Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FOGM01000025 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000032 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000004 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000028 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000027 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_FOGM01000029 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000002 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOGM01000020 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOGM01000019 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000008 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000031 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000012 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_FOGM01000006 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOGM01000010 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000015 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FOGM01000018 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000030 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000007 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FOGM01000005 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs csa3,csm6 0 0 0 0
NZ_FOGM01000021 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOGM01000013 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000009 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000003 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000022 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000033 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000001 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 2 2 2
NZ_FOGM01000026 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000014 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_FOGM01000023 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000024 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FOGM01000011 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FOGM01000017 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FOGM01000016 Streptococcus gallolyticus strain VTM2R47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_FOGM01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14423 : 28604 24 Streptococcus_phage(77.78%) integrase attL 11407:11422|attR 22051:22066
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FOGM01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 170 : 17405 26 Streptococcus_phage(76.19%) integrase attL 4484:4497|attR 18044:18057
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FOGM01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FOGM01000001_1 33919-34086 TypeII NA
2 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FOGM01000001_1 1.1|33955|30|NZ_FOGM01000001|PILER-CR 33955-33984 30 MK448704 Streptococcus phage Javan213, complete genome 17134-17163 2 0.933
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NZ_AP018256 Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome 264336-264365 5 0.833
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 67232-67261 7 0.767
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 MK599315 Pseudomonas phage PA1C, complete genome 66911-66940 7 0.767
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 2815-2844 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 2821-2850 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 2838-2867 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NZ_CP018322 Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence 4247-4276 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 58687-58716 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 58687-58716 8 0.733
NZ_FOGM01000001_1 1.2|34021|30|NZ_FOGM01000001|PILER-CR 34021-34050 30 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 58687-58716 8 0.733

1. spacer 1.1|33955|30|NZ_FOGM01000001|PILER-CR matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 2, identity: 0.933

agatgccaataaccacattgtcgacgcagt	CRISPR spacer
agatgctaataaccacattatcgacgcagt	Protospacer
******.************.**********

2. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 5, identity: 0.833

ttatctgaaattgtagcaggtgagaaatac----	CRISPR spacer
ttatctgaaattgcagcaggt----aatactagt	Protospacer
*************.*******    *****    

3. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 7, identity: 0.767

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
tcattctcaattttagcaggtgagaaatat	Protospacer
*.**..  **** ****************.

4. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 7, identity: 0.767

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
tcattctcaattttagcaggtgagaaatat	Protospacer
*.**..  **** ****************.

5. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
gccagtgaaattgtagcagatgagaaattg	Protospacer
 .   **************.********  

6. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
gccagtgaaattgtagcagatgagaaattg	Protospacer
 .   **************.********  

7. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
gccagtgaaattgtagcagatgagaaattg	Protospacer
 .   **************.********  

8. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NZ_CP018322 (Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
gccagtgaaattgtagcagatgagaaattg	Protospacer
 .   **************.********  

9. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
ttatctgaaattttagcatgtgatttaccg	Protospacer
************ ***** ****   *.  

10. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
ttatctgaaattttagcatgtgatttaccg	Protospacer
************ ***** ****   *.  

11. spacer 1.2|34021|30|NZ_FOGM01000001|PILER-CR matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 8, identity: 0.733

ttatctgaaattgtagcaggtgagaaatac	CRISPR spacer
ttatctgaaattttagcatgtgatttaccg	Protospacer
************ ***** ****   *.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 127 : 27230 27 Streptococcus_phage(85.71%) head,terminase,protease,tail,portal,capsid,holin NA
DBSCAN-SWA_2 203472 : 216017 12 Bacillus_phage(33.33%) tRNA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FOGM01000001.1|WP_074627086.1|21717_22263_+|hypothetical-protein 21717_22263_+ 181 aa aa AcrIIA18 NA NA 127-27230 NA
NZ_FOGM01000001.1|WP_074626943.1|25933_26236_+|hypothetical-protein 25933_26236_+ 100 aa aa AcrIIA17 NA NA 127-27230 NA
4. NZ_FOGM01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5176 8 Streptococcus_phage(57.14%) holin NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FOGM01000027.1|WP_074628305.1|0_455_-|elongation-factor-G 0_455_- 151 aa aa AcrIIA6 NA NA 0-5176 NA
5. NZ_FOGM01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68061 : 79067 17 Streptococcus_phage(92.31%) integrase attL 60055:60067|attR 70331:70343
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FOGM01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 28051 36 Streptococcus_phage(96.55%) terminase,capsid,portal,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FOGM01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 19187 19 Streptococcus_phage(83.33%) protease,terminase,tail,portal,capsid,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FOGM01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53687 : 63683 12 Streptococcus_phage(75.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FOGM01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47832 : 55972 9 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage