| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_FEZK01000002 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000048 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000022 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000003 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000067 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000028 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 2 crisprs | 3 | 2 | 0 | 0 | |
| NZ_FEZK01000074 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000019 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000058 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000031 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000071 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000077 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000020 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000046 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000034 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000050 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000044 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000060 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000070 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000072 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000010 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000012 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000076 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000062 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000061 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000017 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000015 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000005 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 2 | |
| NZ_FEZK01000040 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000042 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000056 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000069 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000006 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000025 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FEZK01000001 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FEZK01000045 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000009 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 3 crisprs | 4 | 0 | 0 | 0 | |
| NZ_FEZK01000029 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000035 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000037 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000021 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000038 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000051 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000008 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000063 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000039 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000041 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000014 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000068 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000053 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000036 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000059 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000064 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000027 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000066 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000075 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000052 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000054 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000047 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000073 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000024 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000057 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000030 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000049 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000033 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000007 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000016 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 1 crisprs | 1 | 1 | 0 | 0 | |
| NZ_FEZK01000043 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000055 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000018 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000011 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000026 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000023 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000032 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 2 crisprs | 3 | 0 | 0 | 0 | |
| NZ_FEZK01000013 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FEZK01000004 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_FEZK01000065 | Neisseria meningitidis strain 2842STDY5881369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000028_1 | 3556-3657 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000028_2 | 4108-4311 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEZK01000028_1 | 3590-3623 | 34 | NZ_FEZK01000054.1 | 1236-1269 | 2 | 0.941 | |
| NZ_FEZK01000028_1 | 3590-3623 | 34 | NZ_FEZK01000054.1 | 1480-1513 | 2 | 0.941 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000002.1 | 142479-142510 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000002.1 | 142759-142790 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000002.1 | 142890-142921 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000002.1 | 143171-143202 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000002.1 | 143302-143333 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000010.1 | 537-568 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000010.1 | 1093-1124 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000010.1 | 871-902 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000012.1 | 111-142 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000012.1 | 309-340 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000013.1 | 12858-12889 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000014.1 | 1270-1301 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000014.1 | 384-415 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000014.1 | 973-1004 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000014.1 | 1421-1452 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000022.1 | 1008-1039 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000022.1 | 1211-1242 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000028.1 | 4312-4343 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000035.1 | 14683-14714 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000038.1 | 13430-13461 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000038.1 | 13731-13762 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000038.1 | 14132-14163 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000038.1 | 13953-13984 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000038.1 | 14414-14445 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000047.1 | 5952-5983 | 1 | 0.969 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000047.1 | 93-124 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000060.1 | 1689-1720 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000071.1 | 34-65 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_FEZK01000071.1 | 185-216 | 2 | 0.938 | |
| NZ_FEZK01000028_2 | 4244-4307 | 64 | NZ_FEZK01000002.1 | 138492-138555 | 5 | 0.922 | |
| NZ_FEZK01000028_2 | 4244-4307 | 64 | NZ_FEZK01000002.1 | 57987-58050 | 6 | 0.906 | |
| NZ_FEZK01000028_2 | 4244-4307 | 64 | NZ_FEZK01000014.1 | 857-920 | 6 | 0.906 | |
| NZ_FEZK01000028_2 | 4244-4307 | 64 | NZ_FEZK01000038.1 | 13615-13678 | 5 | 0.922 | |
| NZ_FEZK01000028_2 | 4244-4307 | 64 | NZ_FEZK01000054.1 | 890-953 | 6 | 0.906 |
gggataacagcaatattcaaagtttataaaagac CRISPR spacer gggataacggcaatattcaaaggttataaaagac Protospacer ********.************* ***********
gggataacagcaatattcaaagtttataaaagac CRISPR spacer gggataacggcaatattcaaaggttataaaagac Protospacer ********.************* ***********
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaagaaactg Protospacer ******.******************.******
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaagaaactg Protospacer ******.******************.******
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcaaaaaactg Protospacer ******.*************************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcgggaatgactgaaactcgaaaaactg Protospacer ******.****************.********
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer tttatcggaaatgactgaaactcaaaaaactg Protospacer ******.*.***********************
actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc CRISPR spacer actttcgtgggaatgacgggatgtaggttcgtaggaatgacgtggtgcaggtttccgtgc Protospacer ********************************.***************************
actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc CRISPR spacer actttcgtgggaatgacagaatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc Protospacer *****************.*.****************************************
actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc CRISPR spacer actttcgtgggaatgacggaatgtaggttcgtgggaatgacgcggtgcaggtttccgtgc Protospacer *******************.**********************.*****************
actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc CRISPR spacer actttcgtgggaatgacggaatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc Protospacer *******************.****************************************
actttcgtgggaatgacgggatgtaggttcgtgggaatgacgtggtgcaggtttccgtgc CRISPR spacer actttcgtgggaatgacgggatgtaggttcgcgggaatgacgcggtgcaggtttccgtgc Protospacer *******************************.**********.*****************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_FEZK01000028_2 | 4160-4191 | 32 | NZ_CP016746 | Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence | 126753-126784 | 8 | 0.75 | |
| NZ_FEZK01000028_2 | 4160-4191 | 32 | MH579717 | Pelagibacter phage HTVC021P, complete genome | 15421-15452 | 10 | 0.688 | |
| NZ_FEZK01000028_1 | 3590-3623 | 34 | NZ_LR699116 | Aquicella lusitana strain SGT-39 plasmid 3 | 2708-2741 | 11 | 0.676 |
--tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer ggataat--aaaatgactgaaactgaaaacactg Protospacer * ** ..************* **** ****
tttatcaggaatgactgaaactcaaaaaactg CRISPR spacer ctatgaaggaatgcctgaaacacaaaaaaaat Protospacer .* ******* ******* *******
gggataacagcaatattcaaagtttataaaagac CRISPR spacer ccaaagttagaaatattcaaattttataaaagga Protospacer .* . .** ********** **********.
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEZK01000016_1 | 37350-37381 | 32 | NZ_FEZK01000016.1 | 37275-37306 | 1 | 0.969 |
cagtaaccgaaaaaccacgggaatctatcgga CRISPR spacer cagtaaccgaaaaaccacaggaatctatcgga Protospacer ******************.*************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_FEZK01000016_1 | 37350-37381 | 32 | NZ_CP016452 | Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence | 1199362-1199393 | 8 | 0.75 |
cagtaacc-gaaaaaccacgggaatctatcgga CRISPR spacer -gctggctggaaaaaccaccggaatccatcgga Protospacer . *..*. ********** ******.******
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 70446 : 80439 | 17 | Vibrio_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_FEZK01000005.1_42129_42339_+ | No | NA |
| 123 aa aa | NA | NA | NZ_FEZK01000005.1_42129_42339_+ | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000032_1 | 20819-21000 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000032_2 | 21096-21197 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEZK01000032_1 | 20919-20974 | 56 | NZ_FEZK01000017.1 | 43189-43244 | 0 | 1.0 | |
| NZ_FEZK01000032_1 | 20844-20893 | 50 | NZ_FEZK01000017.1 | 43270-43319 | 1 | 0.98 | |
| NZ_FEZK01000032_1 | 20844-20893 | 50 | NZ_FEZK01000049.1 | 5630-5679 | 1 | 0.98 | |
| NZ_FEZK01000032_1 | 20844-20893 | 50 | NZ_FEZK01000049.1 | 5907-5956 | 1 | 0.98 | |
| NZ_FEZK01000032_2 | 21121-21172 | 52 | NZ_FEZK01000056.1 | 2626-2677 | 2 | 0.962 |
cagaacgtaaaatctaaagaaaccgtttttcccgacaagtttctgtgccgacaaac CRISPR spacer cagaacgtaaaatctaaagaaaccgtttttcccgacaagtttctgtgccgacaaac Protospacer ********************************************************
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
taggttcgtccggtttcggttatttccgatagattcctgccgcgttgggggt CRISPR spacer taggttcgtctggtttcggttatttccgatagattcctgccgcgttggtggt Protospacer **********.************************************* ***
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 25388 : 32057 | 8 | Bodo_saltans_virus(16.67%) | attL 22455:22468|attR 29457:29470 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 25434 : 34645 | 9 | Burkholderia_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4198 : 16009 | 13 | Haemophilus_phage(46.15%) | NA | ||
| DBSCAN-SWA_2 | 69915 : 77891 | 11 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000009_1 | 85-179 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000009_2 | 356-523 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FEZK01000009_3 | 41168-41339 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FEZK01000009_1 | 111-152 | 42 | NZ_FEZK01000054.1 | 1228-1269 | 2 | 0.952 | |
| NZ_FEZK01000009_1 | 111-152 | 42 | NZ_FEZK01000054.1 | 1472-1513 | 2 | 0.952 | |
| NZ_FEZK01000009_2 | 382-423 | 42 | NZ_FEZK01000054.1 | 756-797 | 1 | 0.976 | |
| NZ_FEZK01000009_2 | 450-497 | 48 | NZ_FEZK01000008.1 | 47080-47127 | 1 | 0.979 | |
| NZ_FEZK01000009_2 | 450-497 | 48 | NZ_FEZK01000028.1 | 15-62 | 0 | 1.0 | |
| NZ_FEZK01000009_2 | 450-497 | 48 | NZ_FEZK01000054.1 | 1988-2035 | 0 | 1.0 | |
| NZ_FEZK01000009_2 | 450-497 | 48 | NZ_FEZK01000054.1 | 2217-2264 | 0 | 1.0 | |
| NZ_FEZK01000009_3 | 41264-41313 | 50 | NZ_FEZK01000009.1 | 41788-41837 | 0 | 1.0 | |
| NZ_FEZK01000009_3 | 41264-41313 | 50 | NZ_FEZK01000010.1 | 79058-79107 | 0 | 1.0 | |
| NZ_FEZK01000009_3 | 41264-41313 | 50 | NZ_FEZK01000016.1 | 20062-20111 | 1 | 0.98 | |
| NZ_FEZK01000009_3 | 41264-41313 | 50 | NZ_FEZK01000029.1 | 25618-25667 | 0 | 1.0 |
gtcttttataatctttgaatattgctgttatcccaaggtctg CRISPR spacer gtcttttataacctttgaatattgccgttatcccaaggtctg Protospacer ***********.*************.****************
gtcttttataatctttgaatattgctgttatcccaaggtctg CRISPR spacer gtcttttataacctttgaatattgccgttatcccaaggtctg Protospacer ***********.*************.****************
gtcttttataatctttgaatattgctgttgttctaaggtcta CRISPR spacer gtcttttataatctttgaatattactgttgttctaaggtcta Protospacer ***********************.******************
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagccg Protospacer *******************************.****************
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg Protospacer ************************************************
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg Protospacer ************************************************
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg Protospacer ************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacctttccg Protospacer ********************************************.*****
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|