Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FEVL01000071 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000005 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 2
NZ_FEVL01000055 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000050 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000080 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000066 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000034 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000063 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000003 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FEVL01000021 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FEVL01000062 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000037 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000073 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000078 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000060 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000044 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000001 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FEVL01000035 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000043 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000040 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000045 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000023 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000038 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FEVL01000082 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000074 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000016 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000065 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000068 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000002 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_FEVL01000033 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs c2c4_V-U1 0 0 0 0
NZ_FEVL01000048 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000004 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000015 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000032 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000025 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000030 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000061 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FEVL01000020 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000072 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000010 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000058 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000052 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000069 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000042 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000011 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FEVL01000036 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000024 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FEVL01000059 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000064 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000046 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000008 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_FEVL01000057 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000053 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000013 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000039 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000054 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000083 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000076 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000012 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000051 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000077 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000018 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000081 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000075 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000022 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000056 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000079 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000009 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_FEVL01000026 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000047 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 2 0 0 0
NZ_FEVL01000019 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 2 crisprs NA 3 1 0 0
NZ_FEVL01000067 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000049 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000031 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000028 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000007 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FEVL01000029 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000041 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000027 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000006 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FEVL01000070 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000014 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEVL01000017 Neisseria meningitidis strain 2842STDY5881257, whole genome shotgun sequence 2 crisprs DEDDh 2 0 0 0

Results visualization

1. NZ_FEVL01000055
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FEVL01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000011_1 40819-40990 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000010.1 5012-5061 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000015.1 50963-51012 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000015.1 51115-51164 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000015.1 52040-52089 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000020.1 31559-31608 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000021.1 986-1035 0 1.0
NZ_FEVL01000011_1 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder 40915-40964 50 NZ_FEVL01000028.1 28584-28633 0 1.0

1. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 5012-5061, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

2. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 50963-51012, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

3. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 51115-51164, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

4. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 52040-52089, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

5. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 31559-31608, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

6. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 986-1035, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

7. spacer 1.2|40915|50|NZ_FEVL01000011|CRISPRCasFinder matches to position: 28584-28633, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FEVL01000080
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FEVL01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FEVL01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FEVL01000079
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FEVL01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FEVL01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 118760 : 128008 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FEVL01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000017_1 13461-13615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000017_2 47848-48004 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000017_2 2.1|47876|53|NZ_FEVL01000017|PILER-CR 47876-47928 53 NZ_FEVL01000012.1 163-215 2 0.962
NZ_FEVL01000017_2 2.1|47876|53|NZ_FEVL01000017|PILER-CR 47876-47928 53 NZ_FEVL01000017.1 46594-46646 2 0.962
NZ_FEVL01000017_2 2.1|47876|53|NZ_FEVL01000017|PILER-CR 47876-47928 53 NZ_FEVL01000017.1 47446-47498 2 0.962
NZ_FEVL01000017_2 2.1|47876|53|NZ_FEVL01000017|PILER-CR 47876-47928 53 NZ_FEVL01000019.1 36322-36374 2 0.962
NZ_FEVL01000017_2 2.1|47876|53|NZ_FEVL01000017|PILER-CR 47876-47928 53 NZ_FEVL01000019.1 36626-36678 2 0.962
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000006.1 2617-2658 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 26450-26491 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 29137-29178 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 33262-33303 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 28451-28492 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 28758-28799 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000009.1 28913-28954 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 5235-5276 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 11835-11876 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 12443-12484 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 12740-12781 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 14345-14386 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000010.1 14931-14972 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000011.1 1517-1558 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000012.1 17759-17800 0 1.0
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000012.1 555-596 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000015.1 51836-51877 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000017.1 47225-47266 0 1.0
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000017.1 76-117 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000017.1 231-272 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000017.1 47655-47696 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000017.1 51654-51695 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000018.1 50282-50323 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000019.1 36381-36422 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000019.1 36967-37008 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000019.1 36101-36142 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000019.1 36836-36877 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000020.1 31308-31349 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000020.1 31510-31551 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000021.1 234-275 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000021.1 752-793 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000029.1 26857-26898 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000029.1 27465-27506 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000029.1 27692-27733 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000037.1 367-408 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000038.1 16178-16219 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000047.1 2584-2625 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000047.1 2171-2212 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000047.1 2739-2780 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000049.1 7991-8032 0 1.0
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000049.1 8268-8309 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000049.1 8971-9012 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000055.1 87-128 0 1.0
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000055.1 242-283 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000055.1 373-414 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000079.1 316-357 1 0.976
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000079.1 517-558 2 0.952
NZ_FEVL01000017_2 2.2|47957|42|NZ_FEVL01000017|PILER-CR 47957-47998 42 NZ_FEVL01000080.1 571-612 1 0.976

1. spacer 2.1|47876|53|NZ_FEVL01000017|PILER-CR matches to position: 163-215, mismatch: 2, identity: 0.962

tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag	CRISPR spacer
tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag	Protospacer
************************.*********************** ****

2. spacer 2.1|47876|53|NZ_FEVL01000017|PILER-CR matches to position: 46594-46646, mismatch: 2, identity: 0.962

tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag	CRISPR spacer
tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag	Protospacer
************************.*********************** ****

3. spacer 2.1|47876|53|NZ_FEVL01000017|PILER-CR matches to position: 47446-47498, mismatch: 2, identity: 0.962

tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag	CRISPR spacer
tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag	Protospacer
************************.*********************** ****

4. spacer 2.1|47876|53|NZ_FEVL01000017|PILER-CR matches to position: 36322-36374, mismatch: 2, identity: 0.962

tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag	CRISPR spacer
tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag	Protospacer
************************.*********************** ****

5. spacer 2.1|47876|53|NZ_FEVL01000017|PILER-CR matches to position: 36626-36678, mismatch: 2, identity: 0.962

tagaaatttaatgttgcggcactaaccaaaaaaaccgaaaccgaacggtctag	CRISPR spacer
tagaaatttaatgttgcggcactagccaaaaaaaccgaaaccgaacggactag	Protospacer
************************.*********************** ****

6. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 2617-2658, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacgaaaacctgca	Protospacer
***************************.****.*********

7. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 26450-26491, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

8. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 29137-29178, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

9. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 33262-33303, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

10. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 28451-28492, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaacccatccatacggaaacctgca	Protospacer
********************.******.**************

11. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 28758-28799, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaacccatccatacggaaacctgca	Protospacer
********************.******.**************

12. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 28913-28954, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatcctcacggaaacctgca	Protospacer
*************************** .*************

13. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 5235-5276, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

14. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 11835-11876, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

15. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 12443-12484, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

16. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 12740-12781, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

17. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 14345-14386, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

18. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 14931-14972, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

19. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 1517-1558, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctacgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****.***********************.*************

20. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 17759-17800, mismatch: 0, identity: 1.0

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	Protospacer
******************************************

21. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 555-596, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

22. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 51836-51877, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

23. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 47225-47266, mismatch: 0, identity: 1.0

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	Protospacer
******************************************

24. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 76-117, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

25. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 231-272, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

26. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 47655-47696, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

27. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 51654-51695, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

28. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 50282-50323, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

29. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 36381-36422, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

30. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 36967-37008, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

31. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 36101-36142, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaacctatccgtacggaaacctgca	Protospacer
********************.*.*******************

32. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 36836-36877, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaacctatccgtacggaaacctgca	Protospacer
********************.*.*******************

33. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 31308-31349, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

34. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 31510-31551, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

35. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 234-275, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

36. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 752-793, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

37. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 26857-26898, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

38. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 27465-27506, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

39. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 27692-27733, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

40. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 367-408, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacaaatccatccgcacggaaacctgca	Protospacer
*****************.**********.*************

41. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 16178-16219, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

42. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 2584-2625, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

43. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 2171-2212, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctaca	Protospacer
***************************.***********.**

44. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 2739-2780, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gccttcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
**** **********************.**************

45. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 7991-8032, mismatch: 0, identity: 1.0

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	Protospacer
******************************************

46. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 8268-8309, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****************************.*************

47. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 8971-9012, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccattcatacggaaacctgca	Protospacer
*************************.*.**************

48. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 87-128, mismatch: 0, identity: 1.0

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	Protospacer
******************************************

49. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 242-283, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccgtacgaaaacctgca	Protospacer
********************************.*********

50. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 373-414, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaattcatccgtacggaaacctgca	Protospacer
*********************.********************

51. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 316-357, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

52. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 517-558, mismatch: 2, identity: 0.952

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctacgcgggaatgacgaatccatccgcacggaaacctgca	Protospacer
****.***********************.*************

53. spacer 2.2|47957|42|NZ_FEVL01000017|PILER-CR matches to position: 571-612, mismatch: 1, identity: 0.976

gcctgcgcgggaatgacgaatccatccgtacggaaacctgca	CRISPR spacer
gcctgcgcgggaatgacgaatccatccatacggaaacctgca	Protospacer
***************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FEVL01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FEVL01000038
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000038_1 15900-15980 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000038_1 1.1|15926|29|NZ_FEVL01000038|CRISPRCasFinder 15926-15954 29 NZ_FEVL01000021.1 153-181 2 0.931
NZ_FEVL01000038_1 1.1|15926|29|NZ_FEVL01000038|CRISPRCasFinder 15926-15954 29 NZ_FEVL01000021.1 1187-1215 2 0.931

1. spacer 1.1|15926|29|NZ_FEVL01000038|CRISPRCasFinder matches to position: 153-181, mismatch: 2, identity: 0.931

tagaacgcggggttaagaaaacctgcatc	CRISPR spacer
taggacgcagggttaagaaaacctgcatc	Protospacer
***.****.********************

2. spacer 1.1|15926|29|NZ_FEVL01000038|CRISPRCasFinder matches to position: 1187-1215, mismatch: 2, identity: 0.931

tagaacgcggggttaagaaaacctgcatc	CRISPR spacer
taggacgcagggttaagaaaacctgcatc	Protospacer
***.****.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FEVL01000019
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000019_1 29514-29619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000019_2 35855-36048 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000019_1 1.1|29546|42|NZ_FEVL01000019|CRISPRCasFinder 29546-29587 42 NZ_FEVL01000021.1 671-712 0 1.0
NZ_FEVL01000019_1 1.1|29546|42|NZ_FEVL01000019|CRISPRCasFinder 29546-29587 42 NZ_FEVL01000021.1 1187-1228 1 0.976
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000012.1 178-206 0 1.0
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000017.1 46603-46631 0 1.0
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000017.1 47455-47483 0 1.0
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000017.1 47605-47633 1 0.966
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000019.1 36331-36359 0 1.0
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_FEVL01000019.1 36635-36663 0 1.0
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000010.1 14915-14985 12 0.831
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000010.1 11822-11892 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000010.1 12430-12500 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000010.1 12727-12797 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000012.1 17743-17813 12 0.831
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000017.1 47642-47712 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000021.1 218-288 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000021.1 736-806 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000029.1 26844-26914 12 0.831
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000037.1 354-424 13 0.817
NZ_FEVL01000019_2 2.2|35974|71|NZ_FEVL01000019|PILER-CR 35974-36044 71 NZ_FEVL01000049.1 8255-8325 12 0.831

1. spacer 1.1|29546|42|NZ_FEVL01000019|CRISPRCasFinder matches to position: 671-712, mismatch: 0, identity: 1.0

aaaagcgggaatctaggacgcagggttaagaaaacctacatc	CRISPR spacer
aaaagcgggaatctaggacgcagggttaagaaaacctacatc	Protospacer
******************************************

2. spacer 1.1|29546|42|NZ_FEVL01000019|CRISPRCasFinder matches to position: 1187-1228, mismatch: 1, identity: 0.976

aaaagcgggaatctaggacgcagggttaagaaaacctacatc	CRISPR spacer
aaaagcgggaatctaggacgcagggttaagaaaacctgcatc	Protospacer
*************************************.****

3. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 178-206, mismatch: 0, identity: 1.0

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcactagccaaaaaaaccga	Protospacer
*****************************

4. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 46603-46631, mismatch: 0, identity: 1.0

