacer . ***** ******.**********.*
tggcataaagaagaactgaataaattaagt CRISPR spacer atttctaaagaagaattgaaaaaattaact Protospacer . **********.**** ******* *
tggcataaagaagaactgaataaattaagt CRISPR spacer tatattaaaaaagaactaaataaattaaaa Protospacer *. ****.*******.**********.
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gtgccacggccgcgtcgatggcggcgaaag Protospacer . . ****.**************.****
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gccagtcggcggcgtcgatggcggtctcgg Protospacer ** ****** *************. .*
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer ccctgtcggcagcgccgatggcgctctgat Protospacer ********** ***.******** . .*
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer ccctgtcggctccggcgatggcgccggccc Protospacer *********** ** ******** *..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer ggctgtcggctacggcgatggcggcggcgg Protospacer *********.** **********.. .*
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tcctgtcggcggcgtcgctggcggaattcc Protospacer .********* ****** ****** *
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tcctgtcggctgcggcgctggcggaattcc Protospacer .************* ** ****** *
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer agctgtcggctgcggcgatgacggcctgcg Protospacer ************ *****.**** . *
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer cggcctcggccgcgtcgatggcggcacagc Protospacer * . *****.*************** *.
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tgctggcggcggcgtcgatggcggcgaggt Protospacer . *** **** **************.*..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer gccagtcggcggcgtcgatggcggtctcgg Protospacer ** ****** *************. .*
ttgagttttcatattttagaaccgccgtcc CRISPR spacer ttgagttttcatatttaagtacctgtttta Protospacer **************** ** *** . *.
ttgagttttcatattttagaaccgccgtcc CRISPR spacer ttgagttttcatatttaagtacctgtttta Protospacer **************** ** *** . *.
tggcataaagaagaactgaataaattaagt CRISPR spacer aattgtaaagaagaactaattaaattaaag Protospacer . ..************.* ********.
tggcataaagaagaactgaataaattaagt CRISPR spacer caaacgcaaaaagaactaaataaattaagt Protospacer ... **.*******.************
tggcataaagaagaactgaataaattaagt CRISPR spacer gataataaagaagacctgaataaactattg Protospacer . ********** *********.**
tggcataaagaagaactgaataaattaagt CRISPR spacer aattgtaaagaagaactaattaaattaaag Protospacer . ..************.* ********.
tggcataaagaagaactgaataaattaagt CRISPR spacer aattgtaaagaagaactaattaaattaaag Protospacer . ..************.* ********.
tggcataaagaagaactgaataaattaagt CRISPR spacer gataataaagaagacctgaataaactattg Protospacer . ********** *********.**
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer tctggtcggcagcgtcgatggcggctggcc Protospacer .*. ****** ************** ..
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer ccctgtcggatgcggcgatggcgaagcgga Protospacer ********* **** ********. . ...
ccctgtcggctgcgtcgatggcggcaaaag CRISPR spacer cgaggtcggcggcgtcgatggcggcgtcga Protospacer * ****** **************. ..
tggcataaaga-agaactgaataaattaagt CRISPR spacer -aacgcaaaagtagaactgaataaattacta Protospacer ..*..***.. ****************
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 52459 : 62644 | 18 | Vibrio_phage(25.0%) | NA |
Acr ID | Acr position | Acr size | |||
---|---|---|---|---|---|
116 aa aa | AcrIIC3 | NA | NZ_FZZH01000003.1_24163_24373_+ | No | NA |
123 aa aa | NA | NA | NZ_FZZH01000003.1_24163_24373_+ | No | NA |
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|