| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000012 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000056 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000009 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000023 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000092 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000046 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000016 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000059 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000048 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000074 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000044 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000001 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FFCX01000068 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000072 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000078 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000039 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000077 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000084 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000018 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000050 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000007 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000003 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_FFCX01000081 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000035 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000090 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000075 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000032 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000014 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000076 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000037 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 2 | 0 | 0 | 0 | |
| NZ_FFCX01000004 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000045 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000025 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000079 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000024 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000049 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000017 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000070 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000067 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000071 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000010 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000036 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000005 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 2 | |
| NZ_FFCX01000089 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000042 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000047 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000054 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000043 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000057 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000008 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000058 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000060 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000052 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000040 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000093 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000006 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 2 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000015 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000031 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000053 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000034 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 3 crisprs | 2 | 0 | 0 | 0 | |
| NZ_FFCX01000019 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000066 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000020 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FFCX01000021 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000087 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000026 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000086 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000061 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000033 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000065 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000029 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000064 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000088 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000062 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000080 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000063 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000073 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000041 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000028 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 2 crisprs | 3 | 0 | 0 | 0 | |
| NZ_FFCX01000011 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000027 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000083 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000085 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000082 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000030 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000002 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000091 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000051 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000069 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000038 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000022 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FFCX01000055 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FFCX01000013 | Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000002.1 | 117264-117314 | 1 | 0.98 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000006.1 | 31748-31798 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000006.1 | 32048-32098 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000006.1 | 78081-78131 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000008.1 | 4-54 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000008.1 | 1186-1236 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000008.1 | 5946-5996 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000008.1 | 6503-6553 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000008.1 | 7106-7156 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000013.1 | 49771-49821 | 0 | 1.0 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000028.1 | 6775-6825 | 1 | 0.98 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000028.1 | 7339-7389 | 2 | 0.961 | |
| NZ_FFCX01000008_1 | 7670-7720 | 51 | NZ_FFCX01000046.1 | 296-346 | 1 | 0.98 |
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcattggattcc Protospacer ******************************************.********
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer ***************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer taaagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc Protospacer **.************************************************
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer taaagtttcaaaatttattctaaatagctgaaactcaacgcactagattcc Protospacer **.*****************************************.******
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc CRISPR spacer tagagtttcaaaatttattctaaatagctgaagctcaacgcactggattcc Protospacer ********************************.******************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000037_1 | 16394-16427 | 34 | NZ_FFCX01000008.1 | 1042-1075 | 0 | 1.0 | |
| NZ_FFCX01000037_1 | 16394-16427 | 34 | NZ_FFCX01000024.1 | 12136-12169 | 2 | 0.941 | |
| NZ_FFCX01000037_1 | 16462-16499 | 38 | NZ_FFCX01000093.1 | 18-55 | 0 | 1.0 |
gggataacagcaatattcaaaggttataaaagac CRISPR spacer gggataacagcaatattcaaaggttataaaagac Protospacer **********************************
gggataacagcaatattcaaaggttataaaagac CRISPR spacer gggatagcggcaatattcaaaggttataaaagac Protospacer ******.*.*************************
aaaatctaaagaaaccgtgttgtaacggcagaccgatg CRISPR spacer aaaatctaaagaaaccgtgttgtaacggcagaccgatg Protospacer **************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000093_1 | 89-131 | 43 | NZ_FFCX01000008.1 | 1034-1076 | 0 | 1.0 | |
| NZ_FFCX01000093_1 | 89-131 | 43 | NZ_FFCX01000024.1 | 12135-12177 | 2 | 0.953 |
ggtcttttataacctttgaatattgctgttatcccaaggtctg CRISPR spacer ggtcttttataacctttgaatattgctgttatcccaaggtctg Protospacer *******************************************
ggtcttttataacctttgaatattgctgttatcccaaggtctg CRISPR spacer ggtcttttataacctttgaatattgccgctatcccaaggtctg Protospacer **************************.*.**************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000028_1 | 7151-7337 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000028_2 | 12336-12416 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000008.1 | 7513-7560 | 0 | 1.0 | |
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000008.1 | 116-163 | 2 | 0.958 | |
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000008.1 | 5386-5433 | 2 | 0.958 | |
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000013.1 | 50493-50540 | 2 | 0.958 | |
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000028.1 | 6279-6326 | 0 | 1.0 | |
| NZ_FFCX01000028_1 | 7182-7229 | 48 | NZ_FFCX01000059.1 | 6043-6090 | 2 | 0.958 | |
| NZ_FFCX01000028_1 | 7261-7331 | 71 | NZ_FFCX01000006.1 | 43731-43801 | 12 | 0.831 | |
| NZ_FFCX01000028_1 | 7261-7331 | 71 | NZ_FFCX01000007.1 | 5103-5173 | 13 | 0.817 | |
| NZ_FFCX01000028_1 | 7261-7331 | 71 | NZ_FFCX01000028.1 | 6333-6403 | 12 | 0.831 | |
| NZ_FFCX01000028_2 | 12362-12390 | 29 | NZ_FFCX01000015.1 | 45433-45461 | 2 | 0.931 | |
| NZ_FFCX01000028_2 | 12362-12390 | 29 | NZ_FFCX01000089.1 | 153-181 | 2 | 0.931 |
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc Protospacer ************************************************
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggtttctgttgctcccgataaatgccgcaatctcaaatcccgtc Protospacer ****** ***************************.*************
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggtttctgttgctcccgataaatgccgcaatctcaaatcccgtc Protospacer ****** ***************************.*************
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggcttctgttgctcccgataaatgccgcaatctcaaatcccgtc Protospacer ****** ***************************.*************
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc Protospacer ************************************************
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc CRISPR spacer gagcggcttctgttgctcccgataaatgccgcaatctcaaatcccgtc Protospacer ****** ***************************.*************
gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga CRISPR spacer gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttca Protospacer ********************************************************** *
gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga CRISPR spacer gcgcaggcgggaatccaggtctgtcggtgcggaaacttatcggataaaacggtttcttta Protospacer ***************.****************************************** *
gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga CRISPR spacer gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcgggtaaaacggtttcttga Protospacer *******************************************.****************
gatgcaggttttcttaaccccgcgttcta CRISPR spacer gatgcaggttttcttaaccctgcgtccta Protospacer ********************.****.***
gatgcaggttttcttaaccccgcgttcta CRISPR spacer gatgcaggttttcttaaccctgcgtccta Protospacer ********************.****.***
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000006_1 | 31268-31435 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000006_2 | 64884-65038 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000006_1 | 31363-31421 | 59 | NZ_FFCX01000002.1 | 117363-117421 | 0 | 1.0 | |
| NZ_FFCX01000006_1 | 31363-31421 | 59 | NZ_FFCX01000006.1 | 32211-32269 | 0 | 1.0 | |
| NZ_FFCX01000006_1 | 31363-31421 | 59 | NZ_FFCX01000016.1 | 30281-30339 | 0 | 1.0 |
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg CRISPR spacer ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg Protospacer ***********************************************************
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg CRISPR spacer ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg Protospacer ***********************************************************
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg CRISPR spacer ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg Protospacer ***********************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000016_1 | 23116-23157 | 42 | NZ_FFCX01000015.1 | 45936-45977 | 0 | 1.0 | |
| NZ_FFCX01000016_1 | 23116-23157 | 42 | NZ_FFCX01000015.1 | 45420-45461 | 1 | 0.976 |
aaaagcgggaatctaggacgcagggttaagaaaacctacatc CRISPR spacer aaaagcgggaatctaggacgcagggttaagaaaacctacatc Protospacer ******************************************
aaaagcgggaatctaggacgcagggttaagaaaacctacatc CRISPR spacer aaaagcgggaatctaggacgcagggttaagaaaacctgcatc Protospacer *************************************.****
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000034_1 | 223-322 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000034_2 | 472-643 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FFCX01000034_3 | 1270-1367 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000034_2 | 566-616 | 51 | NZ_FFCX01000007.1 | 28078-28128 | 2 | 0.961 | |
| NZ_FFCX01000034_3 | 1296-1341 | 46 | NZ_FFCX01000093.1 | 18-63 | 0 | 1.0 |
tttagaagttgcccgaaacctcaaaaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaaaaaccgaaaccgaacagaccg Protospacer **********************************************..***
catcggtctgccgttacaacacggtttctttagattttacgttcta CRISPR spacer catcggtctgccgttacaacacggtttctttagattttacgttcta Protospacer **********************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 118918 : 128166 | 9 | Burkholderia_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000002.1 | 116760-116798 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000002.1 | 117042-117080 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000006.1 | 31817-31855 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000008.1 | 6015-6053 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000008.1 | 6266-6304 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000008.1 | 6572-6610 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000013.1 | 49840-49878 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000013.1 | 50417-50455 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000059.1 | 6128-6166 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000059.1 | 6351-6389 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000059.1 | 6447-6485 | 0 | 1.0 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000059.1 | 5876-5914 | 1 | 0.974 | |
| NZ_FFCX01000020_1 | 90-128 | 39 | NZ_FFCX01000061.1 | 37-75 | 0 | 1.0 |
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtagaagttacccgaaacttaaaacaagcgaaaccg Protospacer *****.*********************************
gaagtggaagttacccgaaacttaaaacaagcgaaaccg CRISPR spacer gaagtggaagttacccgaaacttaaaacaagcgaaaccg Protospacer ***************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 18035 : 24212 | 11 | Burkholderia_virus(33.33%) | attL 15367:15385|attR 27540:27558 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_FFCX01000005.1_40597_40807_+ | No | NA |
| 123 aa aa | NA | NA | NZ_FFCX01000005.1_40597_40807_+ | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1774 : 32420 | 35 | Mannheimia_phage(46.67%) | NA | ||
| DBSCAN-SWA_2 | 75473 : 83640 | 11 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000015.1 | 45613-45662 | 0 | 1.0 | |
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000046.1 | 13931-13980 | 0 | 1.0 | |
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000048.1 | 5012-5061 | 0 | 1.0 | |
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000053.1 | 8855-8904 | 0 | 1.0 | |
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000053.1 | 10152-10201 | 0 | 1.0 | |
| NZ_FFCX01000017_1 | 22757-22806 | 50 | NZ_FFCX01000053.1 | 10304-10353 | 0 | 1.0 |
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|