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcactagccaaaaaaaccga	Protospacer
*****************************

5. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 47455-47483, mismatch: 0, identity: 1.0

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcactagccaaaaaaaccga	Protospacer
*****************************

6. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 47605-47633, mismatch: 1, identity: 0.966

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcattagccaaaaaaaccga	Protospacer
************.****************

7. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 36331-36359, mismatch: 0, identity: 1.0

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcactagccaaaaaaaccga	Protospacer
*****************************

8. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to position: 36635-36663, mismatch: 0, identity: 1.0

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
aatgttgcggcactagccaaaaaaaccga	Protospacer
*****************************

9. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 14915-14985, mismatch: 12, identity: 0.831

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg	Protospacer
*****************************************.******************

10. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 11822-11892, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg	Protospacer
*****.**********************************.*******************

11. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 12430-12500, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg	Protospacer
*****.**********************************.*******************

12. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 12727-12797, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctggattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg	Protospacer
*****.**********************************.*******************

13. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 17743-17813, mismatch: 12, identity: 0.831

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccgcg	Protospacer
*********************************************************.**

14. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 47642-47712, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggactagattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg	Protospacer
** *************************************.*******************

15. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 218-288, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccgcg	Protospacer
*****************************************.***************.**

16. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 736-806, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctggattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg	Protospacer
*****.***********************************.******************

17. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 26844-26914, mismatch: 12, identity: 0.831

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacgaatccatccatacggaaacctgcaccacg	Protospacer
****************************************.*******************

18. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 354-424, mismatch: 13, identity: 0.817

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacaaatccatccgcacggaaacctgcaccacg	Protospacer
******************************.**********.******************

19. spacer 2.2|35974|71|NZ_FEVL01000019|PILER-CR matches to position: 8255-8325, mismatch: 12, identity: 0.831

ggtctagattcccgcctgcgcgggaatgacgaatccatccgtacggaaacctgcaccacg	CRISPR spacer
ggtctagattcccgcctgcgcgggaatgacgaatccatccgcacggaaacctgcaccacg	Protospacer
*****************************************.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 131458-131486 7 0.759
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2157704-2157732 7 0.759
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2223980-2224008 7 0.759
NZ_FEVL01000019_2 2.1|35900|29|NZ_FEVL01000019|PILER-CR 35900-35928 29 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1906642-1906670 7 0.759

1. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 7, identity: 0.759

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
gccatcgcggcagcagccaaaaaaaccga	Protospacer
. ..*.****** .***************

2. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.759

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
cgaattgcggcactaaccaaaagaaccaa	Protospacer
 . .***********.******.****.*

3. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.759

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
cgaattgcggcactaaccaaaagaaccaa	Protospacer
 . .***********.******.****.*

4. spacer 2.1|35900|29|NZ_FEVL01000019|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.759

aatgttgcggcactagccaaaaaaaccga	CRISPR spacer
cgaattgcggcactaaccaaaagaaccaa	Protospacer
 . .***********.******.****.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_FEVL01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25365 : 33532 11 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 76585 : 107272 36 Mannheimia_phage(46.67%) plate,tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_FEVL01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000006_1 75290-75394 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000009.1 33463-33501 1 0.974
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000012.1 479-517 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000012.1 761-799 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000017.1 47027-47065 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000018.1 49832-49870 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000018.1 50409-50447 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000029.1 26659-26697 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000029.1 27262-27300 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000029.1 27568-27606 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000029.1 27819-27857 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000049.1 7793-7831 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000049.1 8070-8108 1 0.974
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000055.1 6160-6198 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000055.1 6383-6421 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000055.1 6479-6517 0 1.0
NZ_FEVL01000006_1 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder 75323-75361 39 NZ_FEVL01000055.1 5908-5946 1 0.974

1. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 33463-33501, mismatch: 1, identity: 0.974

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcacttgttttaagtttcgggtaacttccacttc	Protospacer
*******.*******************************

2. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 479-517, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

3. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 761-799, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

4. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 47027-47065, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

5. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 49832-49870, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

6. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 50409-50447, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

7. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 26659-26697, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

8. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 27262-27300, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

9. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 27568-27606, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

10. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 27819-27857, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

11. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 7793-7831, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

12. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 8070-8108, mismatch: 1, identity: 0.974

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcacttgttttaagtttcgggtaacttccacttc	Protospacer
*******.*******************************

13. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 6160-6198, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

14. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 6383-6421, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

15. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 6479-6517, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

16. spacer 1.1|75323|39|NZ_FEVL01000006|CRISPRCasFinder matches to position: 5908-5946, mismatch: 1, identity: 0.974

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttctacttc	Protospacer
*********************************.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_FEVL01000047
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000047_1 1928-2109 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEVL01000047_1 1.1|1954|60|NZ_FEVL01000047|PILER-CR 1954-2013 60 NZ_FEVL01000017.1 34666-34725 1 0.983
NZ_FEVL01000047_1 1.1|1954|60|NZ_FEVL01000047|PILER-CR 1954-2013 60 NZ_FEVL01000029.1 27050-27109 2 0.967
NZ_FEVL01000047_1 1.1|1954|60|NZ_FEVL01000047|PILER-CR 1954-2013 60 NZ_FEVL01000037.1 8852-8911 2 0.967
NZ_FEVL01000047_1 1.2|2040|64|NZ_FEVL01000047|PILER-CR 2040-2103 64 NZ_FEVL01000047.1 2923-2986 4 0.938
NZ_FEVL01000047_1 1.2|2040|64|NZ_FEVL01000047|PILER-CR 2040-2103 64 NZ_FEVL01000055.1 6061-6124 6 0.906

1. spacer 1.1|1954|60|NZ_FEVL01000047|PILER-CR matches to position: 34666-34725, mismatch: 1, identity: 0.983

cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag	CRISPR spacer
cagaacgtaaaatctgaagaaaccgttttatccgataagtttccgcaccgacagacctag	Protospacer
*************** ********************************************

2. spacer 1.1|1954|60|NZ_FEVL01000047|PILER-CR matches to position: 27050-27109, mismatch: 2, identity: 0.967

cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag	CRISPR spacer
caggacgaaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag	Protospacer
***.*** ****************************************************

3. spacer 1.1|1954|60|NZ_FEVL01000047|PILER-CR matches to position: 8852-8911, mismatch: 2, identity: 0.967

cagaacgtaaaatctcaagaaaccgttttatccgataagtttccgcaccgacagacctag	CRISPR spacer
cagaacgtaaaatctgaagaaaccgttttatccgatacgtttccgcaccgacagacctag	Protospacer
*************** ********************* **********************

4. spacer 1.2|2040|64|NZ_FEVL01000047|PILER-CR matches to position: 2923-2986, mismatch: 4, identity: 0.938

gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc	CRISPR spacer
gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc	Protospacer
************************************************************

5. spacer 1.2|2040|64|NZ_FEVL01000047|PILER-CR matches to position: 6061-6124, mismatch: 6, identity: 0.906

gcctgcgcgggaatgacgggatttgaggttgcggcatttatcgggagcaacagaatccgc	CRISPR spacer
gcctgcgcgggaatgacgggatttgagattgcggcatttatcgggagcaacagaagccgc	Protospacer
***************************.*************************** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_FEVL01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000009_1 3806-3903 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_FEVL01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_FEVL01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_FEVL01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000007_1 28447-28545 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_FEVL01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18134 : 24311 11 Burkholderia_virus(33.33%) integrase attL 15466:15484|attR 27613:27631
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_FEVL01000061
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEVL01000061_1 2392-2509 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_FEVL01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FEVL01000005.1|WP_042743676.1|41356_41707_+|anti-CRISPR-protein-AcrIIC3 41356_41707_+ 116 aa aa AcrIIC3 NA NZ_FEVL01000005.1_42116_42326_+ No NA
NZ_FEVL01000005.1|WP_042743678.1|41752_42124_+|anti-CRISPR-protein-AcrIIC2 41752_42124_+ 123 aa aa NA NA NZ_FEVL01000005.1_42116_42326_+ No NA
23. NZ_FEVL01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_FEVL01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_FEVL01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_FEVL01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage