Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FFCX01000012 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000056 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000009 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000023 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000092 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000046 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000016 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FFCX01000059 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000048 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000074 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000044 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000001 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FFCX01000068 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000072 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000078 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000039 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000077 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000084 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000018 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000050 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000007 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FFCX01000003 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_FFCX01000081 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FFCX01000035 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000090 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000075 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000032 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs c2c4_V-U1 0 0 0 0
NZ_FFCX01000014 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000076 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000037 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 2 0 0 0
NZ_FFCX01000004 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000045 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000025 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000079 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000024 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000049 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000017 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FFCX01000070 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000067 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000071 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000010 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000036 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_FFCX01000005 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 2
NZ_FFCX01000089 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000042 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000047 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000054 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000043 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000057 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000008 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FFCX01000058 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000060 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000052 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000040 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FFCX01000093 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FFCX01000006 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 2 crisprs NA 1 0 0 0
NZ_FFCX01000015 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_FFCX01000031 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000053 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000034 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 3 crisprs NA 2 0 0 0
NZ_FFCX01000019 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000066 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000020 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FFCX01000021 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000087 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000026 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000086 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000061 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000033 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000065 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000029 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000064 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000088 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000062 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000080 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000063 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000073 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000041 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FFCX01000028 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 2 crisprs NA 3 0 0 0
NZ_FFCX01000011 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000027 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_FFCX01000083 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000085 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000082 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000030 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000002 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000091 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000051 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000069 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000038 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000022 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FFCX01000055 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FFCX01000013 Neisseria meningitidis strain 2842STDY5881462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_FFCX01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000015_1 28045-28146 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FFCX01000089
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FFCX01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000008_1 7647-7817 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000002.1 117264-117314 1 0.98
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000006.1 31748-31798 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000006.1 32048-32098 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000006.1 78081-78131 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000008.1 4-54 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000008.1 1186-1236 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000008.1 5946-5996 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000008.1 6503-6553 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000008.1 7106-7156 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000013.1 49771-49821 0 1.0
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000028.1 6775-6825 1 0.98
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000028.1 7339-7389 2 0.961
NZ_FFCX01000008_1 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder 7670-7720 51 NZ_FFCX01000046.1 296-346 1 0.98

1. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 117264-117314, mismatch: 1, identity: 0.98

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcattggattcc	Protospacer
******************************************.********

2. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 31748-31798, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

3. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 32048-32098, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

4. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 78081-78131, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

5. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 4-54, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

6. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 1186-1236, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

7. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 5946-5996, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

8. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 6503-6553, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

9. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 7106-7156, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

10. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 49771-49821, mismatch: 0, identity: 1.0

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
***************************************************

11. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 6775-6825, mismatch: 1, identity: 0.98

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
taaagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	Protospacer
**.************************************************

12. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 7339-7389, mismatch: 2, identity: 0.961

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
taaagtttcaaaatttattctaaatagctgaaactcaacgcactagattcc	Protospacer
**.*****************************************.******

13. spacer 1.1|7670|51|NZ_FFCX01000008|CRISPRCasFinder matches to position: 296-346, mismatch: 1, identity: 0.98

tagagtttcaaaatttattctaaatagctgaaactcaacgcactggattcc	CRISPR spacer
tagagtttcaaaatttattctaaatagctgaagctcaacgcactggattcc	Protospacer
********************************.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FFCX01000053
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FFCX01000037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000037_1 16360-16532 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000037_1 1.1|16394|34|NZ_FFCX01000037|PILER-CR 16394-16427 34 NZ_FFCX01000008.1 1042-1075 0 1.0
NZ_FFCX01000037_1 1.1|16394|34|NZ_FFCX01000037|PILER-CR 16394-16427 34 NZ_FFCX01000024.1 12136-12169 2 0.941
NZ_FFCX01000037_1 1.2|16462|38|NZ_FFCX01000037|PILER-CR 16462-16499 38 NZ_FFCX01000093.1 18-55 0 1.0

1. spacer 1.1|16394|34|NZ_FFCX01000037|PILER-CR matches to position: 1042-1075, mismatch: 0, identity: 1.0

gggataacagcaatattcaaaggttataaaagac	CRISPR spacer
gggataacagcaatattcaaaggttataaaagac	Protospacer
**********************************

2. spacer 1.1|16394|34|NZ_FFCX01000037|PILER-CR matches to position: 12136-12169, mismatch: 2, identity: 0.941

gggataacagcaatattcaaaggttataaaagac	CRISPR spacer
gggatagcggcaatattcaaaggttataaaagac	Protospacer
******.*.*************************

3. spacer 1.2|16462|38|NZ_FFCX01000037|PILER-CR matches to position: 18-55, mismatch: 0, identity: 1.0

aaaatctaaagaaaccgtgttgtaacggcagaccgatg	CRISPR spacer
aaaatctaaagaaaccgtgttgtaacggcagaccgatg	Protospacer
**************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FFCX01000093
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000093_1 64-156 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000093_1 1.1|89|43|NZ_FFCX01000093|CRISPRCasFinder 89-131 43 NZ_FFCX01000008.1 1034-1076 0 1.0
NZ_FFCX01000093_1 1.1|89|43|NZ_FFCX01000093|CRISPRCasFinder 89-131 43 NZ_FFCX01000024.1 12135-12177 2 0.953

1. spacer 1.1|89|43|NZ_FFCX01000093|CRISPRCasFinder matches to position: 1034-1076, mismatch: 0, identity: 1.0

ggtcttttataacctttgaatattgctgttatcccaaggtctg	CRISPR spacer
ggtcttttataacctttgaatattgctgttatcccaaggtctg	Protospacer
*******************************************

2. spacer 1.1|89|43|NZ_FFCX01000093|CRISPRCasFinder matches to position: 12135-12177, mismatch: 2, identity: 0.953

ggtcttttataacctttgaatattgctgttatcccaaggtctg	CRISPR spacer
ggtcttttataacctttgaatattgccgctatcccaaggtctg	Protospacer
**************************.*.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FFCX01000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000028_1 7151-7337 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000028_2 12336-12416 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000008.1 7513-7560 0 1.0
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000008.1 116-163 2 0.958
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000008.1 5386-5433 2 0.958
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000013.1 50493-50540 2 0.958
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000028.1 6279-6326 0 1.0
NZ_FFCX01000028_1 1.1|7182|48|NZ_FFCX01000028|PILER-CR 7182-7229 48 NZ_FFCX01000059.1 6043-6090 2 0.958
NZ_FFCX01000028_1 1.2|7261|71|NZ_FFCX01000028|PILER-CR 7261-7331 71 NZ_FFCX01000006.1 43731-43801 12 0.831
NZ_FFCX01000028_1 1.2|7261|71|NZ_FFCX01000028|PILER-CR 7261-7331 71 NZ_FFCX01000007.1 5103-5173 13 0.817
NZ_FFCX01000028_1 1.2|7261|71|NZ_FFCX01000028|PILER-CR 7261-7331 71 NZ_FFCX01000028.1 6333-6403 12 0.831
NZ_FFCX01000028_2 2.1|12362|29|NZ_FFCX01000028|CRISPRCasFinder 12362-12390 29 NZ_FFCX01000015.1 45433-45461 2 0.931
NZ_FFCX01000028_2 2.1|12362|29|NZ_FFCX01000028|CRISPRCasFinder 12362-12390 29 NZ_FFCX01000089.1 153-181 2 0.931

1. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 7513-7560, mismatch: 0, identity: 1.0

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	Protospacer
************************************************

2. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 116-163, mismatch: 2, identity: 0.958

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggtttctgttgctcccgataaatgccgcaatctcaaatcccgtc	Protospacer
****** ***************************.*************

3. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 5386-5433, mismatch: 2, identity: 0.958

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggtttctgttgctcccgataaatgccgcaatctcaaatcccgtc	Protospacer
****** ***************************.*************

4. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 50493-50540, mismatch: 2, identity: 0.958

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggcttctgttgctcccgataaatgccgcaatctcaaatcccgtc	Protospacer
****** ***************************.*************

5. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 6279-6326, mismatch: 0, identity: 1.0

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	Protospacer
************************************************

6. spacer 1.1|7182|48|NZ_FFCX01000028|PILER-CR matches to position: 6043-6090, mismatch: 2, identity: 0.958

gagcggattctgttgctcccgataaatgccgcaacctcaaatcccgtc	CRISPR spacer
gagcggcttctgttgctcccgataaatgccgcaatctcaaatcccgtc	Protospacer
****** ***************************.*************

7. spacer 1.2|7261|71|NZ_FFCX01000028|PILER-CR matches to position: 43731-43801, mismatch: 12, identity: 0.831

gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga	CRISPR spacer
gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttca	Protospacer
********************************************************** *

8. spacer 1.2|7261|71|NZ_FFCX01000028|PILER-CR matches to position: 5103-5173, mismatch: 13, identity: 0.817

gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga	CRISPR spacer
gcgcaggcgggaatccaggtctgtcggtgcggaaacttatcggataaaacggtttcttta	Protospacer
***************.****************************************** *

9. spacer 1.2|7261|71|NZ_FFCX01000028|PILER-CR matches to position: 6333-6403, mismatch: 12, identity: 0.831

gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcggataaaacggtttcttga	CRISPR spacer
gcgcaggcgggaatctaggtctgtcggtgcggaaacttatcgggtaaaacggtttcttga	Protospacer
*******************************************.****************

10. spacer 2.1|12362|29|NZ_FFCX01000028|CRISPRCasFinder matches to position: 45433-45461, mismatch: 2, identity: 0.931

gatgcaggttttcttaaccccgcgttcta	CRISPR spacer
gatgcaggttttcttaaccctgcgtccta	Protospacer
********************.****.***

11. spacer 2.1|12362|29|NZ_FFCX01000028|CRISPRCasFinder matches to position: 153-181, mismatch: 2, identity: 0.931

gatgcaggttttcttaaccccgcgttcta	CRISPR spacer
gatgcaggttttcttaaccctgcgtccta	Protospacer
********************.****.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FFCX01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000006_1 31268-31435 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000006_2 64884-65038 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000006_1 1.2|31363|59|NZ_FFCX01000006|PILER-CR 31363-31421 59 NZ_FFCX01000002.1 117363-117421 0 1.0
NZ_FFCX01000006_1 1.2|31363|59|NZ_FFCX01000006|PILER-CR 31363-31421 59 NZ_FFCX01000006.1 32211-32269 0 1.0
NZ_FFCX01000006_1 1.2|31363|59|NZ_FFCX01000006|PILER-CR 31363-31421 59 NZ_FFCX01000016.1 30281-30339 0 1.0

1. spacer 1.2|31363|59|NZ_FFCX01000006|PILER-CR matches to position: 117363-117421, mismatch: 0, identity: 1.0

ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	CRISPR spacer
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	Protospacer
***********************************************************

2. spacer 1.2|31363|59|NZ_FFCX01000006|PILER-CR matches to position: 32211-32269, mismatch: 0, identity: 1.0

ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	CRISPR spacer
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	Protospacer
***********************************************************

3. spacer 1.2|31363|59|NZ_FFCX01000006|PILER-CR matches to position: 30281-30339, mismatch: 0, identity: 1.0

ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	CRISPR spacer
ccgtcattcccgcgcaggcgggaatctagtccgttcggtttcggtttttttggctagtg	Protospacer
***********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FFCX01000046
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FFCX01000016
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000016_1 23084-23189 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000016_1 1.1|23116|42|NZ_FFCX01000016|CRISPRCasFinder 23116-23157 42 NZ_FFCX01000015.1 45936-45977 0 1.0
NZ_FFCX01000016_1 1.1|23116|42|NZ_FFCX01000016|CRISPRCasFinder 23116-23157 42 NZ_FFCX01000015.1 45420-45461 1 0.976

1. spacer 1.1|23116|42|NZ_FFCX01000016|CRISPRCasFinder matches to position: 45936-45977, mismatch: 0, identity: 1.0

aaaagcgggaatctaggacgcagggttaagaaaacctacatc	CRISPR spacer
aaaagcgggaatctaggacgcagggttaagaaaacctacatc	Protospacer
******************************************

2. spacer 1.1|23116|42|NZ_FFCX01000016|CRISPRCasFinder matches to position: 45420-45461, mismatch: 1, identity: 0.976

aaaagcgggaatctaggacgcagggttaagaaaacctacatc	CRISPR spacer
aaaagcgggaatctaggacgcagggttaagaaaacctgcatc	Protospacer
*************************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FFCX01000059
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FFCX01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_FFCX01000034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000034_1 223-322 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000034_2 472-643 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000034_3 1270-1367 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000034_2 2.2|566|51|NZ_FFCX01000034|CRISPRCasFinder 566-616 51 NZ_FFCX01000007.1 28078-28128 2 0.961
NZ_FFCX01000034_3 3.1|1296|46|NZ_FFCX01000034|CRISPRCasFinder 1296-1341 46 NZ_FFCX01000093.1 18-63 0 1.0

1. spacer 2.2|566|51|NZ_FFCX01000034|CRISPRCasFinder matches to position: 28078-28128, mismatch: 2, identity: 0.961

tttagaagttgcccgaaacctcaaaaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaaaaaccgaaaccgaacagaccg	Protospacer
**********************************************..***

2. spacer 3.1|1296|46|NZ_FFCX01000034|CRISPRCasFinder matches to position: 18-63, mismatch: 0, identity: 1.0

catcggtctgccgttacaacacggtttctttagattttacgttcta	CRISPR spacer
catcggtctgccgttacaacacggtttctttagattttacgttcta	Protospacer
**********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_FFCX01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 118918 : 128166 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_FFCX01000061
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_FFCX01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_FFCX01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000020_1 57-161 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000002.1 116760-116798 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000002.1 117042-117080 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000006.1 31817-31855 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000008.1 6015-6053 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000008.1 6266-6304 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000008.1 6572-6610 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000013.1 49840-49878 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000013.1 50417-50455 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000059.1 6128-6166 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000059.1 6351-6389 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000059.1 6447-6485 0 1.0
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000059.1 5876-5914 1 0.974
NZ_FFCX01000020_1 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder 90-128 39 NZ_FFCX01000061.1 37-75 0 1.0

1. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 116760-116798, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

2. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 117042-117080, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

3. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 31817-31855, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

4. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6015-6053, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

5. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6266-6304, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

6. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6572-6610, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

7. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 49840-49878, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

8. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 50417-50455, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

9. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6128-6166, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

10. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6351-6389, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

11. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 6447-6485, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

12. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 5876-5914, mismatch: 1, identity: 0.974

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtagaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
*****.*********************************

13. spacer 1.1|90|39|NZ_FFCX01000020|CRISPRCasFinder matches to position: 37-75, mismatch: 0, identity: 1.0

gaagtggaagttacccgaaacttaaaacaagcgaaaccg	CRISPR spacer
gaagtggaagttacccgaaacttaaaacaagcgaaaccg	Protospacer
***************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_FFCX01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18035 : 24212 11 Burkholderia_virus(33.33%) integrase attL 15367:15385|attR 27540:27558
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_FFCX01000048
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_FFCX01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FFCX01000005.1|WP_042743676.1|39837_40188_+|anti-CRISPR-protein-AcrIIC3 39837_40188_+ 116 aa aa AcrIIC3 NA NZ_FFCX01000005.1_40597_40807_+ No NA
NZ_FFCX01000005.1|WP_042743678.1|40233_40605_+|anti-CRISPR-protein-AcrIIC2 40233_40605_+ 123 aa aa NA NA NZ_FFCX01000005.1_40597_40807_+ No NA
21. NZ_FFCX01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1774 : 32420 35 Mannheimia_phage(46.67%) plate,tRNA,tail NA
DBSCAN-SWA_2 75473 : 83640 11 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_FFCX01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000017_1 22661-22832 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000015.1 45613-45662 0 1.0
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000046.1 13931-13980 0 1.0
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000048.1 5012-5061 0 1.0
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000053.1 8855-8904 0 1.0
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000053.1 10152-10201 0 1.0
NZ_FFCX01000017_1 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder 22757-22806 50 NZ_FFCX01000053.1 10304-10353 0 1.0

1. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 45613-45662, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

2. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 13931-13980, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

3. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 5012-5061, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

4. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 8855-8904, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

5. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 10152-10201, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

6. spacer 1.2|22757|50|NZ_FFCX01000017|CRISPRCasFinder matches to position: 10304-10353, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_FFCX01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000007_1 28223-28321 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_FFCX01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_FFCX01000081
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FFCX01000081_1 612-709 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage