| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000071 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000005 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 2 | |
| NZ_FEVL01000055 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000050 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000080 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000066 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000034 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000063 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000003 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000021 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000062 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000037 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000073 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000078 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000060 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000044 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000001 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FEVL01000035 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000043 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000040 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000045 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000023 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000038 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FEVL01000082 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000074 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000016 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000065 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000068 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000002 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_FEVL01000033 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000048 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000004 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000015 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000032 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000025 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000030 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000061 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000020 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000072 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000010 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000058 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000052 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000069 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000042 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000011 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FEVL01000036 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000024 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FEVL01000059 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000064 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000046 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000008 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000057 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000053 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000013 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000039 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000054 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000083 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000076 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000012 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000051 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000077 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000018 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000081 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000075 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000022 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000056 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000079 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000009 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000026 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000047 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 2 | 0 | 0 | 0 | |
| NZ_FEVL01000019 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 2 crisprs | 3 | 1 | 0 | 0 | |
| NZ_FEVL01000067 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000049 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000031 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000028 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000007 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000029 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000041 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000027 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000006 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FEVL01000070 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000014 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEVL01000017 | Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence | 2 crisprs | 2 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000010.1 | 5012-5061 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000015.1 | 50963-51012 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000015.1 | 51115-51164 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000015.1 | 52040-52089 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000020.1 | 31559-31608 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000021.1 | 986-1035 | 0 | 1.0 | |
| NZ_FEVL01000011_1 | 40915-40964 | 50 | NZ_FEVL01000028.1 | 28584-28633 | 0 | 1.0 |
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 118760 : 128008 | 9 | Burkholderia_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEVL01000017_1 | 13461-13615 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEVL01000017_2 | 47848-48004 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000017_2 | 47876-47928 | 53 | NZ_FEVL01000012.1 | 163-215 | 2 | 0.962 | |
| NZ_FEVL01000017_2 | 47876-47928 | 53 | NZ_FEVL01000017.1 | 46594-46646 | 2 | 0.962 | |
| NZ_FEVL01000017_2 | 47876-47928 | 53 | NZ_FEVL01000017.1 | 47446-47498 | 2 | 0.962 | |
| NZ_FEVL01000017_2 | 47876-47928 | 53 | NZ_FEVL01000019.1 | 36322-36374 | 2 | 0.962 | |
| NZ_FEVL01000017_2 | 47876-47928 | 53 | NZ_FEVL01000019.1 | 36626-36678 | 2 | 0.962 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000006.1 | 2617-2658 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 26450-26491 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 29137-29178 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 33262-33303 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 28451-28492 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 28758-28799 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000009.1 | 28913-28954 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 5235-5276 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 11835-11876 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 12443-12484 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 12740-12781 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 14345-14386 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000010.1 | 14931-14972 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000011.1 | 1517-1558 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000012.1 | 17759-17800 | 0 | 1.0 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000012.1 | 555-596 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000015.1 | 51836-51877 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000017.1 | 47225-47266 | 0 | 1.0 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000017.1 | 76-117 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000017.1 | 231-272 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000017.1 | 47655-47696 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000017.1 | 51654-51695 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000018.1 | 50282-50323 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000019.1 | 36381-36422 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000019.1 | 36967-37008 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000019.1 | 36101-36142 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000019.1 | 36836-36877 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000020.1 | 31308-31349 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000020.1 | 31510-31551 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000021.1 | 234-275 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000021.1 | 752-793 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000029.1 | 26857-26898 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000029.1 | 27465-27506 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000029.1 | 27692-27733 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000037.1 | 367-408 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000038.1 | 16178-16219 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000047.1 | 2584-2625 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000047.1 | 2171-2212 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000047.1 | 2739-2780 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000049.1 | 7991-8032 | 0 | 1.0 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000049.1 | 8268-8309 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000049.1 | 8971-9012 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000055.1 | 87-128 | 0 | 1.0 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000055.1 | 242-283 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000055.1 | 373-414 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000079.1 | 316-357 | 1 | 0.976 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000079.1 | 517-558 | 2 | 0.952 | |
| NZ_FEVL01000017_2 | 47957-47998 | 42 | NZ_FEVL01000080.1 | 571-612 | 1 | 0.976 |
tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag CRISPR spacer tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag Protospacer ************************.*********************** ****
tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag CRISPR spacer tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag Protospacer ************************.*********************** ****
tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag CRISPR spacer tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag Protospacer ************************.*********************** ****
tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag CRISPR spacer tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag Protospacer ************************.*********************** ****
tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag CRISPR spacer tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag Protospacer ************************.*********************** ****
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacgaaaacctgca Protospacer ***************************.****.*********
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaacccatccatacggaaacctgca Protospacer ********************.******.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaacccatccatacggaaacctgca Protospacer ********************.******.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatcctcacggaaacctgca Protospacer *************************** .*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctacgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****.***********************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgtacggaaacctgca Protospacer ******************************************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgtacggaaacctgca Protospacer ******************************************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaacctatccgtacggaaacctgca Protospacer ********************.*.*******************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaacctatccgtacggaaacctgca Protospacer ********************.*.*******************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacaaatccatccgcacggaaacctgca Protospacer *****************.**********.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctaca Protospacer ***************************.***********.**
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gccttcgcgggaatgacgaatccatccatacggaaacctgca Protospacer **** **********************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgtacggaaacctgca Protospacer ******************************************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****************************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccattcatacggaaacctgca Protospacer *************************.*.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgtacggaaacctgca Protospacer ******************************************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccgtacgaaaacctgca Protospacer ********************************.*********
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaattcatccgtacggaaacctgca Protospacer *********************.********************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctacgcgggaatgacgaatccatccgcacggaaacctgca Protospacer ****.***********************.*************
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca CRISPR spacer gcctgcgcgggaatgacgaatccatccatacggaaacctgca Protospacer ***************************.**************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000038_1 | 15926-15954 | 29 | NZ_FEVL01000021.1 | 153-181 | 2 | 0.931 | |
| NZ_FEVL01000038_1 | 15926-15954 | 29 | NZ_FEVL01000021.1 | 1187-1215 | 2 | 0.931 |
tagaacgcggggttaagaaaacctgcatc CRISPR spacer taggacgcagggttaagaaaacctgcatc Protospacer ***.****.********************
tagaacgcggggttaagaaaacctgcatc CRISPR spacer taggacgcagggttaagaaaacctgcatc Protospacer ***.****.********************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEVL01000019_1 | 29514-29619 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEVL01000019_2 | 35855-36048 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000019_1 | 29546-29587 | 42 | NZ_FEVL01000021.1 | 671-712 | 0 | 1.0 | |
| NZ_FEVL01000019_1 | 29546-29587 | 42 | NZ_FEVL01000021.1 | 1187-1228 | 1 | 0.976 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000012.1 | 178-206 | 0 | 1.0 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000017.1 | 46603-46631 | 0 | 1.0 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000017.1 | 47455-47483 | 0 | 1.0 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000017.1 | 47605-47633 | 1 | 0.966 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000019.1 | 36331-36359 | 0 | 1.0 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_FEVL01000019.1 | 36635-36663 | 0 | 1.0 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000010.1 | 14915-14985 | 12 | 0.831 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000010.1 | 11822-11892 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000010.1 | 12430-12500 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000010.1 | 12727-12797 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000012.1 | 17743-17813 | 12 | 0.831 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000017.1 | 47642-47712 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000021.1 | 218-288 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000021.1 | 736-806 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000029.1 | 26844-26914 | 12 | 0.831 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000037.1 | 354-424 | 13 | 0.817 | |
| NZ_FEVL01000019_2 | 35974-36044 | 71 | NZ_FEVL01000049.1 | 8255-8325 | 12 | 0.831 |
aaaagcgggaatctaggacgcagggttaagaaaacctacatc CRISPR spacer aaaagcgggaatctaggacgcagggttaagaaaacctacatc Protospacer ******************************************
aaaagcgggaatctaggacgcagggttaagaaaacctacatc CRISPR spacer aaaagcgggaatctaggacgcagggttaagaaaacctgcatc Protospacer *************************************.****
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcactagccaaaaaaaccga Protospacer *****************************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcactagccaaaaaaaccga Protospacer *****************************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcactagccaaaaaaaccga Protospacer *****************************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcattagccaaaaaaaccga Protospacer ************.****************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcactagccaaaaaaaccga Protospacer *****************************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer aatgttgcggcactagccaaaaaaaccga Protospacer *****************************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg Protospacer *****************************************.******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg Protospacer *****.**********************************.*******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg Protospacer *****.**********************************.*******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg Protospacer *****.**********************************.*******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccgcg Protospacer *********************************************************.**
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggactagattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg Protospacer ** *************************************.*******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccgcg Protospacer *****************************************.***************.**
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctggattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg Protospacer *****.***********************************.******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg Protospacer ****************************************.*******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacaaatccatccgcacggaaacctgcaccacg Protospacer ******************************.**********.******************
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg CRISPR spacer ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg Protospacer *****************************************.******************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NC_008712 | Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence | 131458-131486 | 7 | 0.759 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 2157704-2157732 | 7 | 0.759 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_CP023071 | Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence | 2223980-2224008 | 7 | 0.759 | |
| NZ_FEVL01000019_2 | 35900-35928 | 29 | NZ_CP029232 | Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence | 1906642-1906670 | 7 | 0.759 |
aatgttgcggcactagccaaaaaaaccga CRISPR spacer gccatcgcggcagcagccaaaaaaaccga Protospacer . ..*.****** .***************
aatgttgcggcactagccaaaaaaaccga CRISPR spacer cgaattgcggcactaaccaaaagaaccaa Protospacer . .***********.******.****.*
aatgttgcggcactagccaaaaaaaccga CRISPR spacer cgaattgcggcactaaccaaaagaaccaa Protospacer . .***********.******.****.*
aatgttgcggcactagccaaaaaaaccga CRISPR spacer cgaattgcggcactaaccaaaagaaccaa Protospacer . .***********.******.****.*
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 25365 : 33532 | 11 | Staphylococcus_phage(50.0%) | NA | ||
| DBSCAN-SWA_2 | 76585 : 107272 | 36 | Mannheimia_phage(46.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000009.1 | 33463-33501 | 1 | 0.974 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000012.1 | 479-517 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000012.1 | 761-799 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000017.1 | 47027-47065 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000018.1 | 49832-49870 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000018.1 | 50409-50447 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000029.1 | 26659-26697 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000029.1 | 27262-27300 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000029.1 | 27568-27606 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000029.1 | 27819-27857 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000049.1 | 7793-7831 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000049.1 | 8070-8108 | 1 | 0.974 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000055.1 | 6160-6198 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000055.1 | 6383-6421 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000055.1 | 6479-6517 | 0 | 1.0 | |
| NZ_FEVL01000006_1 | 75323-75361 | 39 | NZ_FEVL01000055.1 | 5908-5946 | 1 | 0.974 |
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcacttgttttaagtttcgggtaacttccacttc Protospacer *******.*******************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcacttgttttaagtttcgggtaacttccacttc Protospacer *******.*******************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttctacttc Protospacer *********************************.*****
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEVL01000047_1 | 1954-2013 | 60 | NZ_FEVL01000017.1 | 34666-34725 | 1 | 0.983 | |
| NZ_FEVL01000047_1 | 1954-2013 | 60 | NZ_FEVL01000029.1 | 27050-27109 | 2 | 0.967 | |
| NZ_FEVL01000047_1 | 1954-2013 | 60 | NZ_FEVL01000037.1 | 8852-8911 | 2 | 0.967 | |
| NZ_FEVL01000047_1 | 2040-2103 | 64 | NZ_FEVL01000047.1 | 2923-2986 | 4 | 0.938 | |
| NZ_FEVL01000047_1 | 2040-2103 | 64 | NZ_FEVL01000055.1 | 6061-6124 | 6 | 0.906 |
cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag CRISPR spacer cagaacgtaaaatctgaagaaaccgttttatccgataagtttccgcaccgacagacctag Protospacer *************** ********************************************
cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag CRISPR spacer caggacgaaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag Protospacer ***.*** ****************************************************
cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag CRISPR spacer cagaacgtaaaatctgaagaaaccgttttatccgatacgtttccgcaccgacagacctag Protospacer *************** ********************* **********************
gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc CRISPR spacer gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc Protospacer ************************************************************
gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc CRISPR spacer gcctgcgcgggaatgacgggatttgagattgcggcatttatcgggagcaacagaagccgc Protospacer ***************************.*************************** ****
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 18134 : 24311 | 11 | Burkholderia_virus(33.33%) | attL 15466:15484|attR 27613:27631 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_FEVL01000005.1_42116_42326_+ | No | NA |
| 123 aa aa | NA | NA | NZ_FEVL01000005.1_42116_42326_+ | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|