Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FOJP01000003 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_FOJP01000041 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000045 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000046 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000009 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_FOJP01000013 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_FOJP01000027 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000047 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000001 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs cas3,csa3,DEDDh 0 0 1 0
NZ_FOJP01000029 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000043 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000030 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000025 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000006 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs PD-DExK,DEDDh,DinG 0 0 0 0
NZ_FOJP01000008 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000018 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000011 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_FOJP01000023 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000032 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000004 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FOJP01000015 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000035 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 2 crisprs NA 0 0 0 0
NZ_FOJP01000007 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000026 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000002 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000012 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000050 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000020 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000028 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000038 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000042 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_FOJP01000017 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FOJP01000037 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000016 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000048 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000022 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_FOJP01000044 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000040 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000010 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOJP01000031 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000014 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000024 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000019 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000005 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs cas3,DinG,DEDDh 0 0 0 0
NZ_FOJP01000039 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000021 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 2 crisprs cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3 2 26 0 0
NZ_FOJP01000033 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000034 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000049 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOJP01000036 Pseudomonas otitidis strain DSM 17224, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0

Results visualization

1. NZ_FOJP01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17263 : 58252 58 Pseudomonas_virus(42.86%) portal,terminase,head,capsid,tail,holin,integrase,plate attL 22257:22306|attR 59037:59086
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FOJP01000022.1|WP_074973300.1|34444_34642_+|hypothetical-protein 34444_34642_+ 65 aa aa AcrIE5 NA NZ_FOJP01000022.1_34638_34854_+ 17263-58252 yes
NZ_FOJP01000022.1|WP_139233706.1|33696_34338_+|hypothetical-protein 33696_34338_+ 213 aa aa NA NA NZ_FOJP01000022.1_34638_34854_+ 17263-58252 yes
2. NZ_FOJP01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81107 : 95052 17 uncultured_Caudovirales_phage(72.73%) integrase,tRNA attL 77866:77882|attR 93473:93489
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FOJP01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12578 : 18986 8 Bacillus_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FOJP01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44040 : 55749 10 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FOJP01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 160767 : 166795 9 Vibrio_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FOJP01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 132284 : 180425 59 Pseudomonas_phage(37.14%) lysis,tail,protease,capsid,portal,terminase,head,integrase attL 159431:159447|attR 183074:183090
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FOJP01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120355 : 131482 13 Trichoplusia_ni_ascovirus(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FOJP01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 328503 : 399547 54 Vibrio_phage(16.67%) holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FOJP01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7118 : 24816 22 Haemophilus_phage(50.0%) holin,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FOJP01000042
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOJP01000042_1 650-858 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FOJP01000042_1 1.2|776|63|NZ_FOJP01000042|PILER-CR 776-838 63 NZ_AP015031 Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence 190872-190934 5 0.921
NZ_FOJP01000042_1 1.2|776|63|NZ_FOJP01000042|PILER-CR 776-838 63 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 285509-285571 5 0.921

1. spacer 1.2|776|63|NZ_FOJP01000042|PILER-CR matches to NZ_AP015031 (Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence) position: , mismatch: 5, identity: 0.921

gagcgagtcgggcagcatggaccatagccagatgggccacagccagggccaagagaaggc	CRISPR spacer
gagcgaatcgggcagcatggaccatagccagatgggccacagccagagccaagagaaggc	Protospacer
******.***************************************.*************

2. spacer 1.2|776|63|NZ_FOJP01000042|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.921

gagcgagtcgggcagcatggaccatagccagatgggccacagccagggccaagagaaggc	CRISPR spacer
gagcgaatcgggcagcatggaccatagccagatgggccacagccagagccaagagaaggc	Protospacer
******.***************************************.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FOJP01000035
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOJP01000035_1 2038-2236 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOJP01000035_2 3096-3261 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FOJP01000021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOJP01000021_1 33610-34800 TypeI-E I-E,II-B
19 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOJP01000021_2 44912-45245 TypeI-E I-E,II-B
5 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_FOJP01000022.1 29229-29260 1 0.969
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_FOJP01000022.1 29229-29261 1 0.97

1. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to position: 29229-29260, mismatch: 1, identity: 0.969

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
atcggcatgcgctccagctgctcggcaaaacg	Protospacer
*****************************.**

2. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to position: 29229-29261, mismatch: 1, identity: 0.97

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
atcggcatgcgctccagctgctcggcaaaacgc	Protospacer
*****************************.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510987 Pseudomonas phage BR233, partial genome 859-890 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510984 Pseudomonas phage BR200, partial genome 26758-26789 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510971 Pseudomonas phage CF79, partial genome 22414-22445 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510965 Pseudomonas phage CF34, partial genome 14885-14916 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510974 Pseudomonas phage CF140, partial genome 828-859 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510978 Pseudomonas phage CF208, partial genome 968-999 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510988 Pseudomonas phage BR299, partial genome 914-945 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510976 Pseudomonas phage CF165, partial genome 21568-21599 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510970 Pseudomonas phage CF67, partial genome 912-943 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510992 Pseudomonas phage BR144, partial genome 26994-27025 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510990 Pseudomonas phage BR133, partial genome 4197-4228 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 NC_031091 Pseudomonas phage MD8, complete genome 862-893 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510975 Pseudomonas phage CF145, partial genome 1144-1175 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510968 Pseudomonas phage CF55, partial genome 968-999 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510969 Pseudomonas phage CF60, partial genome 28274-28305 1 0.969
NZ_FOJP01000021_1 1.8|34069|32|NZ_FOJP01000021|CRT 34069-34100 32 MK510986 Pseudomonas phage BR213, partial genome 859-890 1 0.969
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510987 Pseudomonas phage BR233, partial genome 858-890 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510984 Pseudomonas phage BR200, partial genome 26757-26789 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510971 Pseudomonas phage CF79, partial genome 22413-22445 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510965 Pseudomonas phage CF34, partial genome 14884-14916 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510974 Pseudomonas phage CF140, partial genome 827-859 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510978 Pseudomonas phage CF208, partial genome 967-999 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510988 Pseudomonas phage BR299, partial genome 913-945 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510976 Pseudomonas phage CF165, partial genome 21567-21599 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510970 Pseudomonas phage CF67, partial genome 911-943 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510992 Pseudomonas phage BR144, partial genome 26993-27025 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510990 Pseudomonas phage BR133, partial genome 4196-4228 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 NC_031091 Pseudomonas phage MD8, complete genome 861-893 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510975 Pseudomonas phage CF145, partial genome 1143-1175 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510968 Pseudomonas phage CF55, partial genome 967-999 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510969 Pseudomonas phage CF60, partial genome 28273-28305 1 0.97
NZ_FOJP01000021_1 1.26|34076|33|NZ_FOJP01000021|PILER-CR 34076-34108 33 MK510986 Pseudomonas phage BR213, partial genome 858-890 1 0.97
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP014801 Salipiger profundus strain JLT2016 plasmid pTPRO5, complete sequence 27863-27894 5 0.844
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP015450 Dietzia lutea strain YIM 80766 plasmid unnamed1, complete sequence 25701-25732 6 0.812
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 599936-599967 6 0.812
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 134312-134343 6 0.812
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 219824-219855 6 0.812
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NC_009939 Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence 79048-79079 6 0.812
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 29744-29775 6 0.812
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 599935-599967 6 0.818
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP014801 Salipiger profundus strain JLT2016 plasmid pTPRO5, complete sequence 27863-27895 6 0.818
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 134312-134344 6 0.818
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NC_009939 Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence 79048-79080 6 0.818
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 MT952845 Microbacterium phage GardenState, complete genome 35084-35115 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 977879-977910 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1524436-1524467 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 977974-978005 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1469029-1469060 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1210614-1210645 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 632297-632328 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 977697-977728 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 977642-977673 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1452613-1452644 6 0.812
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1199057-1199088 6 0.812
NZ_FOJP01000021_2 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR 45063-45094 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 43667-43698 6 0.812
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1811477-1811508 6 0.812
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1255108-1255139 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 877264-877295 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 211576-211607 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 79525-79556 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 86277-86308 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 79930-79961 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1872450-1872481 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 86916-86947 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 107695-107726 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 295536-295567 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 191954-191985 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 38995-39026 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 382395-382426 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 78014-78045 7 0.781
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 533692-533723 7 0.781
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 262180-262211 7 0.781
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 262618-262649 7 0.781
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 268620-268651 7 0.781
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 570571-570602 7 0.781
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1188509-1188540 7 0.781
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 673966-673997 7 0.781
NZ_FOJP01000021_1 1.13|34374|32|NZ_FOJP01000021|CRT 34374-34405 32 MN856025 Bacteriophage sp. isolate 180, complete genome 7944-7975 7 0.781
NZ_FOJP01000021_1 1.13|34374|32|NZ_FOJP01000021|CRT 34374-34405 32 MH178096 Aeromonas phage AsXd-1, complete genome 21740-21771 7 0.781
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MH697589 Microbacterium phage Neferthena, complete genome 31859-31890 7 0.781
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MT451984 Microbacterium phage Nebulous, complete genome 32518-32549 7 0.781
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 901048-901079 7 0.781
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 219824-219856 7 0.788
NZ_FOJP01000021_1 1.31|34381|33|NZ_FOJP01000021|PILER-CR 34381-34413 33 MH178096 Aeromonas phage AsXd-1, complete genome 21739-21771 7 0.788
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 80828-80859 7 0.781
NZ_FOJP01000021_2 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR 45002-45033 32 NC_006552 Pseudomonas phage F116, complete genome 55144-55175 7 0.781
NZ_FOJP01000021_2 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR 45002-45033 32 AY625898 Pseudomonas aeruginosa phage F116, complete genome 55144-55175 7 0.781
NZ_FOJP01000021_2 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR 45063-45094 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 47671-47702 7 0.781
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 207767-207798 7 0.781
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP037914 Sphingomonas sp. AAP5 plasmid p213, complete sequence 116600-116631 8 0.75
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1392277-1392308 8 0.75
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 56704-56735 8 0.75
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 651263-651294 8 0.75
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 433077-433108 8 0.75
NZ_FOJP01000021_1 1.5|33885|32|NZ_FOJP01000021|CRT 33885-33916 32 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 152104-152135 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_AP017657 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence 140786-140817 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 170084-170115 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 268034-268065 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 262104-262135 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 262104-262135 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 262104-262135 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 262104-262135 8 0.75
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 262196-262227 8 0.75
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NC_021209 Sinorhizobium sp. M14 plasmid pSinA, complete sequence 21882-21913 8 0.75
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP045378 Sulfitobacter sp. THAF37 plasmid pTHAF37_f, complete sequence 19019-19050 8 0.75
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP017191 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence 168474-168505 8 0.75
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP018463 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence 135554-135585 8 0.75
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NC_007507 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence 77028-77059 8 0.75
NZ_FOJP01000021_1 1.13|34374|32|NZ_FOJP01000021|CRT 34374-34405 32 MN693401 Marine virus AFVG_25M126, complete genome 18044-18075 8 0.75
NZ_FOJP01000021_1 1.14|34435|32|NZ_FOJP01000021|CRT 34435-34466 32 NZ_CP049252 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence 10478-10509 8 0.75
NZ_FOJP01000021_1 1.15|34496|32|NZ_FOJP01000021|CRT,PILER-CR 34496-34527 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 816527-816558 8 0.75
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP039693 Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence 159845-159876 8 0.75
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 213552-213583 8 0.75
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_KY000074 Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence 26932-26963 8 0.75
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MN908686 Microbacterium phage Zepp, complete genome 29760-29791 8 0.75
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MT889377 Microbacterium phage Zayuliv, complete genome 30326-30357 8 0.75
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 533691-533723 8 0.758
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 262179-262211 8 0.758
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 262617-262649 8 0.758
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 268619-268651 8 0.758
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 570570-570602 8 0.758
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP017191 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence 168473-168505 8 0.758
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP018463 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence 135554-135586 8 0.758
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NC_007507 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence 77028-77060 8 0.758
NZ_FOJP01000021_1 1.31|34381|33|NZ_FOJP01000021|PILER-CR 34381-34413 33 MN856025 Bacteriophage sp. isolate 180, complete genome 7944-7976 8 0.758
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 223655-223686 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 612955-612986 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 225203-225234 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 227256-227287 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 225203-225234 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 110343-110374 8 0.75
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_048860 Microbacterium phage Arete, complete genome 21748-21779 8 0.75
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1181564-1181595 9 0.719
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 723635-723666 9 0.719
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 950810-950841 9 0.719
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 9890-9921 9 0.719
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 104132-104163 9 0.719
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 NC_048097 Arthrobacter phage Yang, complete genome 15787-15818 9 0.719
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 200784-200815 9 0.719
NZ_FOJP01000021_1 1.6|33946|32|NZ_FOJP01000021|CRT 33946-33977 32 NZ_CP006570 Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence 96463-96494 9 0.719
NZ_FOJP01000021_1 1.7|34007|33|NZ_FOJP01000021|CRT 34007-34039 33 NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 25156-25188 9 0.727
NZ_FOJP01000021_1 1.9|34130|32|NZ_FOJP01000021|CRT 34130-34161 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 630082-630113 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 996037-996068 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1315266-1315297 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1748420-1748451 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 891025-891056 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1317744-1317775 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1135421-1135452 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1536426-1536457 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 806270-806301 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 851090-851121 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 964276-964307 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 983069-983100 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1158625-1158656 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 912434-912465 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1311587-1311618 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 882493-882524 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1730905-1730936 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 143967-143998 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1519854-1519885 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 970109-970140 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 688071-688102 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 894608-894639 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 796628-796659 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 893213-893244 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1275530-1275561 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 194125-194156 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 891705-891736 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 452859-452890 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 970098-970129 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1275497-1275528 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 961281-961312 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1004223-1004254 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1274302-1274333 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 983115-983146 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 856724-856755 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 961281-961312 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1004223-1004254 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1274339-1274370 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 961281-961312 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 110115-110146 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 856747-856778 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 961285-961316 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1004223-1004254 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1004223-1004254 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1004223-1004254 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1274339-1274370 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1070766-1070797 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1274328-1274359 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 856747-856778 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 896006-896037 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 876690-876721 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 924634-924665 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 970784-970815 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1180937-1180968 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1274328-1274359 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 856747-856778 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 961281-961312 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1203060-1203091 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1275495-1275526 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 856747-856778 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 856747-856778 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1274339-1274370 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1004225-1004256 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1095687-1095718 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1274350-1274381 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1274328-1274359 9 0.719
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1095687-1095718 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 1820-1851 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1440057-1440088 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 519610-519641 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 5513-5544 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 483517-483548 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MG925347 Microbacterium phage Lucky3, complete genome 29653-29684 9 0.719
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 MG925343 Microbacterium phage Golden, complete genome 29653-29684 9 0.719
NZ_FOJP01000021_1 1.18|34679|32|NZ_FOJP01000021|CRT,PILER-CR 34679-34710 32 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 406442-406473 9 0.719
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP015450 Dietzia lutea strain YIM 80766 plasmid unnamed1, complete sequence 25700-25732 9 0.727
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP037914 Sphingomonas sp. AAP5 plasmid p213, complete sequence 116599-116631 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_AP017657 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence 140786-140818 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 170084-170116 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 268033-268065 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 262103-262135 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 262103-262135 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 262103-262135 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 262103-262135 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 262195-262227 9 0.727
NZ_FOJP01000021_1 1.24|33953|33|NZ_FOJP01000021|PILER-CR 33953-33985 33 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 200784-200816 9 0.727
NZ_FOJP01000021_1 1.27|34137|33|NZ_FOJP01000021|PILER-CR 34137-34169 33 NZ_CP045378 Sulfitobacter sp. THAF37 plasmid pTHAF37_f, complete sequence 19018-19050 9 0.727
NZ_FOJP01000021_1 1.29|34259|33|NZ_FOJP01000021|PILER-CR 34259-34291 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1315266-1315298 9 0.727
NZ_FOJP01000021_1 1.29|34259|33|NZ_FOJP01000021|PILER-CR 34259-34291 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1317744-1317776 9 0.727
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP017300 Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence 265686-265717 9 0.719
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 389390-389421 9 0.719
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 389944-389975 9 0.719
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 45193-45224 9 0.719
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 26115-26146 9 0.719
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 355888-355919 9 0.719
NZ_FOJP01000021_2 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR 45002-45033 32 NZ_CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 31514-31545 9 0.719
NZ_FOJP01000021_2 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR 45063-45094 32 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 620307-620338 9 0.719
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 CP053333 Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence 91670-91701 9 0.719
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 37712-37743 9 0.719
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 227796-227827 9 0.719
NZ_FOJP01000021_1 1.3|33763|32|NZ_FOJP01000021|CRT 33763-33794 32 NZ_CP045855 Agrobacterium sp. MA01 plasmid punnamed1, complete sequence 33885-33916 10 0.688
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 MT639653 Arthrobacter phage Elezi, complete genome 15662-15693 10 0.688
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 MN703413 Arthrobacter phage Powerpuff, complete genome 15731-15762 10 0.688
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 MT024869 Arthrobacter phage Lego, complete genome 15680-15711 10 0.688
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 MT889366 Arthrobacter phage London, complete genome 15662-15693 10 0.688
NZ_FOJP01000021_1 1.4|33824|32|NZ_FOJP01000021|CRT 33824-33855 32 MT024871 Arthrobacter phage YesChef, complete genome 15731-15762 10 0.688
NZ_FOJP01000021_1 1.5|33885|32|NZ_FOJP01000021|CRT 33885-33916 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2349077-2349108 10 0.688
NZ_FOJP01000021_1 1.5|33885|32|NZ_FOJP01000021|CRT 33885-33916 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 973837-973868 10 0.688
NZ_FOJP01000021_1 1.5|33885|32|NZ_FOJP01000021|CRT 33885-33916 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1415792-1415823 10 0.688
NZ_FOJP01000021_1 1.10|34191|32|NZ_FOJP01000021|CRT 34191-34222 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 190854-190885 10 0.688
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 470529-470560 10 0.688
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 381571-381602 10 0.688
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 252541-252572 10 0.688
NZ_FOJP01000021_1 1.13|34374|32|NZ_FOJP01000021|CRT 34374-34405 32 MN694315 Marine virus AFVG_250M710, complete genome 20254-20285 10 0.688
NZ_FOJP01000021_1 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR 34557-34588 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 194257-194288 10 0.688
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1181563-1181595 10 0.697
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 723635-723667 10 0.697
NZ_FOJP01000021_1 1.22|33831|33|NZ_FOJP01000021|PILER-CR 33831-33863 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 950810-950842 10 0.697
NZ_FOJP01000021_1 1.25|34014|34|NZ_FOJP01000021|PILER-CR 34014-34047 34 NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 25156-25189 10 0.706
NZ_FOJP01000021_1 1.29|34259|33|NZ_FOJP01000021|PILER-CR 34259-34291 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 996036-996068 10 0.697
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP016593 Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence 189188-189219 10 0.688
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_017386 Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence 124388-124419 10 0.688
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NC_014621 Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence 91106-91137 10 0.688
NZ_FOJP01000021_2 2.1|44941|32|NZ_FOJP01000021|CRT 44941-44972 32 NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 189196-189227 10 0.688
NZ_FOJP01000021_2 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR 45185-45216 32 NZ_KY680213 Klebsiella aerogenes strain N15-1247 plasmid pN151247-1, complete sequence 2616-2647 10 0.688
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 415210-415241 11 0.656
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 403837-403868 11 0.656
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 460600-460631 11 0.656
NZ_FOJP01000021_1 1.11|34252|32|NZ_FOJP01000021|CRT 34252-34283 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 457804-457835 11 0.656
NZ_FOJP01000021_1 1.23|33892|33|NZ_FOJP01000021|PILER-CR 33892-33924 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2349077-2349109 11 0.667
NZ_FOJP01000021_1 1.29|34259|33|NZ_FOJP01000021|PILER-CR 34259-34291 33 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 470529-470561 11 0.667
NZ_FOJP01000021_1 1.29|34259|33|NZ_FOJP01000021|PILER-CR 34259-34291 33 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 381570-381602 11 0.667
NZ_FOJP01000021_2 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR 45063-45094 32 LR606151 Rhizobium sp. Q54 genome assembly, plasmid: 8 86217-86248 11 0.656

1. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

2. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510984 (Pseudomonas phage BR200, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

3. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

4. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510965 (Pseudomonas phage CF34, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

5. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

6. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

7. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

8. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

9. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

10. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510992 (Pseudomonas phage BR144, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

11. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

12. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

13. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

14. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510968 (Pseudomonas phage CF55, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

15. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

16. spacer 1.8|34069|32|NZ_FOJP01000021|CRT matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 1, identity: 0.969

cacatcatcacgttgcggcgcttgtgctgaat	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggat	Protospacer
*****************************.**

17. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

18. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510984 (Pseudomonas phage BR200, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

19. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

20. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510965 (Pseudomonas phage CF34, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

21. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

22. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

23. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

24. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

25. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

26. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510992 (Pseudomonas phage BR144, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

27. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

28. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

29. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

30. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510968 (Pseudomonas phage CF55, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

31. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

32. spacer 1.26|34076|33|NZ_FOJP01000021|PILER-CR matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 1, identity: 0.97

cacatcatcacgttgcggcgcttgtgctgaatc	CRISPR spacer
cacatcatcacgttgcggcgcttgtgctggatc	Protospacer
*****************************.***

33. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP014801 (Salipiger profundus strain JLT2016 plasmid pTPRO5, complete sequence) position: , mismatch: 5, identity: 0.844

tcgttacgctgcggcagcatgacccggtagaa-	CRISPR spacer
tctttacgctgcggcagcacga-ccggcacaat	Protospacer
** ****************.** ****.* ** 

34. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP015450 (Dietzia lutea strain YIM 80766 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tcagatcggcgcccttgcccgcgcctgcgggc-	CRISPR spacer
tcagatccgtgcccttgcccgcgccc-cgatca	Protospacer
******* *.***************. **. * 

35. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 6, identity: 0.812

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
tcagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
******** **** **********  ** **.  

36. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 6, identity: 0.812

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
agcgcagtgcgctccatctcctcggcaaagcg	Protospacer
* **  .********* ** ************

37. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 6, identity: 0.812

atcg-gcatgcgctccagctgctcggcaaagcg	CRISPR spacer
-tcgcggatgcgctccagcagctcgtcaaagta	Protospacer
 *** * ************ ***** *****..

38. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 6, identity: 0.812

atcggca-tgcgctccagctgctcggcaaagcg	CRISPR spacer
-cgggcattgcgctccacctgctcggcgaagca	Protospacer
 . **** ********* *********.****.

39. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.812

--ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
ggccgg--ccgccgacgatgaagctcttgccgac	Protospacer
  ****  ******.****** ********** .

40. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 6, identity: 0.818

tcagatcggcgcccttgcccgcgcctgcgggcc--	CRISPR spacer
tcagatcgtcgccattgcccgcgc--gctggtcgg	Protospacer
******** **** **********  ** **.*  

41. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP014801 (Salipiger profundus strain JLT2016 plasmid pTPRO5, complete sequence) position: , mismatch: 6, identity: 0.818

tcgttacgctgcggcagcatgacccggtagaac-	CRISPR spacer
tctttacgctgcggcagcacga-ccggcacaatc	Protospacer
** ****************.** ****.* **. 

42. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 6, identity: 0.818

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
agcgcagtgcgctccatctcctcggcaaagcgc	Protospacer
* **  .********* ** *************

43. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 6, identity: 0.818

atcggca-tgcgctccagctgctcggcaaagcgc	CRISPR spacer
-cgggcattgcgctccacctgctcggcgaagcac	Protospacer
 . **** ********* *********.****.*

44. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to MT952845 (Microbacterium phage GardenState, complete genome) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
gcaccctgcccggcgcaatcgaggccctcccc	Protospacer
 ******** ** ***************  * 

45. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

46. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

47. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

48. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

49. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

50. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

51. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

52. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

53. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

54. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
tggcctcgcgcaccgcaatcgaggccatggcg	Protospacer
* .**..****.************** *****

55. spacer 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 6, identity: 0.812

tggagctcgatgccacggcgggcgatagccgc	CRISPR spacer
tggagcgcgatgccgcggcgggcgaagaccgt	Protospacer
****** *******.********** ..***.

56. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.812

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
gaggccatgctgaaagccgtgctgggcggcat	Protospacer
***.** ***************** . .****

57. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tcaaatcggcgctcttgcccgcggcgtggcgc	Protospacer
***.********.********** *   * **

58. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tcaaatcggcgctcttgcccgcggcgtggcgc	Protospacer
***.********.********** *   * **

59. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

60. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

61. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

62. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

63. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tcaggtcggcgctcttgcccgcggcgtggcgc	Protospacer
****.*******.********** *   * **

64. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

65. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

66. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

67. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

-tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
gccaga-cggcgcccgagcccgcgcctgcgcag	Protospacer
 .**** ********  ************* . 

68. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

69. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tcaggtcggcgctcttgcccgcggcgtggcgc	Protospacer
****.*******.********** *   * **

70. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 7, identity: 0.781

tcagatcggcgcccttgcccgcgcctgcgggc--	CRISPR spacer
ccagatcgtcgccattgcccgcgc--gctggtcg	Protospacer
.******* **** **********  ** **.  

71. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.781

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acgatcacctgcggcagcatgacccggcggaa	Protospacer
 ** *   *******************..***

72. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.781

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaa	Protospacer
 ** *.  *******************..***

73. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.781

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaa	Protospacer
 ** *.  *******************..***

74. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.781

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaa	Protospacer
 ** *.  *******************..***

75. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.781

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
ctgcgcatgcgctccagccgctcggcgaacag	Protospacer
 *  **************.*******.**  *

76. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

atcggcatgcgctccagctgctcggcaaagcg-	CRISPR spacer
ctgtgcatgcgctccagatggtcggc-aggcgt	Protospacer
 *  ************* ** ***** *.*** 

77. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
ttcttgcgcgccgcctccatctggccgagctc	Protospacer
 *****.************ ****. ** * *

78. spacer 1.13|34374|32|NZ_FOJP01000021|CRT matches to MN856025 (Bacteriophage sp. isolate 180, complete genome) position: , mismatch: 7, identity: 0.781

cgctggcacaggttcatcagcaggacctcagc	CRISPR spacer
ctaaggcacaggttcagcagcagggcctcaat	Protospacer
*   ************ *******.*****..

79. spacer 1.13|34374|32|NZ_FOJP01000021|CRT matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 7, identity: 0.781

cgctggcacaggttcatcagcagg---acctcagc	CRISPR spacer
cgctggcgcaggttgatcagcaggtgagactc---	Protospacer
*******.****** *********   . ***   

80. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MH697589 (Microbacterium phage Neferthena, complete genome) position: , mismatch: 7, identity: 0.781

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcgttctcgccggcgatgatggccttgccgtc	Protospacer
.** * .************** .********.

81. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MT451984 (Microbacterium phage Nebulous, complete genome) position: , mismatch: 7, identity: 0.781

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcgttctcgccggcgatgatggccttgccgtc	Protospacer
.** * .************** .********.

82. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 7, identity: 0.781

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcgggcgcgccggcgacgatgatcttgccgat	Protospacer
.***   *********.**** ******** *

83. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 7, identity: 0.788

atcg-gcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
-tcgcggatgcgctccagcagctcgtcaaagtag	Protospacer
 *** * ************ ***** *****.. 

84. spacer 1.31|34381|33|NZ_FOJP01000021|PILER-CR matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 7, identity: 0.788

cgctggcacaggttcatcagcagg---acctcagcc	CRISPR spacer
cgctggcgcaggttgatcagcaggtgagactca---	Protospacer
*******.****** *********   . ****   

85. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.781

tcaccctgcgcgccgcaatcgag-gccctggcg	CRISPR spacer
tcaccctgcgcgccgcgctcgagcgcgccatc-	Protospacer
****************. ***** ** *.. * 

86. spacer 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_006552 (Pseudomonas phage F116, complete genome) position: , mismatch: 7, identity: 0.781

cgctgcctgtcacgctccagcttggccgggaa	CRISPR spacer
ccctgcctgccacgctccagcatggtccgcac	Protospacer
* *******.*********** ***.* * * 

87. spacer 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR matches to AY625898 (Pseudomonas aeruginosa phage F116, complete genome) position: , mismatch: 7, identity: 0.781

cgctgcctgtcacgctccagcttggccgggaa	CRISPR spacer
ccctgcctgccacgctccagcatggtccgcac	Protospacer
* *******.*********** ***.* * * 

88. spacer 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 7, identity: 0.781

tggagctcgatgccacggcgggcgatagccgc	CRISPR spacer
acgagatcgatgccacggcgggcgatgcgctc	Protospacer
  *** ********************.  * *

89. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.781

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
gaaagcaacctcaaagccgcgctgcagagcat	Protospacer
**.* *   ** *******.************

90. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 8, identity: 0.75

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
gcagatcggcgcctttgccagcgcccggaagg	Protospacer
 ************.***** *****.* ..* 

91. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
cgaagtcggcgcccgcgcccgcgcctgctgcc	Protospacer
. *..********* .************ * *

92. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
cgaagtcggcgcccgcgcccgcgcctgctgcc	Protospacer
. *..********* .************ * *

93. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
cgaagtcggcgcccgcgcccgcgcctgctgcc	Protospacer
. *..********* .************ * *

94. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 8, identity: 0.75

tcagatcggcgcccttgcccgcgcctgcgggc-	CRISPR spacer
agagatcggcgcgcttgcccccgcc-gagatca	Protospacer
  ********** ******* **** * *. * 

95. spacer 1.5|33885|32|NZ_FOJP01000021|CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 8, identity: 0.75

agggtcgccgactgctcgacgcctgcagggtg	CRISPR spacer
tcggctgccgactgctcggcgccggcaggatc	Protospacer
  **..************.**** *****.* 

96. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
aaatcaggctgcggcaggatcacccggtagag	Protospacer
  .*.* ********** ** **********.

97. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
aaatcaggctgcggcaggatcacccggtagag	Protospacer
  .*.* ********** ** **********.

98. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

99. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

100. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

101. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

102. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

103. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 8, identity: 0.75

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaa	Protospacer
 *. *   *******************..***

104. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NC_021209 (Sinorhizobium sp. M14 plasmid pSinA, complete sequence) position: , mismatch: 8, identity: 0.75

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
cctcgctcgcgctcgagctgctcggcaaagcc	Protospacer
 .. ** .****** **************** 

105. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP045378 (Sulfitobacter sp. THAF37 plasmid pTHAF37_f, complete sequence) position: , mismatch: 8, identity: 0.75

atcgg--catgcgctccagctgctcggcaaagcg	CRISPR spacer
--tggtccatgcggtccagcagctcggcaaactc	Protospacer
  .**  ****** ****** ********** . 

106. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP017191 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence) position: , mismatch: 8, identity: 0.75

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcg	Protospacer
..*.**  .**** **********.*******

107. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP018463 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence) position: , mismatch: 8, identity: 0.75

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcg	Protospacer
..*.**  .**** **********.*******

108. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NC_007507 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence) position: , mismatch: 8, identity: 0.75

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcg	Protospacer
..*.**  .**** **********.*******

109. spacer 1.13|34374|32|NZ_FOJP01000021|CRT matches to MN693401 (Marine virus AFVG_25M126, complete genome) position: , mismatch: 8, identity: 0.75

cgctggcacaggttcatcagcaggacctcagc	CRISPR spacer
gacgggcacaggttcatcagcagggccgtttc	Protospacer
 .* ********************.** .  *

110. spacer 1.14|34435|32|NZ_FOJP01000021|CRT matches to NZ_CP049252 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

tcgccaccttcggactcgctccgaacagcgga	CRISPR spacer
ttttcgccttcggactcgctccgaatagcctt	Protospacer
*. .*.*******************.***   

111. spacer 1.15|34496|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

atcggctggggctggacggtgatcgaagagcg	CRISPR spacer
tccggctggacctggacggtgatcgagacgct	Protospacer
 .*******. ***************.. ** 

112. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP039693 (Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence) position: , mismatch: 8, identity: 0.75

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
acatcaccggcggcgatgatgttcttgcgctt	Protospacer
 *. .**** ***********.******  **

113. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.75

-ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcctgcg-cgccggcgatgatgctttttccggc	Protospacer
 ** *.. ****************.** *** .

114. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_KY000074 (Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence) position: , mismatch: 8, identity: 0.75

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
acatcaccggcggcgatgatgttcttgcgctt	Protospacer
 *. .**** ***********.******  **

115. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MN908686 (Microbacterium phage Zepp, complete genome) position: , mismatch: 8, identity: 0.75

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcgttcgggccggcgatgatgggcttgccgtc	Protospacer
.** *   *************  ********.

116. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MT889377 (Microbacterium phage Zayuliv, complete genome) position: , mismatch: 8, identity: 0.75

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcgttcgggccggcgatgatgggcttgccgtc	Protospacer
.** *   *************  ********.

117. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.758

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acgatcacctgcggcagcatgacccggcggaag	Protospacer
 ** *   *******************..*** 

118. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 8, identity: 0.758

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaag	Protospacer
 ** *.  *******************..*** 

119. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 8, identity: 0.758

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaag	Protospacer
 ** *.  *******************..*** 

120. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 8, identity: 0.758

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acgatgacctgcggcagcatgacccggcggaag	Protospacer
 ** *.  *******************..*** 

121. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.758

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
ctgcgcatgcgctccagccgctcggcgaacagg	Protospacer
 *  **************.*******.**  * 

122. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP017191 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence) position: , mismatch: 8, identity: 0.758

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcgc	Protospacer
..*.**  .**** **********.********

123. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP018463 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence) position: , mismatch: 8, identity: 0.758

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcgc	Protospacer
..*.**  .**** **********.********

124. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NC_007507 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence) position: , mismatch: 8, identity: 0.758

atcggcatgcgctccagctgctcggcaaagcgc	CRISPR spacer
gccagctgacgctgcagctgctcgacaaagcgc	Protospacer
..*.**  .**** **********.********

125. spacer 1.31|34381|33|NZ_FOJP01000021|PILER-CR matches to MN856025 (Bacteriophage sp. isolate 180, complete genome) position: , mismatch: 8, identity: 0.758

cgctggcacaggttcatcagcaggacctcagcc	CRISPR spacer
ctaaggcacaggttcagcagcagggcctcaatt	Protospacer
*   ************ *******.*****...

126. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
gcctgctgcgcgccgccatcgaggccccggac	Protospacer
 * . *********** **********.**  

127. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg--	CRISPR spacer
cgtccctgcgcgtcgcaatggaggcc--ggctgc	Protospacer
.  *********.****** ******  ***   

128. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg--	CRISPR spacer
cgtccctgcgcgtcgcaatggaggcc--ggctgc	Protospacer
.  *********.****** ******  ***   

129. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg--	CRISPR spacer
cgtccctgcgcgtcgcaatggaggcc--ggctgc	Protospacer
.  *********.****** ******  ***   

130. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg--	CRISPR spacer
cgtccctgcgcgtcgcaatggaggcc--ggctgc	Protospacer
.  *********.****** ******  ***   

131. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgaagctgcgcgacgcaatcgcggccctcccg	Protospacer
. *  ******* ******** ******  **

132. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_048860 (Microbacterium phage Arete, complete genome) position: , mismatch: 8, identity: 0.75

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
ccgccctgcgcgccgcgctcgaggccgccgcc	Protospacer
.*.*************. ******** . ** 

133. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tggcgacggcggccttgcccgcgccggcggtg	Protospacer
* . . ***** ************* ****  

134. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
gcggatcggcgccctcgcccgcccctgacact	Protospacer
 *.************.****** ****  . .

135. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
tggcgacggcggccttgcccgcgccggcggtg	Protospacer
* . . ***** ************* ****  

136. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
cgagcccggcgcctttgcccgcgactgcgccg	Protospacer
. ** .*******.********* *****   

137. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
cgagcccggcgcctttgcccgcgactgcgccg	Protospacer
. ** .*******.********* *****   

138. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to NC_048097 (Arthrobacter phage Yang, complete genome) position: , mismatch: 9, identity: 0.719

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
ggtggacggcgcccttgccctcgccagcgccc	Protospacer
   *. ************** **** ***  *

139. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
agatcgggctgcggcaggatgacccgatagag	Protospacer
  .*.. ********** ********.****.

140. spacer 1.6|33946|32|NZ_FOJP01000021|CRT matches to NZ_CP006570 (Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence) position: , mismatch: 9, identity: 0.719

tcgttacgctgcggcagcatgacccggtagaa	CRISPR spacer
ccggcacgctgcggctgcatgtcccggtgagc	Protospacer
.** .********** ***** ******... 

141. spacer 1.7|34007|33|NZ_FOJP01000021|CRT matches to NZ_CP009882 (Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence) position: , mismatch: 9, identity: 0.727

ctggacgttgcgcatggcctgctggccagcgtc	CRISPR spacer
taccacgttgcgcatgaccggctggccatcttt	Protospacer
.   ************.** ******** * *.

142. spacer 1.9|34130|32|NZ_FOJP01000021|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

atcggcatgcgctccagctgctcggcaaagcg	CRISPR spacer
tccgagatgcgctccagcagctcggcgaacgt	Protospacer
 .**. ************ *******.**   

143. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatggc	Protospacer
     *********** ** ********* .*

144. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gcccgtcgtgccgcctccggctggtcgatcac	Protospacer
..*.  .*.*********.****** ******

145. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

146. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

147. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gcccgtcgtgccgcctccggctggtcgatcac	Protospacer
..*.  .*.*********.****** ******

148. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

149. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

150. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

151. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
ttgaccagctccgcctcctgctggtggatctc	Protospacer
 *  .  ** ******** *********** *

152. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

153. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

154. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

155. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

156. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

157. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

158. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

159. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

160. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

161. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

162. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

163. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

164. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

165. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

166. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

167. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

168. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

169. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
ttgaccagctccgcctcctgctggtggatctc	Protospacer
 *  .  ** ******** *********** *

170. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

171. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

172. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

173. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

174. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

175. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

176. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

177. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

178. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

179. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

180. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

181. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
ttgaccagctccgcctcctgctggtggatctc	Protospacer
 *  .  ** ******** *********** *

182. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

183. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

184. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

185. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

186. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

187. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

188. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

189. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

190. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

191. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

192. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

193. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

194. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

195. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

196. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

197. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

198. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

199. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

200. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

201. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

202. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

203. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

204. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

205. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

206. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

207. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

208. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

------atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
gaagacat------cgccgactccagctggtcgatcag	Protospacer
      **      ***** *********** ***** 

209. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcggtagcgccggcaatgatgctcgactagtg	Protospacer
.***** *******.*********   . ** 

210. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
atcgcggcgccggccatgatcctcttgccggt	Protospacer
 . *.. ******* ***** ********* *

211. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcggtagcgccggcaatgatgctcgactagtg	Protospacer
.***** *******.*********   . ** 

212. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tcggtagcgccggcaatgatgctcgactagtg	Protospacer
.***** *******.*********   . ** 

213. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
ccgttaccgcgggcgatgatgctggccacact	Protospacer
*** ****** ************  .  *..*

214. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MG925347 (Microbacterium phage Lucky3, complete genome) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
aggtgagtgcaggcgatgatgatcttgccgtc	Protospacer
  *  * .** ********** *********.

215. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to MG925343 (Microbacterium phage Golden, complete genome) position: , mismatch: 9, identity: 0.719

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
aggtgagtgcaggcgatgatgatcttgccgtc	Protospacer
  *  * .** ********** *********.

216. spacer 1.18|34679|32|NZ_FOJP01000021|CRT,PILER-CR matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 9, identity: 0.719

gcgtcacgtgaccaaaaatcgaattcgggtaa	CRISPR spacer
gcttcacgtgaccaaaaaacgaatataagatt	Protospacer
** *************** ***** ...*   

217. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP015450 (Dietzia lutea strain YIM 80766 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tcagatcggcgcccttgcccgcgcctgcgggcc	CRISPR spacer
tcagatccgtgcccttgcccgcgccccgatcac	Protospacer
******* *.***************.  .   *

218. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 9, identity: 0.727

tcagatcggcgcccttgcccgcgcctgcgggcc	CRISPR spacer
gcagatcggcgcctttgccagcgcccggaaggt	Protospacer
 ************.***** *****.* ..* .

219. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
aaatcaggctgcggcaggatcacccggtagagg	Protospacer
  .*.* ********** ** **********. 

220. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
aaatcaggctgcggcaggatcacccggtagagg	Protospacer
  .*.* ********** ** **********. 

221. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

222. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

223. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

224. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

225. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

226. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
acaatcacctgcggcagcatgacccggcggaag	Protospacer
 *. *   *******************..*** 

227. spacer 1.24|33953|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgttacgctgcggcagcatgacccggtagaac	CRISPR spacer
agatcgggctgcggcaggatgacccgatagagc	Protospacer
  .*.. ********** ********.****.*

228. spacer 1.27|34137|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP045378 (Sulfitobacter sp. THAF37 plasmid pTHAF37_f, complete sequence) position: , mismatch: 9, identity: 0.727

atcgg--catgcgctccagctgctcggcaaagcgc	CRISPR spacer
--tggtccatgcggtccagcagctcggcaaactct	Protospacer
  .**  ****** ****** ********** . .

229. spacer 1.29|34259|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.727

atcttgtgcgccgcctccagctggtggatcacc	CRISPR spacer
gcccgtcgtgccgcctccggctggtcgatcacc	Protospacer
..*.  .*.*********.****** *******

230. spacer 1.29|34259|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.727

atcttgtgcgccgcctccagctggtggatcacc	CRISPR spacer
gcccgtcgtgccgcctccggctggtcgatcacc	Protospacer
..*.  .*.*********.****** *******

231. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
aggcagcacgcgccgcgatcgaggccctgacg	Protospacer
  .*  ..********.************.**

232. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
aggcagcacgcgccgcgatcgaggccctgacg	Protospacer
  .*  ..********.************.**

233. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgttgctgcgcgccgcgatcgagggcctgacc	Protospacer
.  . ***********.******* ****.* 

234. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 9, identity: 0.719

------tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
aggatggca------gcgccggaatcgaggccctgccg	Protospacer
       **      ****** ************* **

235. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
ccgatcaccgcgccgaattcgaggccctggcc	Protospacer
.*. .*  ******* * ************* 

236. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

------tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
aggatggca------gcgccggaatcgaggccctgccg	Protospacer
       **      ****** ************* **

237. spacer 2.2|45002|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

cgctgcctgtcacgctccagcttggccgggaa	CRISPR spacer
cgctgactgtcacggtccagcttgaggatgcg	Protospacer
***** ******** *********.  . * .

238. spacer 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

tggagctcgatgccacggcgggcgatagccgc	CRISPR spacer
attcaccggatgccgcgtcgggcgatagccgc	Protospacer
    .*. ******.** **************

239. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to CP053333 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
tgtcgcctgctgaaagccgtgcggctgagctg	Protospacer
 .   ***************** ** ****  

240. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
catgccctgctgatcgccgtgctgcagaaagg	Protospacer
 * .*********  *************. . 

241. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
catgccctgctgatcgccgtgctgcagaaagg	Protospacer
 * .*********  *************. . 

242. spacer 1.3|33763|32|NZ_FOJP01000021|CRT matches to NZ_CP045855 (Agrobacterium sp. MA01 plasmid punnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgctgggtaagctttcgcgcctccctcaattt	CRISPR spacer
gcctgggtaagttttctcgcctcccgaatgag	Protospacer
  *********.**** ********  *    

243. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 10, identity: 0.688

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
gatggacggcgcccttgccctcgccagcgccg	Protospacer
   *. ************** **** ***   

244. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 10, identity: 0.688

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
ggtggacggcgcccttgccctcgccagcgccg	Protospacer
   *. ************** **** ***   

245. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 10, identity: 0.688

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
ggtggacggcgcccttgccctcgccagcgccg	Protospacer
   *. ************** **** ***   

246. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 10, identity: 0.688

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
ggtggacggcgcccttgccctcgccagcgccg	Protospacer
   *. ************** **** ***   

247. spacer 1.4|33824|32|NZ_FOJP01000021|CRT matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 10, identity: 0.688

tcagatcggcgcccttgcccgcgcctgcgggc	CRISPR spacer
ggtggacggcgcccttgccctcgccagcgccg	Protospacer
   *. ************** **** ***   

248. spacer 1.5|33885|32|NZ_FOJP01000021|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688

agggtcgccgactgctcgacgcctgcagggtg	CRISPR spacer
tctcccgccgacttctcgacgcctgctggaga	Protospacer
    .******** ************ **. .

249. spacer 1.5|33885|32|NZ_FOJP01000021|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

agggtcgccgactgctcgacgcctgcagggtg	CRISPR spacer
aggggcgccgactgcccgacgcccccgtatca	Protospacer
**** **********.*******. *. . ..

250. spacer 1.5|33885|32|NZ_FOJP01000021|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

agggtcgccgactgctcgacgcctgcagggtg	CRISPR spacer
aggggcgccgactgcccgacgcccccgtttca	Protospacer
**** **********.*******. *.   ..

251. spacer 1.10|34191|32|NZ_FOJP01000021|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688

actcggggccggagaattcagaggccagcgag	CRISPR spacer
tcgtcaatccggcgaatgcagaggccagcgaa	Protospacer
 * . .. **** **** *************.

252. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatggg	Protospacer
     *********** ** ********* . 

253. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 10, identity: 0.688

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatggg	Protospacer
     *********** ** ********* . 

254. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
acggccgcggccgcctggagctggtggatcac	Protospacer
*.  .    *******  **************

255. spacer 1.13|34374|32|NZ_FOJP01000021|CRT matches to MN694315 (Marine virus AFVG_250M710, complete genome) position: , mismatch: 10, identity: 0.688

cgctggcacaggttcatcagcaggacctcagc	CRISPR spacer
aactggaacaggttcaacagcaggagatttat	Protospacer
 .**** ********* ********  *. ..

256. spacer 1.16|34557|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 10, identity: 0.688

ccggtaccgccggcgatgatgctcttgccgtt	CRISPR spacer
tagacgtaaccggcgttgaagctcttgccgtt	Protospacer
. *.... .****** *** ************

257. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

tcagatcggcgcccttgcccgcgcctgcgggcc	CRISPR spacer
tggcgacggcggccttgcccgcgccggcggtga	Protospacer
* . . ***** ************* ****   

258. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

tcagatcggcgcccttgcccgcgcctgcgggcc	CRISPR spacer
gcggatcggcgccctcgcccgcccctgacactt	Protospacer
 *.************.****** ****  . ..

259. spacer 1.22|33831|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.697

tcagatcggcgcccttgcccgcgcctgcgggcc	CRISPR spacer
tggcgacggcggccttgcccgcgccggcggtga	Protospacer
* . . ***** ************* ****   

260. spacer 1.25|34014|34|NZ_FOJP01000021|PILER-CR matches to NZ_CP009882 (Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence) position: , mismatch: 10, identity: 0.706

ctggacgttgcgcatggcctgctggccagcgtcc	CRISPR spacer
taccacgttgcgcatgaccggctggccatctttg	Protospacer
.   ************.** ******** * *. 

261. spacer 1.29|34259|33|NZ_FOJP01000021|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.697

atcttgtgcgccgcctccagctggtggatcacc	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatggcg	Protospacer
     *********** ** ********* .* 

262. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgaccctgcgcgccgcgctcgaggcagaaggc	Protospacer
. **************. *******   .*  

263. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgaccctgcgcgccgcgctcgaggcagaaggc	Protospacer
. **************. *******   .*  

264. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgaccctgcgcgccgcgctcgaggcagaaggc	Protospacer
. **************. *******   .*  

265. spacer 2.1|44941|32|NZ_FOJP01000021|CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

tcaccctgcgcgccgcaatcgaggccctggcg	CRISPR spacer
cgaccctgcgcgccgcgctcgaggcagaaggc	Protospacer
. **************. *******   .*  

266. spacer 2.5|45185|32|NZ_FOJP01000021|CRT,PILER-CR matches to NZ_KY680213 (Klebsiella aerogenes strain N15-1247 plasmid pN151247-1, complete sequence) position: , mismatch: 10, identity: 0.688

gagaccctgctgaaagccgtgctgcagagcat	CRISPR spacer
tgccgcctgctgaaagccgtgcggctgaactg	Protospacer
 .   ***************** ** **.*  

267. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggacggg	Protospacer
     *********** ** ********. . 

268. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggacggg	Protospacer
     *********** ** ********. . 

269. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggacggg	Protospacer
     *********** ** ********. . 

270. spacer 1.11|34252|32|NZ_FOJP01000021|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656

atcttgtgcgccgcctccagctggtggatcac	CRISPR spacer
tggaggtgcgccgcctgcatctggtggacggg	Protospacer
     *********** ** ********. . 

271. spacer 1.23|33892|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 11, identity: 0.667

agggtcgccgactgctcgacgcctgcagggtgc	CRISPR spacer
tctcccgccgacttctcgacgcctgctggagat	Protospacer
    .******** ************ **. ..

272. spacer 1.29|34259|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 11, identity: 0.667

atcttgtgcgccgcctccagctggtggatcacc	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatgggg	Protospacer
     *********** ** ********* .  

273. spacer 1.29|34259|33|NZ_FOJP01000021|PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 11, identity: 0.667

atcttgtgcgccgcctccagctggtggatcacc	CRISPR spacer
tggaggtgcgccgcctgcatctggtggatgggg	Protospacer
     *********** ** ********* .  

274. spacer 2.3|45063|32|NZ_FOJP01000021|CRT,PILER-CR matches to LR606151 (Rhizobium sp. Q54 genome assembly, plasmid: 8) position: , mismatch: 11, identity: 0.656

tggagctcgatgccacggcgggcgatagccgc	CRISPR spacer
attggctcgatgccaaggcgggcgctaaggtg	Protospacer
   .*********** ******** **.    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage