Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FEZK01000002 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000048 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000022 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000003 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000067 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000028 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 2 crisprs NA 3 2 0 0
NZ_FEZK01000074 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000019 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000058 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000031 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000071 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000077 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000020 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000046 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000034 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs c2c4_V-U1 0 0 0 0
NZ_FEZK01000050 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000044 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000060 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000070 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000072 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000010 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000012 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FEZK01000076 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000062 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000061 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000017 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000015 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000005 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_FEZK01000040 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000042 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000056 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000069 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000006 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000025 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FEZK01000001 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_FEZK01000045 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000009 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 3 crisprs cas3 4 0 0 0
NZ_FEZK01000029 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000035 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000037 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000021 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000038 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000051 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000008 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FEZK01000063 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000039 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000041 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000014 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FEZK01000068 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000053 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000036 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FEZK01000059 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000064 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000027 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000066 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000075 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000052 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000054 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000047 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000073 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000024 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000057 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000030 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000049 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000033 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000007 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 1 crisprs WYL 0 0 0 0
NZ_FEZK01000016 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 1 crisprs NA 1 1 0 0
NZ_FEZK01000043 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000055 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000018 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000011 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_FEZK01000026 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000023 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000032 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 2 crisprs NA 3 0 0 0
NZ_FEZK01000013 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FEZK01000004 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_FEZK01000065 Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_FEZK01000071
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FEZK01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FEZK01000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000028_1 3556-3657 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000028_2 4108-4311 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEZK01000028_1 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder 3590-3623 34 NZ_FEZK01000054.1 1236-1269 2 0.941
NZ_FEZK01000028_1 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder 3590-3623 34 NZ_FEZK01000054.1 1480-1513 2 0.941
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000002.1 142479-142510 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000002.1 142759-142790 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000002.1 142890-142921 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000002.1 143171-143202 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000002.1 143302-143333 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000010.1 537-568 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000010.1 1093-1124 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000010.1 871-902 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000012.1 111-142 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000012.1 309-340 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000013.1 12858-12889 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000014.1 1270-1301 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000014.1 384-415 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000014.1 973-1004 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000014.1 1421-1452 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000022.1 1008-1039 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000022.1 1211-1242 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000028.1 4312-4343 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000035.1 14683-14714 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000038.1 13430-13461 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000038.1 13731-13762 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000038.1 14132-14163 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000038.1 13953-13984 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000038.1 14414-14445 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000047.1 5952-5983 1 0.969
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000047.1 93-124 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000060.1 1689-1720 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000071.1 34-65 2 0.938
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_FEZK01000071.1 185-216 2 0.938
NZ_FEZK01000028_2 2.2|4244|64|NZ_FEZK01000028|PILER-CR 4244-4307 64 NZ_FEZK01000002.1 138492-138555 5 0.922
NZ_FEZK01000028_2 2.2|4244|64|NZ_FEZK01000028|PILER-CR 4244-4307 64 NZ_FEZK01000002.1 57987-58050 6 0.906
NZ_FEZK01000028_2 2.2|4244|64|NZ_FEZK01000028|PILER-CR 4244-4307 64 NZ_FEZK01000014.1 857-920 6 0.906
NZ_FEZK01000028_2 2.2|4244|64|NZ_FEZK01000028|PILER-CR 4244-4307 64 NZ_FEZK01000038.1 13615-13678 5 0.922
NZ_FEZK01000028_2 2.2|4244|64|NZ_FEZK01000028|PILER-CR 4244-4307 64 NZ_FEZK01000054.1 890-953 6 0.906

1. spacer 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder matches to position: 1236-1269, mismatch: 2, identity: 0.941

gggataacagcaatattcaaagtttataaaagac	CRISPR spacer
gggataacggcaatattcaaaggttataaaagac	Protospacer
********.************* ***********

2. spacer 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder matches to position: 1480-1513, mismatch: 2, identity: 0.941

gggataacagcaatattcaaagtttataaaagac	CRISPR spacer
gggataacggcaatattcaaaggttataaaagac	Protospacer
********.************* ***********

3. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 142479-142510, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

4. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 142759-142790, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

5. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 142890-142921, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

6. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 143171-143202, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

7. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 143302-143333, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

8. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 537-568, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

9. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1093-1124, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

10. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 871-902, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

11. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 111-142, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaagaaactg	Protospacer
******.******************.******

12. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 309-340, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaagaaactg	Protospacer
******.******************.******

13. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 12858-12889, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

14. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1270-1301, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

15. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 384-415, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

16. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 973-1004, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

17. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1421-1452, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

18. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1008-1039, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

19. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1211-1242, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

20. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 4312-4343, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

21. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 14683-14714, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

22. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 13430-13461, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

23. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 13731-13762, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

24. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 14132-14163, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

25. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 13953-13984, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

26. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 14414-14445, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

27. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 5952-5983, mismatch: 1, identity: 0.969

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcaaaaaactg	Protospacer
******.*************************

28. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 93-124, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcgggaatgactgaaactcgaaaaactg	Protospacer
******.****************.********

29. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 1689-1720, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

30. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 34-65, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

31. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to position: 185-216, mismatch: 2, identity: 0.938

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
tttatcggaaatgactgaaactcaaaaaactg	Protospacer
******.*.***********************

32. spacer 2.2|4244|64|NZ_FEZK01000028|PILER-CR matches to position: 138492-138555, mismatch: 5, identity: 0.922

actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	CRISPR spacer
actttcgtgggaatgacgggatgtaggttcgtaggaatgacgtggtgcaggtttccgtgc	Protospacer
********************************.***************************

33. spacer 2.2|4244|64|NZ_FEZK01000028|PILER-CR matches to position: 57987-58050, mismatch: 6, identity: 0.906

actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	CRISPR spacer
actttcgtgggaatgacagaatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	Protospacer
*****************.*.****************************************

34. spacer 2.2|4244|64|NZ_FEZK01000028|PILER-CR matches to position: 857-920, mismatch: 6, identity: 0.906

actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	CRISPR spacer
actttcgtgggaatgacggaatgtaggttcgtgggaatgacgcggtgcaggtttccgtgc	Protospacer
*******************.**********************.*****************

35. spacer 2.2|4244|64|NZ_FEZK01000028|PILER-CR matches to position: 13615-13678, mismatch: 5, identity: 0.922

actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	CRISPR spacer
actttcgtgggaatgacggaatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	Protospacer
*******************.****************************************

36. spacer 2.2|4244|64|NZ_FEZK01000028|PILER-CR matches to position: 890-953, mismatch: 6, identity: 0.906

actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc	CRISPR spacer
actttcgtgggaatgacgggatgtaggttcgcgggaatgacgcggtgcaggtttccgtgc	Protospacer
*******************************.**********.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 126753-126784 8 0.75
NZ_FEZK01000028_2 2.1|4160|32|NZ_FEZK01000028|PILER-CR 4160-4191 32 MH579717 Pelagibacter phage HTVC021P, complete genome 15421-15452 10 0.688
NZ_FEZK01000028_1 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder 3590-3623 34 NZ_LR699116 Aquicella lusitana strain SGT-39 plasmid 3 2708-2741 11 0.676

1. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 8, identity: 0.75

--tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
ggataat--aaaatgactgaaactgaaaacactg	Protospacer
   * **  ..************* **** ****

2. spacer 2.1|4160|32|NZ_FEZK01000028|PILER-CR matches to MH579717 (Pelagibacter phage HTVC021P, complete genome) position: , mismatch: 10, identity: 0.688

tttatcaggaatgactgaaactcaaaaaactg	CRISPR spacer
ctatgaaggaatgcctgaaacacaaaaaaaat	Protospacer
.*    ******* ******* *******   

3. spacer 1.1|3590|34|NZ_FEZK01000028|CRISPRCasFinder matches to NZ_LR699116 (Aquicella lusitana strain SGT-39 plasmid 3) position: , mismatch: 11, identity: 0.676

gggataacagcaatattcaaagtttataaaagac	CRISPR spacer
ccaaagttagaaatattcaaattttataaaagga	Protospacer
  .* . .** ********** **********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FEZK01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FEZK01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FEZK01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FEZK01000060
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FEZK01000056
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FEZK01000047
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FEZK01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FEZK01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FEZK01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_FEZK01000016
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000016_1 37306-37425 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEZK01000016_1 1.1|37350|32|NZ_FEZK01000016|CRISPRCasFinder 37350-37381 32 NZ_FEZK01000016.1 37275-37306 1 0.969

1. spacer 1.1|37350|32|NZ_FEZK01000016|CRISPRCasFinder matches to position: 37275-37306, mismatch: 1, identity: 0.969

cagtaaccgaaaaaccacgggaatctatcgga	CRISPR spacer
cagtaaccgaaaaaccacaggaatctatcgga	Protospacer
******************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FEZK01000016_1 1.1|37350|32|NZ_FEZK01000016|CRISPRCasFinder 37350-37381 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1199362-1199393 8 0.75

1. spacer 1.1|37350|32|NZ_FEZK01000016|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

cagtaacc-gaaaaaccacgggaatctatcgga	CRISPR spacer
-gctggctggaaaaaccaccggaatccatcgga	Protospacer
 . *..*. ********** ******.******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_FEZK01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_FEZK01000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_FEZK01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 70446 : 80439 17 Vibrio_phage(25.0%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FEZK01000005.1|WP_042743676.1|41369_41720_+|anti-CRISPR-protein-AcrIIC3 41369_41720_+ 116 aa aa AcrIIC3 NA NZ_FEZK01000005.1_42129_42339_+ No NA
NZ_FEZK01000005.1|WP_042743678.1|41765_42137_+|anti-CRISPR-protein-AcrIIC2 41765_42137_+ 123 aa aa NA NA NZ_FEZK01000005.1_42129_42339_+ No NA
17. NZ_FEZK01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_FEZK01000054
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_FEZK01000032
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000032_1 20819-21000 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000032_2 21096-21197 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEZK01000032_1 1.2|20919|56|NZ_FEZK01000032|CRISPRCasFinder 20919-20974 56 NZ_FEZK01000017.1 43189-43244 0 1.0
NZ_FEZK01000032_1 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder 20844-20893 50 NZ_FEZK01000017.1 43270-43319 1 0.98
NZ_FEZK01000032_1 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder 20844-20893 50 NZ_FEZK01000049.1 5630-5679 1 0.98
NZ_FEZK01000032_1 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder 20844-20893 50 NZ_FEZK01000049.1 5907-5956 1 0.98
NZ_FEZK01000032_2 2.1|21121|52|NZ_FEZK01000032|CRISPRCasFinder 21121-21172 52 NZ_FEZK01000056.1 2626-2677 2 0.962

1. spacer 1.2|20919|56|NZ_FEZK01000032|CRISPRCasFinder matches to position: 43189-43244, mismatch: 0, identity: 1.0

cagaacgtaaaatctaaagaaaccgtttttcccgacaagtttctgtgccgacaaac	CRISPR spacer
cagaacgtaaaatctaaagaaaccgtttttcccgacaagtttctgtgccgacaaac	Protospacer
********************************************************

2. spacer 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder matches to position: 43270-43319, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

3. spacer 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder matches to position: 5630-5679, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

4. spacer 1.1|20844|50|NZ_FEZK01000032|CRISPRCasFinder matches to position: 5907-5956, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

5. spacer 2.1|21121|52|NZ_FEZK01000032|CRISPRCasFinder matches to position: 2626-2677, mismatch: 2, identity: 0.962

taggttcgtccggtttcggttatttccgatagattcctgccgcgttgggggt	CRISPR spacer
taggttcgtctggtttcggttatttccgatagattcctgccgcgttggtggt	Protospacer
**********.************************************* ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_FEZK01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000008_1 74825-74931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_FEZK01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25388 : 32057 8 Bodo_saltans_virus(16.67%) transposase,integrase attL 22455:22468|attR 29457:29470
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_FEZK01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000001_1 113830-113911 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25434 : 34645 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_FEZK01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4198 : 16009 13 Haemophilus_phage(46.15%) terminase,plate,head NA
DBSCAN-SWA_2 69915 : 77891 11 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_FEZK01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000009_1 85-179 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000009_2 356-523 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000009_3 41168-41339 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FEZK01000009_1 1.1|111|42|NZ_FEZK01000009|CRISPRCasFinder 111-152 42 NZ_FEZK01000054.1 1228-1269 2 0.952
NZ_FEZK01000009_1 1.1|111|42|NZ_FEZK01000009|CRISPRCasFinder 111-152 42 NZ_FEZK01000054.1 1472-1513 2 0.952
NZ_FEZK01000009_2 2.1|382|42|NZ_FEZK01000009|CRISPRCasFinder 382-423 42 NZ_FEZK01000054.1 756-797 1 0.976
NZ_FEZK01000009_2 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder 450-497 48 NZ_FEZK01000008.1 47080-47127 1 0.979
NZ_FEZK01000009_2 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder 450-497 48 NZ_FEZK01000028.1 15-62 0 1.0
NZ_FEZK01000009_2 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder 450-497 48 NZ_FEZK01000054.1 1988-2035 0 1.0
NZ_FEZK01000009_2 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder 450-497 48 NZ_FEZK01000054.1 2217-2264 0 1.0
NZ_FEZK01000009_3 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder 41264-41313 50 NZ_FEZK01000009.1 41788-41837 0 1.0
NZ_FEZK01000009_3 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder 41264-41313 50 NZ_FEZK01000010.1 79058-79107 0 1.0
NZ_FEZK01000009_3 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder 41264-41313 50 NZ_FEZK01000016.1 20062-20111 1 0.98
NZ_FEZK01000009_3 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder 41264-41313 50 NZ_FEZK01000029.1 25618-25667 0 1.0

1. spacer 1.1|111|42|NZ_FEZK01000009|CRISPRCasFinder matches to position: 1228-1269, mismatch: 2, identity: 0.952

gtcttttataatctttgaatattgctgttatcccaaggtctg	CRISPR spacer
gtcttttataacctttgaatattgccgttatcccaaggtctg	Protospacer
***********.*************.****************

2. spacer 1.1|111|42|NZ_FEZK01000009|CRISPRCasFinder matches to position: 1472-1513, mismatch: 2, identity: 0.952

gtcttttataatctttgaatattgctgttatcccaaggtctg	CRISPR spacer
gtcttttataacctttgaatattgccgttatcccaaggtctg	Protospacer
***********.*************.****************

3. spacer 2.1|382|42|NZ_FEZK01000009|CRISPRCasFinder matches to position: 756-797, mismatch: 1, identity: 0.976

gtcttttataatctttgaatattgctgttgttctaaggtcta	CRISPR spacer
gtcttttataatctttgaatattactgttgttctaaggtcta	Protospacer
***********************.******************

4. spacer 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder matches to position: 47080-47127, mismatch: 1, identity: 0.979

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagccg	Protospacer
*******************************.****************

5. spacer 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder matches to position: 15-62, mismatch: 0, identity: 1.0

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	Protospacer
************************************************

6. spacer 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder matches to position: 1988-2035, mismatch: 0, identity: 1.0

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	Protospacer
************************************************

7. spacer 2.2|450|48|NZ_FEZK01000009|CRISPRCasFinder matches to position: 2217-2264, mismatch: 0, identity: 1.0

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	Protospacer
************************************************

8. spacer 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder matches to position: 41788-41837, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

9. spacer 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder matches to position: 79058-79107, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

10. spacer 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder matches to position: 20062-20111, mismatch: 1, identity: 0.98

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacctttccg	Protospacer
********************************************.*****

11. spacer 3.2|41264|50|NZ_FEZK01000009|CRISPRCasFinder matches to position: 25618-25667, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_FEZK01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FEZK01000007_1 61-164 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_FEZK01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage