| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000068 | Neisseria meningitidis strain Nm360527 Scaffold68, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000073 | Neisseria meningitidis strain Nm360527 Scaffold74, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000030 | Neisseria meningitidis strain Nm360527 Scaffold30, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000077 | Neisseria meningitidis strain Nm360527 Scaffold78, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000038 | Neisseria meningitidis strain Nm360527 Scaffold38, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000020 | Neisseria meningitidis strain Nm360527 Scaffold20, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000043 | Neisseria meningitidis strain Nm360527 Scaffold43, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000008 | Neisseria meningitidis strain Nm360527 Scaffold8, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000024 | Neisseria meningitidis strain Nm360527 Scaffold24, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_JWNH01000050 | Neisseria meningitidis strain Nm360527 Scaffold50, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000026 | Neisseria meningitidis strain Nm360527 Scaffold26, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000037 | Neisseria meningitidis strain Nm360527 Scaffold37, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000007 | Neisseria meningitidis strain Nm360527 Scaffold7, whole genome shotgun sequence | 2 crisprs | 0 | 2 | 0 | 0 | |
| NZ_JWNH01000071 | Neisseria meningitidis strain Nm360527 Scaffold71, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000027 | Neisseria meningitidis strain Nm360527 Scaffold27, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000046 | Neisseria meningitidis strain Nm360527 Scaffold46, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000039 | Neisseria meningitidis strain Nm360527 Scaffold39, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000049 | Neisseria meningitidis strain Nm360527 Scaffold49, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000012 | Neisseria meningitidis strain Nm360527 Scaffold12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000021 | Neisseria meningitidis strain Nm360527 Scaffold21, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_JWNH01000005 | Neisseria meningitidis strain Nm360527 Scaffold5, whole genome shotgun sequence | 4 crisprs | 3 | 0 | 0 | 0 | |
| NZ_JWNH01000033 | Neisseria meningitidis strain Nm360527 Scaffold33, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000069 | Neisseria meningitidis strain Nm360527 Scaffold69, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000075 | Neisseria meningitidis strain Nm360527 Scaffold76, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000022 | Neisseria meningitidis strain Nm360527 Scaffold22, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000041 | Neisseria meningitidis strain Nm360527 Scaffold41, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_JWNH01000003 | Neisseria meningitidis strain Nm360527 Scaffold3, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 1 | 0 | |
| NZ_JWNH01000072 | Neisseria meningitidis strain Nm360527 Scaffold72, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000055 | Neisseria meningitidis strain Nm360527 Scaffold55, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000061 | Neisseria meningitidis strain Nm360527 Scaffold61, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000074 | Neisseria meningitidis strain Nm360527 Scaffold75, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000015 | Neisseria meningitidis strain Nm360527 Scaffold15, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000044 | Neisseria meningitidis strain Nm360527 Scaffold44, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000062 | Neisseria meningitidis strain Nm360527 Scaffold62, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000063 | Neisseria meningitidis strain Nm360527 Scaffold63, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000031 | Neisseria meningitidis strain Nm360527 Scaffold31, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000028 | Neisseria meningitidis strain Nm360527 Scaffold28, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_JWNH01000065 | Neisseria meningitidis strain Nm360527 Scaffold65, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000040 | Neisseria meningitidis strain Nm360527 Scaffold40, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000056 | Neisseria meningitidis strain Nm360527 Scaffold56, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000066 | Neisseria meningitidis strain Nm360527 Scaffold66, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000032 | Neisseria meningitidis strain Nm360527 Scaffold32, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000014 | Neisseria meningitidis strain Nm360527 Scaffold14, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000058 | Neisseria meningitidis strain Nm360527 Scaffold58, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000010 | Neisseria meningitidis strain Nm360527 Scaffold10, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000047 | Neisseria meningitidis strain Nm360527 Scaffold47, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_JWNH01000023 | Neisseria meningitidis strain Nm360527 Scaffold23, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000017 | Neisseria meningitidis strain Nm360527 Scaffold17, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000029 | Neisseria meningitidis strain Nm360527 Scaffold29, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000045 | Neisseria meningitidis strain Nm360527 Scaffold45, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000011 | Neisseria meningitidis strain Nm360527 Scaffold11, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000034 | Neisseria meningitidis strain Nm360527 Scaffold34, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000009 | Neisseria meningitidis strain Nm360527 Scaffold9, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000036 | Neisseria meningitidis strain Nm360527 Scaffold36, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000025 | Neisseria meningitidis strain Nm360527 Scaffold25, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000053 | Neisseria meningitidis strain Nm360527 Scaffold53, whole genome shotgun sequence | 2 crisprs | 1 | 0 | 0 | 0 | |
| NZ_JWNH01000060 | Neisseria meningitidis strain Nm360527 Scaffold60, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000067 | Neisseria meningitidis strain Nm360527 Scaffold67, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000042 | Neisseria meningitidis strain Nm360527 Scaffold42, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000059 | Neisseria meningitidis strain Nm360527 Scaffold59, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000052 | Neisseria meningitidis strain Nm360527 Scaffold52, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000001 | Neisseria meningitidis strain Nm360527 Scaffold1, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_JWNH01000016 | Neisseria meningitidis strain Nm360527 Scaffold16, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000035 | Neisseria meningitidis strain Nm360527 Scaffold35, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000002 | Neisseria meningitidis strain Nm360527 Scaffold2, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000070 | Neisseria meningitidis strain Nm360527 Scaffold70, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000064 | Neisseria meningitidis strain Nm360527 Scaffold64, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000013 | Neisseria meningitidis strain Nm360527 Scaffold13, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000019 | Neisseria meningitidis strain Nm360527 Scaffold19, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000051 | Neisseria meningitidis strain Nm360527 Scaffold51, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000054 | Neisseria meningitidis strain Nm360527 Scaffold54, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000048 | Neisseria meningitidis strain Nm360527 Scaffold48, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000006 | Neisseria meningitidis strain Nm360527 Scaffold6, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_JWNH01000018 | Neisseria meningitidis strain Nm360527 Scaffold18, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000004 | Neisseria meningitidis strain Nm360527 Scaffold4, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 1 | 2 | |
| NZ_JWNH01000057 | Neisseria meningitidis strain Nm360527 Scaffold57, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_JWNH01000076 | Neisseria meningitidis strain Nm360527 Scaffold77, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000001.1 | 85027-85052 | 0 | 1.0 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000001.1 | 85474-85499 | 0 | 1.0 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000001.1 | 86013-86038 | 0 | 1.0 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000017.1 | 38218-38243 | 0 | 1.0 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000027.1 | 25517-25542 | 1 | 0.962 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000030.1 | 59-84 | 1 | 0.962 | |
| NZ_JWNH01000028_1 | 20797-20822 | 26 | NZ_JWNH01000045.1 | 379-404 | 0 | 1.0 |
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgtaggttttcttaaccctgcgtc Protospacer **************************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgtaggttttcttaaccctgcgtc Protospacer **************************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgtaggttttcttaaccctgcgtc Protospacer **************************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgtaggttttcttaaccctgcgtc Protospacer **************************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgcaggttttcttaaccctgcgtc Protospacer ****.*********************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgcaggttttcttaaccctgcgtc Protospacer ****.*********************
gatgtaggttttcttaaccctgcgtc CRISPR spacer gatgtaggttttcttaaccctgcgtc Protospacer **************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 197066 : 205365 | 7 | Synechococcus_phage(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000053_1 | 3888-4069 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000053_2 | 4165-4266 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000053_1 | 3913-3962 | 50 | NZ_JWNH01000005.1 | 33204-33253 | 1 | 0.98 | |
| NZ_JWNH01000053_1 | 3913-3962 | 50 | NZ_JWNH01000005.1 | 33758-33807 | 1 | 0.98 | |
| NZ_JWNH01000053_1 | 3913-3962 | 50 | NZ_JWNH01000005.1 | 34035-34084 | 1 | 0.98 |
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat CRISPR spacer tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat Protospacer ***************.**********************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000021_1 | 1547-1582 | 36 | NZ_JWNH01000002.1 | 82818-82853 | 1 | 0.972 | |
| NZ_JWNH01000021_1 | 1547-1582 | 36 | NZ_JWNH01000002.1 | 82594-82629 | 2 | 0.944 | |
| NZ_JWNH01000021_1 | 1547-1582 | 36 | NZ_JWNH01000021.1 | 255-290 | 1 | 0.972 |
gtcttttataaactttgaatattgctgttatcccaa CRISPR spacer gtcttttataacctttgaatattgctgttatcccaa Protospacer *********** ************************
gtcttttataaactttgaatattgctgttatcccaa CRISPR spacer gtcttttataacctttgaatattgccgttatcccaa Protospacer *********** *************.**********
gtcttttataaactttgaatattgctgttatcccaa CRISPR spacer gtcttttataacctttgaatattgctgttatcccaa Protospacer *********** ************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000005_1 | 21391-21471 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000005_2 | 27650-27750 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000005_3 | 28134-28307 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000005_4 | 122832-122937 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000005_1 | 21417-21445 | 29 | NZ_JWNH01000027.1 | 25517-25545 | 2 | 0.931 | |
| NZ_JWNH01000005_1 | 21417-21445 | 29 | NZ_JWNH01000030.1 | 59-87 | 2 | 0.931 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000014.1 | 21893-21936 | 1 | 0.977 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000047.1 | 7905-7948 | 0 | 1.0 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000005.1 | 27298-27341 | 0 | 1.0 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000005.1 | 27601-27644 | 0 | 1.0 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000009.1 | 49646-49689 | 0 | 1.0 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000009.1 | 49898-49941 | 0 | 1.0 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000009.1 | 50150-50193 | 1 | 0.977 | |
| NZ_JWNH01000005_2 | 27678-27721 | 44 | NZ_JWNH01000009.1 | 43549-43592 | 2 | 0.955 | |
| NZ_JWNH01000005_3 | 28162-28205 | 44 | NZ_JWNH01000001.1 | 67308-67351 | 0 | 1.0 | |
| NZ_JWNH01000005_3 | 28162-28205 | 44 | NZ_JWNH01000001.1 | 67590-67633 | 1 | 0.977 | |
| NZ_JWNH01000005_3 | 28162-28205 | 44 | NZ_JWNH01000021.1 | 25429-25472 | 1 | 0.977 |
tagaacgcggggttaagaaaacctgcatc CRISPR spacer taggacgcagggttaagaaaacctgcatc Protospacer ***.****.********************
tagaacgcggggttaagaaaacctgcatc CRISPR spacer taggacgcagggttaagaaaacctgcatc Protospacer ***.****.********************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaaatttcgggtaacttccac Protospacer **************************.*****************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaagtttcgggtaacttctac Protospacer *****************************************.**
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer agttcgttcggtttcgcttgttttaaatttcgggtaacttctac Protospacer **************************.**************.**
ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer ********************************************
ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer ggctcgttcggtttcgcttgttttaagtttcgggtaacttccac Protospacer **.*****************************************
ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac CRISPR spacer ggttcgttcggtttcacttgttttaagtttcgggtaacttccac Protospacer ***************.****************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000047_1 | 8880-8926 | 47 | NZ_JWNH01000021.1 | 638-684 | 2 | 0.957 | |
| NZ_JWNH01000047_1 | 8880-8926 | 47 | NZ_JWNH01000006.1 | 46976-47022 | 1 | 0.979 |
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagcc CRISPR spacer tttagaagttgcccgaaatctcaaaaaaaaccgaaaccgaacaaacc Protospacer ******************.*************************.**
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagcc CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagcc Protospacer *******************************.***************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1101 : 7319 | 11 | Burkholderia_virus(33.33%) | attL 607:619|attR 13162:13174 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 102406 : 111617 | 9 | Burkholderia_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_JWNH01000006_1 | 46198-46244 | 47 | NZ_JWNH01000040.1 | 16974-17020 | 0 | 1.0 |
ggtctgttcggtttcagttgtttttgggtttcgggtaatttccaaat CRISPR spacer ggtctgttcggtttcagttgtttttgggtttcgggtaatttccaaat Protospacer ***********************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 6364 : 29095 | 26 | Haemophilus_phage(45.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 24774 : 37819 | 13 | Pseudomonas_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_JWNH01000004.1_24531_24741_+ | No | NA |
| 123 aa aa | NA | NA | NZ_JWNH01000004.1_24531_24741_+ | No | NA |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000007_1 | 20293-20371 | Orphan |
NA
|
1 spacers
|
DinG |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_JWNH01000007_2 | 29890-30097 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_JWNH01000007_2 | 29926-29952 | 27 | MN850587 | Escherichia phage mistaenkt, complete genome | 12272-12298 | 2 | 0.926 | |
| NZ_JWNH01000007_2 | 29926-29952 | 27 | MN850587 | Escherichia phage mistaenkt, complete genome | 12263-12289 | 3 | 0.889 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP054621 | Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence | 748041-748069 | 4 | 0.862 | |
| NZ_JWNH01000007_2 | 29926-29952 | 27 | MN693680 | Marine virus AFVG_250M653, complete genome | 16786-16812 | 4 | 0.852 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016587 | Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence | 85917-85945 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016587 | Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence | 107806-107834 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016587 | Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence | 456119-456147 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016587 | Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence | 473742-473770 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016623 | Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence | 84056-84084 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016624 | Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence | 101875-101903 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP054615 | Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence | 306836-306864 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 58018-58046 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 365563-365591 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 624557-624585 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 861517-861545 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 1741801-1741829 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP022367 | Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence | 1328784-1328812 | 5 | 0.828 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP016453 | Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence | 339480-339508 | 5 | 0.828 | |
| NZ_JWNH01000007_2 | 29926-29952 | 27 | NZ_CP043499 | Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence | 662992-663018 | 5 | 0.815 | |
| NZ_JWNH01000007_2 | 29926-29952 | 27 | NZ_CP047261 | Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence | 290453-290479 | 5 | 0.815 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016587 | Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence | 161433-161461 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016624 | Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence | 468489-468517 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 624493-624521 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 347827-347855 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 428157-428185 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 1011611-1011639 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP019045 | Halioglobus pacificus strain RR3-57 plasmid pRR3-57, complete sequence | 140523-140551 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_LR134417 | Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 8 | 104885-104913 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP012940 | Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence | 1009433-1009461 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP012944 | Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence | 833488-833516 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP029356 | Azospirillum sp. CFH 70021 plasmid unnamed1 | 781058-781086 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_017575 | Ralstonia solanacearum Po82 megaplasmid, complete sequence | 1512874-1512902 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP026308 | Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence | 1512818-1512846 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP038636 | Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence | 357881-357909 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP051295 | Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence | 1000427-1000455 | 6 | 0.793 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP054621 | Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence | 747977-748005 | 7 | 0.759 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 352492-352520 | 7 | 0.759 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 715171-715199 | 7 | 0.759 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NC_016108 | Methylomicrobium alcaliphilum 20Z plasmid MEALZ_p, complete sequence | 1776-1804 | 7 | 0.759 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 13254-13282 | 8 | 0.724 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 1624687-1624715 | 8 | 0.724 | |
| NZ_JWNH01000007_1 | 20318-20346 | 29 | NZ_CP050093 | Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence | 171172-171200 | 8 | 0.724 |
ggcaactttggcaactttggcaacttt CRISPR spacer ggcaactttggcaactttggcaactgg Protospacer *************************
ggcaactttggcaactttggcaacttt CRISPR spacer aacagctttggcaactttggcaacttt Protospacer ..**.**********************
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgcaggcgggaatc Protospacer *******************.******
ggcaactttggcaactttggcaacttt CRISPR spacer ggcaactttggcaacatgggcaacgtc Protospacer *************** * ****** *.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer tggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer aagccgtcattcccgcgaaggcgggaatc Protospacer . *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggaatc Protospacer *************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer gcgccgtcattcccgcgaaggcggcattc Protospacer ***************** ***.** * *
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cctccgtcattcccgcgaaggcgggaatc Protospacer * ************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer tccccgtcattcccgcgaaggcgggaatc Protospacer * ************** ***.******
ggcaactttggcaactttggcaacttt CRISPR spacer ggcaacgttggcaacgttggcaacgcc Protospacer ****** ******** ******** ..
ggcaactttggcaactttggcaacttt CRISPR spacer atcacctttggcaaccttggcaactat Protospacer . ** **********.********* *
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cgaccgtcattcccgcgaaggcgggaatc Protospacer .************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer aacccgtcattcccgcgaaggcgggaatc Protospacer . ************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cgcccgtcattcccgcgaaggcgggaatc Protospacer ************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcattcccgcgaaggcgggactc Protospacer *************** ***.**** *
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer gacccgtcattcccgcgaaggcgggaacc Protospacer * ************** ***.*****.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer tcgttgtcattcccgcgcaggcgggaacc Protospacer **..****************.*****.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ttcccgtcattcccgcgaaggcgggaatc Protospacer . ************** ***.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer aatctgtcattcccgcgtaggtgggaatg Protospacer . *.************.**********.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ccgccggccttcccgcgcaggtggcgatc Protospacer ***** * *************** .**
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ccgccggccttcccgcgcaggtggcgatc Protospacer ***** * *************** .**
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cccccgtcattcccgcgaaggcgggactc Protospacer * ************** ***.**** *
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ccgccggccttcccgcgcaggtggcgatc Protospacer ***** * *************** .**
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ccgccggccttcccgcgcaggtggcgatc Protospacer ***** * *************** .**
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer gggatgacattcccgcgcaggcgggaatc Protospacer * * .* **************.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ccgccggccttcccgcgcaggtggcgatc Protospacer ***** * *************** .**
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtcatccccgcgcaggcggggaac Protospacer ********.**********.***.*
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer atcccgtcattcccgcgaaggcgggaacc Protospacer .. ************** ***.*****.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ttcccgtcattcccgcgaaggcgggaacc Protospacer . ************** ***.*****.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer agatcgtcatccccgcgcaggcgggaatc Protospacer . ..******.**********.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer aactagtcatccccgcgcaggcgggaatc Protospacer . . *****.**********.******
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer ttatcgtcattcccgcgaaggcgggaacc Protospacer ...************* ***.*****.
gcgccgtcattcccgcgcaggtgggaata CRISPR spacer cggccgtctttcccgcgcaggtgtatcca Protospacer ****** ************** . .*
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|