Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_SRYT01000001 Enterococcus faecalis strain NM58_B2-5 NODE_1_length_786750_cov_691.081, whole genome shotgun sequence 2 crisprs csn2,cas2,cas9,cas3,DinG,DEDDh,csa3 0 8 2 0
NZ_SRYT01000023 Enterococcus faecalis strain NM58_B2-5 NODE_23_length_28630_cov_899.071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000036 Enterococcus faecalis strain NM58_B2-5 NODE_36_length_959_cov_1548.2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000010 Enterococcus faecalis strain NM58_B2-5 NODE_10_length_68479_cov_739.851, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000009 Enterococcus faecalis strain NM58_B2-5 NODE_9_length_69408_cov_790.384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000039 Enterococcus faecalis strain NM58_B2-5 NODE_39_length_526_cov_3364.51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000029 Enterococcus faecalis strain NM58_B2-5 NODE_29_length_11223_cov_671.636, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000002 Enterococcus faecalis strain NM58_B2-5 NODE_2_length_328556_cov_678.087, whole genome shotgun sequence 0 crisprs cas3,DinG 0 0 1 0
NZ_SRYT01000041 Enterococcus faecalis strain NM58_B2-5 NODE_41_length_332_cov_617.942, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000004 Enterococcus faecalis strain NM58_B2-5 NODE_4_length_176591_cov_742.995, whole genome shotgun sequence 0 crisprs cas14j,cas3 0 0 1 0
NZ_SRYT01000021 Enterococcus faecalis strain NM58_B2-5 NODE_21_length_36090_cov_917.867, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000030 Enterococcus faecalis strain NM58_B2-5 NODE_30_length_2739_cov_5789.04, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000018 Enterococcus faecalis strain NM58_B2-5 NODE_18_length_43883_cov_811.105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000026 Enterococcus faecalis strain NM58_B2-5 NODE_26_length_18396_cov_711.691, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000028 Enterococcus faecalis strain NM58_B2-5 NODE_28_length_11655_cov_904.538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000035 Enterococcus faecalis strain NM58_B2-5 NODE_35_length_984_cov_1355.61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000003 Enterococcus faecalis strain NM58_B2-5 NODE_3_length_294056_cov_795.044, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_SRYT01000014 Enterococcus faecalis strain NM58_B2-5 NODE_14_length_61463_cov_730.119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000032 Enterococcus faecalis strain NM58_B2-5 NODE_32_length_1313_cov_5141.42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000011 Enterococcus faecalis strain NM58_B2-5 NODE_11_length_66213_cov_779.568, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_SRYT01000024 Enterococcus faecalis strain NM58_B2-5 NODE_24_length_24747_cov_783.579, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000040 Enterococcus faecalis strain NM58_B2-5 NODE_40_length_357_cov_3644.87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000038 Enterococcus faecalis strain NM58_B2-5 NODE_38_length_542_cov_5780.89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000027 Enterococcus faecalis strain NM58_B2-5 NODE_27_length_15135_cov_673.009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000034 Enterococcus faecalis strain NM58_B2-5 NODE_34_length_1131_cov_464.891, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000019 Enterococcus faecalis strain NM58_B2-5 NODE_19_length_42535_cov_734.512, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000020 Enterococcus faecalis strain NM58_B2-5 NODE_20_length_41806_cov_706.304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000005 Enterococcus faecalis strain NM58_B2-5 NODE_5_length_160076_cov_819.228, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_SRYT01000006 Enterococcus faecalis strain NM58_B2-5 NODE_6_length_151733_cov_909.857, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_SRYT01000037 Enterococcus faecalis strain NM58_B2-5 NODE_37_length_745_cov_1691.67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000015 Enterococcus faecalis strain NM58_B2-5 NODE_15_length_54908_cov_835.406, whole genome shotgun sequence 1 crisprs NA 0 2 0 2
NZ_SRYT01000025 Enterococcus faecalis strain NM58_B2-5 NODE_25_length_18699_cov_592.131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000007 Enterococcus faecalis strain NM58_B2-5 NODE_7_length_137438_cov_801.952, whole genome shotgun sequence 0 crisprs csa3,WYL 0 0 0 0
NZ_SRYT01000017 Enterococcus faecalis strain NM58_B2-5 NODE_17_length_47465_cov_837.108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000022 Enterococcus faecalis strain NM58_B2-5 NODE_22_length_35853_cov_965.83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000033 Enterococcus faecalis strain NM58_B2-5 NODE_33_length_1251_cov_2253.23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000031 Enterococcus faecalis strain NM58_B2-5 NODE_31_length_1986_cov_1338.75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000008 Enterococcus faecalis strain NM58_B2-5 NODE_8_length_110646_cov_820.327, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_SRYT01000012 Enterococcus faecalis strain NM58_B2-5 NODE_12_length_63219_cov_780.098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000016 Enterococcus faecalis strain NM58_B2-5 NODE_16_length_47940_cov_752.659, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_SRYT01000013 Enterococcus faecalis strain NM58_B2-5 NODE_13_length_61789_cov_819.542, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_SRYT01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_SRYT01000001_1 269829-270326 TypeII NA
7 spacers
csn2,cas2,cas9,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_SRYT01000001_2 527698-527982 Orphan NA:II-A,II-B
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MH375074 Enterococcus phage LY0323, complete genome 14191-14220 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MH355583 Enterococcus phage vB_EfaS_LM99, complete genome 25256-25285 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721199 Enterococcus phage vB_EfaS_Ef5.1, complete genome 25294-25323 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK360024 Enterococcus phage vB_EfaS_Max, complete genome 26997-27026 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 CAJDJX010000002 Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence 28839-28868 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MT857001 Enterococcus phage EFA1, complete genome 26140-26169 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 KT932701 Enterococcus phage vB_EfaS_IME196, complete genome 25559-25588 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042023 Enterococcus phage phiSHEF5, complete genome 15973-16002 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042101 Enterococcus phage PMBT2, complete genome 26219-26248 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MH203383 Ecterococcus phage vB_EfaS_AL3, complete genome 27301-27330 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721200 Enterococcus phage vB_EfaS_Ef5.3, complete genome 25586-25615 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042022 Enterococcus phage phiSHEF4, complete genome 19571-19600 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MT520979 Enterococcus phage vB_EfaS-271, complete genome 27170-27199 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MH193369 Enterococcus phage LY0322, complete genome 13774-13803 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_031260 Enterococcus phage Ec-ZZ2, complete genome 4183-4212 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721186 Enterococcus phage vB_EfaS_Ef5.2, complete genome 25777-25806 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042021 Enterococcus phage phiSHEF2, complete genome 26175-26204 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 JX193904 Enterococcus phage EfaCPT1, complete genome 24158-24187 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042126 Enterococcus phage vB_EfaS_AL3, complete genome 27301-27330 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 KX284704 Enterococcus phage SANTOR1, complete genome 23374-23403 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 KJ127304 Enterococcus phage AUEF3, partial genome 16779-16808 0 1.0
NZ_SRYT01000001_2 2.1|527718|46|NZ_SRYT01000001|CRT 527718-527763 46 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 288-333 0 1.0
NZ_SRYT01000001_2 2.2|527784|46|NZ_SRYT01000001|CRT 527784-527829 46 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 222-267 0 1.0
NZ_SRYT01000001_2 2.5|527785|27|NZ_SRYT01000001|CRISPRCasFinder 527785-527811 27 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 240-266 0 1.0
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 KF728385 Enterococcus phage IME_EF3, complete genome 27212-27241 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 25243-25272 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 NC_042127 Enterococcus phage vB_EfaS_AL2, complete genome 14027-14056 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MG264739 UNVERIFIED: Enterococcus phage phiNASRA1, complete genome 2703-2732 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 CAJDKF010000002 Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence 28650-28679 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 KF733017 Enterococcus phage IME-EF4, complete genome 14831-14860 1 0.967
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721191 Enterococcus phage vB_EfaS_Ef5.4, complete genome 25476-25505 2 0.933
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK721187 Enterococcus phage vB_EfaS_Ef6.1, complete genome 25547-25576 2 0.933
NZ_SRYT01000001_1 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270261-270290 30 MK982307 Enterococcus phage MSF2, complete genome 32076-32105 3 0.9
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 LT615366 Enterococcus phage VPE25 genome assembly, chromosome: VPE25 28752-28781 6 0.8
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 LT546029 Enterococcus phage VFW genome assembly, chromosome: VFW 28684-28713 6 0.8
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 LT546030 Enterococcus phage VPE25 genome assembly, chromosome: I 28752-28781 6 0.8
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 MT119361 Enterococus phage vipetofem, complete genome 56526-56555 6 0.8
NZ_SRYT01000001_1 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270195-270224 30 MG592415 Vibrio phage 1.031.O._10N.261.46.F8, partial genome 10873-10902 6 0.8
NZ_SRYT01000001_1 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270195-270224 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1590971-1591000 6 0.8
NZ_SRYT01000001_2 2.5|527785|27|NZ_SRYT01000001|CRISPRCasFinder 527785-527811 27 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 111387-111413 6 0.778
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP041427 Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence 56283-56312 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP011362 Salimicrobium jeotgali strain MJ3 plasmid pSJ52, complete sequence 1949-1978 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 CP006767 Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed1, complete sequence 408-437 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 481058-481087 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NC_004922 Lactococcus lactis lactis BGMN1-5 plasmid pMN5, complete sequence 763-792 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP038659 Citrobacter freundii strain 680 plasmid p680_1, complete sequence 363776-363805 7 0.767
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 106851-106880 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 MN794232 Vibrio phage VH1_2019, complete genome 117004-117033 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 NC_005083 Vibrio phage KVP40, complete genome 116465-116494 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 JN849462 Vibriophage phi-pp2, complete genome 116408-116437 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 MT135024 Vibrio phage V05, complete genome 59483-59512 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 AY283928 Bacteriophage KVP40, complete genome 116465-116494 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 MT135026 Vibrio phage V09, complete genome 227856-227885 7 0.767
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 MT135025 Vibrio phage V07, complete genome 164567-164596 7 0.767
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MN176217 Escherichia phage vB_Eco4M-7, complete genome 54013-54042 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 47776-47805 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 JX128258 Escherichia phage ECML-117, complete genome 52688-52717 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 NC_048194 Escherichia phage vB_EcoM_WFH, complete genome 47826-47855 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MT446405 UNVERIFIED: Escherichia virus TH32, complete genome 47325-47354 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MT446408 UNVERIFIED: Escherichia virus TH35, complete genome 8122-8151 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 47764-47793 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 NC_048073 Escherichia phage FEC19, complete genome 22675-22704 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MT684590 Streptomyces phage LilMartin, complete genome 63102-63131 8 0.733
NZ_SRYT01000001_1 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 269997-270026 30 MT897905 Streptomyces phage MulchMansion, complete genome 63102-63131 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 MN693967 Marine virus AFVG_250M992, complete genome 40288-40317 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 100498-100527 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 303135-303164 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 476724-476753 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 475721-475750 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 336359-336388 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 210527-210556 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 508466-508495 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 294951-294980 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1124729-1124758 8 0.733
NZ_SRYT01000001_1 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270129-270158 30 KP671755 Vibrio phage ValKK3, complete genome 10086-10115 8 0.733
NZ_SRYT01000001_1 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270195-270224 30 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 280146-280175 8 0.733
NZ_SRYT01000001_1 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT 270063-270092 30 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 530179-530208 9 0.7

1. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH375074 (Enterococcus phage LY0323, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

2. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH355583 (Enterococcus phage vB_EfaS_LM99, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

3. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721199 (Enterococcus phage vB_EfaS_Ef5.1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

4. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK360024 (Enterococcus phage vB_EfaS_Max, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

5. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to CAJDJX010000002 (Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

6. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT857001 (Enterococcus phage EFA1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

7. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KT932701 (Enterococcus phage vB_EfaS_IME196, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

8. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042023 (Enterococcus phage phiSHEF5, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

9. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042101 (Enterococcus phage PMBT2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

10. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH203383 (Ecterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

11. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721200 (Enterococcus phage vB_EfaS_Ef5.3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

12. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042022 (Enterococcus phage phiSHEF4, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

13. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT520979 (Enterococcus phage vB_EfaS-271, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

14. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH193369 (Enterococcus phage LY0322, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

15. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_031260 (Enterococcus phage Ec-ZZ2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

16. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721186 (Enterococcus phage vB_EfaS_Ef5.2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

17. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042021 (Enterococcus phage phiSHEF2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

18. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX193904 (Enterococcus phage EfaCPT1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

19. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042126 (Enterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

20. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KX284704 (Enterococcus phage SANTOR1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

21. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ127304 (Enterococcus phage AUEF3, partial genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

22. spacer 2.1|527718|46|NZ_SRYT01000001|CRT matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

aggggagaaaaagccaaatcaaaaaagtttgttttggtaccattcc	CRISPR spacer
aggggagaaaaagccaaatcaaaaaagtttgttttggtaccattcc	Protospacer
**********************************************

23. spacer 2.2|527784|46|NZ_SRYT01000001|CRT matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

tatagtcattatgctgaacaagggtttgttgttttggtaccattct	CRISPR spacer
tatagtcattatgctgaacaagggtttgttgttttggtaccattct	Protospacer
**********************************************

24. spacer 2.5|527785|27|NZ_SRYT01000001|CRISPRCasFinder matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

atagtcattatgctgaacaagggtttg	CRISPR spacer
atagtcattatgctgaacaagggtttg	Protospacer
***************************

25. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KF728385 (Enterococcus phage IME_EF3, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ctacaccaaagcgaaacatattcaactttt	Protospacer
.*****************************

26. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

27. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042127 (Enterococcus phage vB_EfaS_AL2, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

28. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MG264739 (UNVERIFIED: Enterococcus phage phiNASRA1, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacgtattcaactttt	Protospacer
*****************.************

29. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to CAJDKF010000002 (Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

30. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KF733017 (Enterococcus phage IME-EF4, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

31. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721191 (Enterococcus phage vB_EfaS_Ef5.4, complete genome) position: , mismatch: 2, identity: 0.933

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaagcttt	Protospacer
************************* .***

32. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK721187 (Enterococcus phage vB_EfaS_Ef6.1, complete genome) position: , mismatch: 2, identity: 0.933

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacatcagagcgaaacatattcaactttt	Protospacer
*****.**.*********************

33. spacer 1.7|270261|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 3, identity: 0.9

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcatcaaagcgaaacatattcaactttc	Protospacer
**.**.***********************.

34. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to LT615366 (Enterococcus phage VPE25 genome assembly, chromosome: VPE25) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

35. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to LT546029 (Enterococcus phage VFW genome assembly, chromosome: VFW) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

36. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to LT546030 (Enterococcus phage VPE25 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

37. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT119361 (Enterococus phage vipetofem, complete genome) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

38. spacer 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MG592415 (Vibrio phage 1.031.O._10N.261.46.F8, partial genome) position: , mismatch: 6, identity: 0.8

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
taatttttagggtgacgagcgtgacgagca	Protospacer
.* * ***.*** **************** 

39. spacer 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
catcagctggggagacaagcgtgccgagcc	Protospacer
**..* .*********.****** ******

40. spacer 2.5|527785|27|NZ_SRYT01000001|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 6, identity: 0.778

atagtcattatgctgaacaagggtttg	CRISPR spacer
gaggtcatgatgccgaacaagggtttc	Protospacer
. .***** ****.************ 

41. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041427 (Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
tccacaaaagaaaataatttatttaattca	Protospacer
... *************** ***.**** *

42. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011362 (Salimicrobium jeotgali strain MJ3 plasmid pSJ52, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ggctgaaaagaaaatatttaattcaattgg	Protospacer
  .* *********** **.*********.

43. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to CP006767 (Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

---ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aaatttt---aagaaaattattgattcaattag	Protospacer
   .***   ******** ************..

44. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaacacgt	Protospacer
************** ****.*** *  .* 

45. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_004922 (Lactococcus lactis lactis BGMN1-5 plasmid pMN5, complete sequence) position: , mismatch: 7, identity: 0.767

---ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aaatttt---aagaaaattattgattcaattag	Protospacer
   .***   ******** ************..

46. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
atttcaaaagaaattaattgatgctgatta	Protospacer
 ************ ******** * . * *

47. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaacacgt	Protospacer
************** ****.*** *  .* 

48. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN794232 (Vibrio phage VH1_2019, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

49. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_005083 (Vibrio phage KVP40, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

50. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to JN849462 (Vibriophage phi-pp2, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

51. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT135024 (Vibrio phage V05, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

52. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to AY283928 (Bacteriophage KVP40, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

53. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT135026 (Vibrio phage V09, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

54. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT135025 (Vibrio phage V07, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

55. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN176217 (Escherichia phage vB_Eco4M-7, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

56. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

57. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX128258 (Escherichia phage ECML-117, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

58. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_048194 (Escherichia phage vB_EcoM_WFH, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

59. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT446405 (UNVERIFIED: Escherichia virus TH32, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

60. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT446408 (UNVERIFIED: Escherichia virus TH35, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

61. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

62. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_048073 (Escherichia phage FEC19, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

63. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT684590 (Streptomyces phage LilMartin, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
gggagtttcaagagcttcatgatttcatga	Protospacer
 .************** ***** **  * .

64. spacer 1.3|269997|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT897905 (Streptomyces phage MulchMansion, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
gggagtttcaagagcttcatgatttcatga	Protospacer
 .************** ***** **  * .

65. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN693967 (Marine virus AFVG_250M992, complete genome) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
tttttaaaagaaaataatggattcacagct	Protospacer
.***.************* ******     

66. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

67. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

68. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

69. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

70. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

71. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

72. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

73. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

74. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aacgaaaaagaaaataattgatttagttaa	Protospacer
  .  ******************.*.**.*

75. spacer 1.5|270129|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to KP671755 (Vibrio phage ValKK3, complete genome) position: , mismatch: 8, identity: 0.733

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgacaggtgcgccgactagataaacaggta	Protospacer
* ..  ********* ******** ****.

76. spacer 1.6|270195|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
ccgactttggggcgacgagcctgacgagag	Protospacer
*    ******* ******* *******  

77. spacer 1.4|270063|30|NZ_SRYT01000001|PILER-CR,CRISPRCasFinder,CRT matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
taaagataagaaaataattgatttaattcc	Protospacer
.    * ****************.****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 292571 : 301216 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 482459 : 505993 30 Enterococcus_phage(54.55%) capsid,terminase,portal,transposase,integrase attL 485440:485454|attR 506692:506706
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_SRYT01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39951 : 50865 12 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_SRYT01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_SRYT01000015_1 5371-5502 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5073-5102 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 602-631 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 515-544 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33709-33738 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7643-7672 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66171-66200 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12176-12205 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 503-532 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60906-60935 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92754-92783 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 503-532 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5526-5555 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43889-43918 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83505-83534 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9536-9565 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4944-4973 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 827-856 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 548-577 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 461-490 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33655-33684 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 449-478 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5472-5501 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43943-43972 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83451-83480 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4998-5027 0 1.0
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 773-802 0 1.0
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 748-777 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7697-7726 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66225-66254 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12230-12259 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60960-60989 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92808-92837 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 449-478 1 0.967
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5019-5048 2 0.933
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 694-723 2 0.933
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9482-9511 2 0.933
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 31963-31992 6 0.8
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 MT711976 Streptomyces phage Coruscant, complete genome 87401-87430 7 0.767
NZ_SRYT01000015_1 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder 5449-5478 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 586542-586571 7 0.767
NZ_SRYT01000015_1 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder 5395-5424 30 JQ660954 Clostridium phage PhiS63, complete genome 22890-22919 9 0.7

1. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

2. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

3. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

4. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

5. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

6. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

7. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

8. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

9. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

10. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

11. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

12. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

13. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

14. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

15. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

16. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

17. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattattggattcttctggac	Protospacer
******************************

18. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

19. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

20. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

21. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

22. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

23. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

24. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

25. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

26. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgattttatcatgtttatccgaag	Protospacer
******************************

27. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.967

aagtactggtattattggattcttctggac	CRISPR spacer
aagtcctggtattattggattcttctggac	Protospacer
**** *************************

28. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaatgccgattttatcatgtttatccgaag	Protospacer
***.**************************

29. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgctgattttatcatgtttatccgaag	Protospacer
******.***********************

30. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaatgccgattttatcatgtttatccgaag	Protospacer
***.**************************

31. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaatgccgattttatcatgtttatccgaag	Protospacer
***.**************************

32. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaatgccgattttatcatgtttatccgaag	Protospacer
***.**************************

33. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgctgattttatcatgtttatccgaag	Protospacer
******.***********************

34. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 2, identity: 0.933

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgttgattttatcatgtttatccgaag	Protospacer
*****..***********************

35. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 2, identity: 0.933

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgttgattttatcatgtttatccgaag	Protospacer
*****..***********************

36. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 2, identity: 0.933

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgttgattttatcatgtttatccgaag	Protospacer
*****..***********************

37. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 6, identity: 0.8

aagtactggtattattggattcttctggac	CRISPR spacer
aagtactggtattaaaggattcttcaaaat	Protospacer
**************  ********* ..*.

38. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to MT711976 (Streptomyces phage Coruscant, complete genome) position: , mismatch: 7, identity: 0.767

aagtactggtattattggattcttctggac	CRISPR spacer
acagagtggttttattggcttcttctggat	Protospacer
* . * **** ******* **********.

39. spacer 1.2|5449|30|NZ_SRYT01000015|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 7, identity: 0.767

aaacgccgattttatcatgtttatccgaag	CRISPR spacer
aaacgccgtttttatcatttttaatggtgg	Protospacer
******** ********* **** . * .*

40. spacer 1.1|5395|30|NZ_SRYT01000015|CRISPRCasFinder matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 9, identity: 0.7

aagtactggtattattggattcttctggac	CRISPR spacer
ttgtactgatattattggtttcttcgtttt	Protospacer
  ******.********* ******    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_SRYT01000015.1|WP_002401839.1|13423_13753_-|hypothetical-protein 13423_13753_- 109 aa aa AcrIIA17 HTH_49 NA No NA
NZ_SRYT01000015.1|WP_025188019.1|13766_14381_-|hypothetical-protein 13766_14381_- 204 aa aa AcrIIA16 HTH_49 NA No NA
4. NZ_SRYT01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 108843 : 129253 22 Enterococcus_phage(37.5%) tRNA,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_SRYT01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 147234 : 153945 7 Enterococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_SRYT01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_SRYT01000006_1 87240-87313 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_SRYT01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 78253 : 86167 11 Planktothrix_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage