Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JWNH01000030 Neisseria meningitidis strain Nm360527 Scaffold30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000067 Neisseria meningitidis strain Nm360527 Scaffold67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000036 Neisseria meningitidis strain Nm360527 Scaffold36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000040 Neisseria meningitidis strain Nm360527 Scaffold40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000005 Neisseria meningitidis strain Nm360527 Scaffold5, whole genome shotgun sequence 4 crisprs NA 3 0 0 0
NZ_JWNH01000022 Neisseria meningitidis strain Nm360527 Scaffold22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000002 Neisseria meningitidis strain Nm360527 Scaffold2, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JWNH01000041 Neisseria meningitidis strain Nm360527 Scaffold41, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JWNH01000055 Neisseria meningitidis strain Nm360527 Scaffold55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000060 Neisseria meningitidis strain Nm360527 Scaffold60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000075 Neisseria meningitidis strain Nm360527 Scaffold76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000031 Neisseria meningitidis strain Nm360527 Scaffold31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000037 Neisseria meningitidis strain Nm360527 Scaffold37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000072 Neisseria meningitidis strain Nm360527 Scaffold72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000066 Neisseria meningitidis strain Nm360527 Scaffold66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000039 Neisseria meningitidis strain Nm360527 Scaffold39, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JWNH01000043 Neisseria meningitidis strain Nm360527 Scaffold43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000063 Neisseria meningitidis strain Nm360527 Scaffold63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000046 Neisseria meningitidis strain Nm360527 Scaffold46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000057 Neisseria meningitidis strain Nm360527 Scaffold57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000020 Neisseria meningitidis strain Nm360527 Scaffold20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000007 Neisseria meningitidis strain Nm360527 Scaffold7, whole genome shotgun sequence 2 crisprs DinG 0 2 0 0
NZ_JWNH01000052 Neisseria meningitidis strain Nm360527 Scaffold52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000058 Neisseria meningitidis strain Nm360527 Scaffold58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000064 Neisseria meningitidis strain Nm360527 Scaffold64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000069 Neisseria meningitidis strain Nm360527 Scaffold69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000056 Neisseria meningitidis strain Nm360527 Scaffold56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000028 Neisseria meningitidis strain Nm360527 Scaffold28, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_JWNH01000051 Neisseria meningitidis strain Nm360527 Scaffold51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000032 Neisseria meningitidis strain Nm360527 Scaffold32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000062 Neisseria meningitidis strain Nm360527 Scaffold62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000045 Neisseria meningitidis strain Nm360527 Scaffold45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000053 Neisseria meningitidis strain Nm360527 Scaffold53, whole genome shotgun sequence 2 crisprs NA 1 0 0 0
NZ_JWNH01000015 Neisseria meningitidis strain Nm360527 Scaffold15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000049 Neisseria meningitidis strain Nm360527 Scaffold49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000010 Neisseria meningitidis strain Nm360527 Scaffold10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000035 Neisseria meningitidis strain Nm360527 Scaffold35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000074 Neisseria meningitidis strain Nm360527 Scaffold75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000004 Neisseria meningitidis strain Nm360527 Scaffold4, whole genome shotgun sequence 1 crisprs csa3 0 0 1 2
NZ_JWNH01000012 Neisseria meningitidis strain Nm360527 Scaffold12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000076 Neisseria meningitidis strain Nm360527 Scaffold77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000023 Neisseria meningitidis strain Nm360527 Scaffold23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000050 Neisseria meningitidis strain Nm360527 Scaffold50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000042 Neisseria meningitidis strain Nm360527 Scaffold42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000017 Neisseria meningitidis strain Nm360527 Scaffold17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000001 Neisseria meningitidis strain Nm360527 Scaffold1, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JWNH01000054 Neisseria meningitidis strain Nm360527 Scaffold54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000021 Neisseria meningitidis strain Nm360527 Scaffold21, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_JWNH01000034 Neisseria meningitidis strain Nm360527 Scaffold34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000014 Neisseria meningitidis strain Nm360527 Scaffold14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000018 Neisseria meningitidis strain Nm360527 Scaffold18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000027 Neisseria meningitidis strain Nm360527 Scaffold27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000068 Neisseria meningitidis strain Nm360527 Scaffold68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000044 Neisseria meningitidis strain Nm360527 Scaffold44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000003 Neisseria meningitidis strain Nm360527 Scaffold3, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_JWNH01000073 Neisseria meningitidis strain Nm360527 Scaffold74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000024 Neisseria meningitidis strain Nm360527 Scaffold24, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JWNH01000009 Neisseria meningitidis strain Nm360527 Scaffold9, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_JWNH01000070 Neisseria meningitidis strain Nm360527 Scaffold70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000048 Neisseria meningitidis strain Nm360527 Scaffold48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000013 Neisseria meningitidis strain Nm360527 Scaffold13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000047 Neisseria meningitidis strain Nm360527 Scaffold47, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_JWNH01000059 Neisseria meningitidis strain Nm360527 Scaffold59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000071 Neisseria meningitidis strain Nm360527 Scaffold71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000077 Neisseria meningitidis strain Nm360527 Scaffold78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000006 Neisseria meningitidis strain Nm360527 Scaffold6, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_JWNH01000008 Neisseria meningitidis strain Nm360527 Scaffold8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000011 Neisseria meningitidis strain Nm360527 Scaffold11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000065 Neisseria meningitidis strain Nm360527 Scaffold65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000029 Neisseria meningitidis strain Nm360527 Scaffold29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000033 Neisseria meningitidis strain Nm360527 Scaffold33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000016 Neisseria meningitidis strain Nm360527 Scaffold16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000061 Neisseria meningitidis strain Nm360527 Scaffold61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000019 Neisseria meningitidis strain Nm360527 Scaffold19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000026 Neisseria meningitidis strain Nm360527 Scaffold26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000025 Neisseria meningitidis strain Nm360527 Scaffold25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JWNH01000038 Neisseria meningitidis strain Nm360527 Scaffold38, whole genome shotgun sequence 0 crisprs c2c4_V-U1 0 0 0 0

Results visualization

1. NZ_JWNH01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_JWNH01000047
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000047_1 8853-8953 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000047_1 1.1|8880|47|NZ_JWNH01000047|CRISPRCasFinder 8880-8926 47 NZ_JWNH01000021.1 638-684 2 0.957
NZ_JWNH01000047_1 1.1|8880|47|NZ_JWNH01000047|CRISPRCasFinder 8880-8926 47 NZ_JWNH01000006.1 46976-47022 1 0.979

1. spacer 1.1|8880|47|NZ_JWNH01000047|CRISPRCasFinder matches to position: 638-684, mismatch: 2, identity: 0.957

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagcc	CRISPR spacer
tttagaagttgcccgaaatctcaaaaaaaaccgaaaccgaacaaacc	Protospacer
******************.*************************.**

2. spacer 1.1|8880|47|NZ_JWNH01000047|CRISPRCasFinder matches to position: 46976-47022, mismatch: 1, identity: 0.979

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagcc	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagcc	Protospacer
*******************************.***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JWNH01000040
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JWNH01000005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000005_1 21391-21471 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000005_2 27650-27750 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000005_3 28134-28307 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000005_4 122832-122937 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000005_1 1.1|21417|29|NZ_JWNH01000005|CRISPRCasFinder 21417-21445 29 NZ_JWNH01000027.1 25517-25545 2 0.931
NZ_JWNH01000005_1 1.1|21417|29|NZ_JWNH01000005|CRISPRCasFinder 21417-21445 29 NZ_JWNH01000030.1 59-87 2 0.931
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000014.1 21893-21936 1 0.977
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000047.1 7905-7948 0 1.0
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000005.1 27298-27341 0 1.0
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000005.1 27601-27644 0 1.0
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000009.1 49646-49689 0 1.0
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000009.1 49898-49941 0 1.0
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000009.1 50150-50193 1 0.977
NZ_JWNH01000005_2 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder 27678-27721 44 NZ_JWNH01000009.1 43549-43592 2 0.955
NZ_JWNH01000005_3 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder 28162-28205 44 NZ_JWNH01000001.1 67308-67351 0 1.0
NZ_JWNH01000005_3 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder 28162-28205 44 NZ_JWNH01000001.1 67590-67633 1 0.977
NZ_JWNH01000005_3 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder 28162-28205 44 NZ_JWNH01000021.1 25429-25472 1 0.977

1. spacer 1.1|21417|29|NZ_JWNH01000005|CRISPRCasFinder matches to position: 25517-25545, mismatch: 2, identity: 0.931

tagaacgcggggttaagaaaacctgcatc	CRISPR spacer
taggacgcagggttaagaaaacctgcatc	Protospacer
***.****.********************

2. spacer 1.1|21417|29|NZ_JWNH01000005|CRISPRCasFinder matches to position: 59-87, mismatch: 2, identity: 0.931

tagaacgcggggttaagaaaacctgcatc	CRISPR spacer
taggacgcagggttaagaaaacctgcatc	Protospacer
***.****.********************

3. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 21893-21936, mismatch: 1, identity: 0.977

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaaatttcgggtaacttccac	Protospacer
**************************.*****************

4. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 7905-7948, mismatch: 0, identity: 1.0

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

5. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 27298-27341, mismatch: 0, identity: 1.0

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

6. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 27601-27644, mismatch: 0, identity: 1.0

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

7. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 49646-49689, mismatch: 0, identity: 1.0

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

8. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 49898-49941, mismatch: 0, identity: 1.0

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

9. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 50150-50193, mismatch: 1, identity: 0.977

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaagtttcgggtaacttctac	Protospacer
*****************************************.**

10. spacer 2.1|27678|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 43549-43592, mismatch: 2, identity: 0.955

agttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
agttcgttcggtttcgcttgttttaaatttcgggtaacttctac	Protospacer
**************************.**************.**

11. spacer 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 67308-67351, mismatch: 0, identity: 1.0

ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
********************************************

12. spacer 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 67590-67633, mismatch: 1, identity: 0.977

ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
ggctcgttcggtttcgcttgttttaagtttcgggtaacttccac	Protospacer
**.*****************************************

13. spacer 3.1|28162|44|NZ_JWNH01000005|CRISPRCasFinder matches to position: 25429-25472, mismatch: 1, identity: 0.977

ggttcgttcggtttcgcttgttttaagtttcgggtaacttccac	CRISPR spacer
ggttcgttcggtttcacttgttttaagtttcgggtaacttccac	Protospacer
***************.****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JWNH01000045
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_JWNH01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_JWNH01000053
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000053_1 3888-4069 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000053_2 4165-4266 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000053_1 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder 3913-3962 50 NZ_JWNH01000005.1 33204-33253 1 0.98
NZ_JWNH01000053_1 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder 3913-3962 50 NZ_JWNH01000005.1 33758-33807 1 0.98
NZ_JWNH01000053_1 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder 3913-3962 50 NZ_JWNH01000005.1 34035-34084 1 0.98

1. spacer 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder matches to position: 33204-33253, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

2. spacer 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder matches to position: 33758-33807, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

3. spacer 1.1|3913|50|NZ_JWNH01000053|CRISPRCasFinder matches to position: 34035-34084, mismatch: 1, identity: 0.98

tagaacccaacacggtaaaaatttatccgaagcgacaacaatcttttcat	CRISPR spacer
tagaacccaacacggcaaaaatttatccgaagcgacaacaatcttttcat	Protospacer
***************.**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JWNH01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 197066 : 205365 7 Synechococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_JWNH01000021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000021_1 1428-1614 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000021_1 1.2|1547|36|NZ_JWNH01000021|PILER-CR 1547-1582 36 NZ_JWNH01000002.1 82818-82853 1 0.972
NZ_JWNH01000021_1 1.2|1547|36|NZ_JWNH01000021|PILER-CR 1547-1582 36 NZ_JWNH01000002.1 82594-82629 2 0.944
NZ_JWNH01000021_1 1.2|1547|36|NZ_JWNH01000021|PILER-CR 1547-1582 36 NZ_JWNH01000021.1 255-290 1 0.972

1. spacer 1.2|1547|36|NZ_JWNH01000021|PILER-CR matches to position: 82818-82853, mismatch: 1, identity: 0.972

gtcttttataaactttgaatattgctgttatcccaa	CRISPR spacer
gtcttttataacctttgaatattgctgttatcccaa	Protospacer
*********** ************************

2. spacer 1.2|1547|36|NZ_JWNH01000021|PILER-CR matches to position: 82594-82629, mismatch: 2, identity: 0.944

gtcttttataaactttgaatattgctgttatcccaa	CRISPR spacer
gtcttttataacctttgaatattgccgttatcccaa	Protospacer
*********** *************.**********

3. spacer 1.2|1547|36|NZ_JWNH01000021|PILER-CR matches to position: 255-290, mismatch: 1, identity: 0.972

gtcttttataaactttgaatattgctgttatcccaa	CRISPR spacer
gtcttttataacctttgaatattgctgttatcccaa	Protospacer
*********** ************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_JWNH01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000006_1 46172-46270 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000006_1 1.1|46198|47|NZ_JWNH01000006|CRISPRCasFinder 46198-46244 47 NZ_JWNH01000040.1 16974-17020 0 1.0

1. spacer 1.1|46198|47|NZ_JWNH01000006|CRISPRCasFinder matches to position: 16974-17020, mismatch: 0, identity: 1.0

ggtctgttcggtttcagttgtttttgggtttcgggtaatttccaaat	CRISPR spacer
ggtctgttcggtttcagttgtttttgggtttcgggtaatttccaaat	Protospacer
***********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_JWNH01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_JWNH01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_JWNH01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000009_1 29677-29831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_JWNH01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_JWNH01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000003_1 26842-26943 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102406 : 111617 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_JWNH01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000004_1 58098-58220 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24774 : 37819 13 Pseudomonas_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JWNH01000004.1|WP_042743676.1|23771_24122_+|anti-CRISPR-protein-AcrIIC3 23771_24122_+ 116 aa aa AcrIIC3 NA NZ_JWNH01000004.1_24531_24741_+ No NA
NZ_JWNH01000004.1|WP_101171527.1|24167_24539_+|anti-CRISPR-protein-AcrIIC2 24167_24539_+ 123 aa aa NA NA NZ_JWNH01000004.1_24531_24741_+ No NA
17. NZ_JWNH01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6364 : 29095 26 Haemophilus_phage(45.0%) head,capsid,terminase,plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_JWNH01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000007_1 20293-20371 Orphan NA
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000007_2 29890-30097 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JWNH01000007_2 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder 29926-29952 27 MN850587 Escherichia phage mistaenkt, complete genome 12272-12298 2 0.926
NZ_JWNH01000007_2 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder 29926-29952 27 MN850587 Escherichia phage mistaenkt, complete genome 12263-12289 3 0.889
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 748041-748069 4 0.862
NZ_JWNH01000007_2 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder 29926-29952 27 MN693680 Marine virus AFVG_250M653, complete genome 16786-16812 4 0.852
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 85917-85945 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 107806-107834 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 456119-456147 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 473742-473770 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 84056-84084 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 101875-101903 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 306836-306864 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 58018-58046 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 365563-365591 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 624557-624585 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 861517-861545 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1741801-1741829 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1328784-1328812 5 0.828
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 339480-339508 5 0.828
NZ_JWNH01000007_2 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder 29926-29952 27 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 662992-663018 5 0.815
NZ_JWNH01000007_2 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder 29926-29952 27 NZ_CP047261 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence 290453-290479 5 0.815
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 161433-161461 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 468489-468517 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 624493-624521 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 347827-347855 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 428157-428185 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1011611-1011639 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP019045 Halioglobus pacificus strain RR3-57 plasmid pRR3-57, complete sequence 140523-140551 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_LR134417 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 8 104885-104913 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1009433-1009461 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 833488-833516 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 781058-781086 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1512874-1512902 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1512818-1512846 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 357881-357909 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1000427-1000455 6 0.793
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 747977-748005 7 0.759
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 352492-352520 7 0.759
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 715171-715199 7 0.759
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NC_016108 Methylomicrobium alcaliphilum 20Z plasmid MEALZ_p, complete sequence 1776-1804 7 0.759
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 13254-13282 8 0.724
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1624687-1624715 8 0.724
NZ_JWNH01000007_1 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder 20318-20346 29 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 171172-171200 8 0.724

1. spacer 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder matches to MN850587 (Escherichia phage mistaenkt, complete genome) position: , mismatch: 2, identity: 0.926

ggcaactttggcaactttggcaacttt	CRISPR spacer
ggcaactttggcaactttggcaactgg	Protospacer
*************************  

2. spacer 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder matches to MN850587 (Escherichia phage mistaenkt, complete genome) position: , mismatch: 3, identity: 0.889

ggcaactttggcaactttggcaacttt	CRISPR spacer
aacagctttggcaactttggcaacttt	Protospacer
..**.**********************

3. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.862

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgcaggcgggaatc	Protospacer
  *******************.****** 

4. spacer 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder matches to MN693680 (Marine virus AFVG_250M653, complete genome) position: , mismatch: 4, identity: 0.852

ggcaactttggcaactttggcaacttt	CRISPR spacer
ggcaactttggcaacatgggcaacgtc	Protospacer
*************** * ****** *.

5. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

6. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

7. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
tggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

8. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

9. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

10. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

11. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
aagccgtcattcccgcgaaggcgggaatc	Protospacer
. *************** ***.****** 

12. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

13. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

14. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

15. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggaatc	Protospacer
  *************** ***.****** 

16. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
gcgccgtcattcccgcgaaggcggcattc	Protospacer
***************** ***.** * * 

17. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cctccgtcattcccgcgaaggcgggaatc	Protospacer
 * ************** ***.****** 

18. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
tccccgtcattcccgcgaaggcgggaatc	Protospacer
 * ************** ***.****** 

19. spacer 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaactttggcaactttggcaacttt	CRISPR spacer
ggcaacgttggcaacgttggcaacgcc	Protospacer
****** ******** ******** ..

20. spacer 2.1|29926|27|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 5, identity: 0.815

ggcaactttggcaactttggcaacttt	CRISPR spacer
atcacctttggcaaccttggcaactat	Protospacer
. ** **********.********* *

21. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cgaccgtcattcccgcgaaggcgggaatc	Protospacer
  .************** ***.****** 

22. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
aacccgtcattcccgcgaaggcgggaatc	Protospacer
.  ************** ***.****** 

23. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cgcccgtcattcccgcgaaggcgggaatc	Protospacer
   ************** ***.****** 

24. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcattcccgcgaaggcgggactc	Protospacer
  *************** ***.**** * 

25. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
gacccgtcattcccgcgaaggcgggaacc	Protospacer
*  ************** ***.*****. 

26. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
tcgttgtcattcccgcgcaggcgggaacc	Protospacer
 **..****************.*****. 

27. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP019045 (Halioglobus pacificus strain RR3-57 plasmid pRR3-57, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ttcccgtcattcccgcgaaggcgggaatc	Protospacer
 . ************** ***.****** 

28. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_LR134417 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 8) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
aatctgtcattcccgcgtaggtgggaatg	Protospacer
.  *.************.**********.

29. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ccgccggccttcccgcgcaggtggcgatc	Protospacer
 ***** * *************** .** 

30. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ccgccggccttcccgcgcaggtggcgatc	Protospacer
 ***** * *************** .** 

31. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cccccgtcattcccgcgaaggcgggactc	Protospacer
 * ************** ***.**** * 

32. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ccgccggccttcccgcgcaggtggcgatc	Protospacer
 ***** * *************** .** 

33. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ccgccggccttcccgcgcaggtggcgatc	Protospacer
 ***** * *************** .** 

34. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
gggatgacattcccgcgcaggcgggaatc	Protospacer
* * .* **************.****** 

35. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ccgccggccttcccgcgcaggtggcgatc	Protospacer
 ***** * *************** .** 

36. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.759

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtcatccccgcgcaggcggggaac	Protospacer
  ********.**********.***.*  

37. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.759

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
atcccgtcattcccgcgaaggcgggaacc	Protospacer
.. ************** ***.*****. 

38. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.759

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ttcccgtcattcccgcgaaggcgggaacc	Protospacer
 . ************** ***.*****. 

39. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NC_016108 (Methylomicrobium alcaliphilum 20Z plasmid MEALZ_p, complete sequence) position: , mismatch: 7, identity: 0.759

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
agatcgtcatccccgcgcaggcgggaatc	Protospacer
. ..******.**********.****** 

40. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.724

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
aactagtcatccccgcgcaggcgggaatc	Protospacer
.  . *****.**********.****** 

41. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.724

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
ttatcgtcattcccgcgaaggcgggaacc	Protospacer
 ...************* ***.*****. 

42. spacer 1.1|20318|29|NZ_JWNH01000007|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.724

gcgccgtcattcccgcgcaggtgggaata	CRISPR spacer
cggccgtctttcccgcgcaggtgtatcca	Protospacer
  ****** ************** .  .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_JWNH01000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1101 : 7319 11 Burkholderia_virus(33.33%) integrase attL 607:619|attR 13162:13174
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_JWNH01000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JWNH01000028_1 20768-20851 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000001.1 85027-85052 0 1.0
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000001.1 85474-85499 0 1.0
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000001.1 86013-86038 0 1.0
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000017.1 38218-38243 0 1.0
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000027.1 25517-25542 1 0.962
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000030.1 59-84 1 0.962
NZ_JWNH01000028_1 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder 20797-20822 26 NZ_JWNH01000045.1 379-404 0 1.0

1. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 85027-85052, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

2. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 85474-85499, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

3. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 86013-86038, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

4. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 38218-38243, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

5. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 25517-25542, mismatch: 1, identity: 0.962

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgcaggttttcttaaccctgcgtc	Protospacer
****.*********************

6. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 59-84, mismatch: 1, identity: 0.962

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgcaggttttcttaaccctgcgtc	Protospacer
****.*********************

7. spacer 1.1|20797|26|NZ_JWNH01000028|CRISPRCasFinder matches to position: 379-404, mismatch: 0, identity: 1.0

gatgtaggttttcttaaccctgcgtc	CRISPR spacer
gatgtaggttttcttaaccctgcgtc	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage