Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_RXTB01000108 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000017 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000061 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000307 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000305 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000210 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00210, whole genome shotgun sequence 1 crisprs NA 1 3 0 0
NZ_RXTB01000007 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000164 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00164, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_RXTB01000289 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00289, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000038 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000044 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000255 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00255, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000119 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000129 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000003 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000070 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00070, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_RXTB01000182 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000272 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000034 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00034, whole genome shotgun sequence 1 crisprs NA 0 1 1 0
NZ_RXTB01000022 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000060 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000286 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000159 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000251 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00251, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000181 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000109 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000011 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000280 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000051 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000056 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000100 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000248 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000063 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000168 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000002 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000270 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000271 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000196 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00196, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_RXTB01000080 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000069 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000245 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00245, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000092 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000185 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000234 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000171 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000138 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000278 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000031 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000309 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000208 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00208, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000068 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000116 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000180 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000045 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000076 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000179 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000263 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00263, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000220 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000079 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000036 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000281 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000304 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000021 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000149 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00149, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_RXTB01000225 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000266 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000136 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000144 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000146 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000283 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000265 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00265, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000170 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000187 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000158 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00158, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_RXTB01000073 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000238 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000037 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000285 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000226 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000115 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000273 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00273, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000098 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000315 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000072 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000247 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00247, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000110 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00110, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_RXTB01000064 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00064, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000207 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00207, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000065 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00065, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_RXTB01000233 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000302 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000215 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000142 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000306 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000085 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000035 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000024 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000071 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000294 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000046 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000087 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000191 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000025 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00025, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_RXTB01000214 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000101 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000178 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000107 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000228 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000204 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000057 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000184 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000175 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000308 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000102 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000211 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00211, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000176 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000221 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000258 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000097 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000026 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000033 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00033, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000190 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000009 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000218 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000296 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000039 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000106 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000103 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000043 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00043, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000010 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000311 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00311, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000165 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000203 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000117 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000040 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00040, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_RXTB01000145 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000231 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000094 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000032 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000054 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000114 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000291 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00291, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000313 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000001 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00001, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000276 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000140 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000259 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00259, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000284 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000157 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000161 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00161, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_RXTB01000084 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000261 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00261, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000135 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000055 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000223 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000096 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000015 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00015, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_RXTB01000050 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00050, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_RXTB01000023 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000012 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000269 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000194 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000198 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000172 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000235 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000217 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00217, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000250 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000121 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000083 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000193 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000089 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000125 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00125, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_RXTB01000177 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00177, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_RXTB01000293 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00293, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000126 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000078 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000314 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000152 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00152, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_RXTB01000299 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000197 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000147 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000155 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000295 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00295, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000153 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000292 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000134 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000227 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000016 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000020 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000081 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000173 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000018 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000077 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00077, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000053 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000163 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000213 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00213, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000122 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000104 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000242 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000006 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000111 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000090 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000008 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000237 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000013 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000243 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00243, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000086 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00086, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000310 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000222 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000219 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000041 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000186 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000052 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000067 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000246 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000277 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000130 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000274 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000139 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000091 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000062 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000224 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000229 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000112 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000200 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000128 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000154 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000300 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000279 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000275 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00275, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000209 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000298 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000030 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000301 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000236 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000005 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000166 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000141 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000074 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000148 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00148, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_RXTB01000230 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000118 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000188 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000268 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000312 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000260 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000249 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00249, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000082 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000047 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000120 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000160 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000156 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000252 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000212 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000099 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000297 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00297, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000048 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000257 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000123 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00123, whole genome shotgun sequence 0 crisprs RT,csa3 0 0 1 0
NZ_RXTB01000143 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000201 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000095 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000105 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000267 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000075 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000167 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000239 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00239, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000253 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000151 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000232 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000059 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000029 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000288 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000205 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000132 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000004 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000088 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000093 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00093, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_RXTB01000133 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000027 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000189 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000192 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000150 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00150, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_RXTB01000199 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00199, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_RXTB01000290 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000028 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000066 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00066, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_RXTB01000113 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000206 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000169 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000127 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000256 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000014 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00014, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_RXTB01000124 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00124, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_RXTB01000254 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000244 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000058 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000019 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000262 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000241 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00241, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000042 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000183 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000264 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000240 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000287 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00287, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000137 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000174 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000216 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000131 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000303 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00303, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000162 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000195 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000202 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000282 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_RXTB01000049 Pseudomonas aeruginosa strain MRSN8914 MRSN8914_contig00049, whole genome shotgun sequence 0 crisprs DEDDh,DinG 0 0 0 0

Results visualization

1. NZ_RXTB01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 154121 : 160307 9 Powai_lake_megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_RXTB01000124
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 190 : 16954 21 Pseudomonas_phage(90.48%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_RXTB01000171
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_RXTB01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15934 : 23841 11 Pseudomonas_phage(100.0%) capsid,integrase attL 13901:13927|attR 23869:23895
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_RXTB01000123
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102 : 36800 44 uncultured_Caudovirales_phage(25.0%) plate,tail,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_RXTB01000211
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3875 : 6940 8 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_RXTB01000210
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_RXTB01000210_1 343-611 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_RXTB01000210_1 1.4|551|33|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 551-583 33 NZ_RXTB01000171.1 5363-5395 2 0.939

1. spacer 1.4|551|33|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to position: 5363-5395, mismatch: 2, identity: 0.939

agacaagaaaaaccggtcgatgcgggttgtgat	CRISPR spacer
agacaagaaaaaccgctcgatgcgcgttgtgat	Protospacer
*************** ******** ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK034952 Pseudomonas phage Dobby, complete genome 32388-32419 0 1.0
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511042 Pseudomonas phage CF126, partial genome 9365-9396 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511040 Pseudomonas phage CF63, partial genome 55856-55887 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511051 Pseudomonas phage BR181, partial genome 54933-54964 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 KC900378 Pseudomonas phage LKA5, complete genome 7930-7961 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NC_003278 Pseudomonas phage phiCTX, complete genome 31683-31714 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511041 Pseudomonas phage CF69, partial genome 9393-9424 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511049 Pseudomonas phage BR326, partial genome 54933-54964 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511045 Pseudomonas phage BR208, partial genome 54933-54964 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511044 Pseudomonas phage BR197, partial genome 9393-9424 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511050 Pseudomonas phage BR150, partial genome 9321-9352 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511048 Pseudomonas phage BR320, partial genome 9321-9352 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 KM389401 UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00001 genomic sequence 4844-4875 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511046 Pseudomonas phage BR313, partial genome 54933-54964 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 Y13918 Pseudomonas aeruginosa phage phi CTX DNA, complete genome 31683-31714 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 AB008550 Pseudomonas phage phiCTX DNA, complete genome 31683-31714 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NC_042342 Pseudomonas virus H66, complete genome 8813-8844 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511047 Pseudomonas phage BR319, partial genome 9497-9528 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511043 Pseudomonas phage BR228, partial genome 5442-5473 1 0.969
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 MK511039 Pseudomonas phage CF24, partial genome 9393-9424 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 MK511036 Pseudomonas phage BR327, partial genome 17529-17560 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 JQ762257 Pseudomonas phage MP42, complete genome 17491-17522 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 KM389243 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence 7555-7586 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 MK511018 Pseudomonas phage CF28, partial genome 17561-17592 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 17102-17133 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 17534-17565 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NC_030918 Pseudomonas phage JBD93, complete genome 16691-16722 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 EU272037 Pseudomonas phage MP38, complete genome 17707-17738 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 JX434032 Pseudomonas phage JBD30, complete genome 17530-17561 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 KU199708 Pseudomonas phage JBD69, complete genome 17513-17544 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 DQ631426 Pseudomonas phage DMS3, complete genome 17086-17117 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 JX434031 Pseudomonas phage JBD24, complete genome 17379-17410 1 0.969
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NC_009818 Pseudomonas phage MP22, complete genome 16164-16195 2 0.938
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 JX434033 Pseudomonas phage JBD88a, complete genome 16153-16184 2 0.938
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 KU199707 Pseudomonas phage JBD16C, partial genome 16130-16161 2 0.938
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 17074-17105 2 0.938
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 DQ873690 Phage MP22, complete genome 16164-16195 2 0.938
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 MG707188 Pseudomonas phage TC7, partial genome 14616-14647 3 0.906
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NC_031091 Pseudomonas phage MD8, complete genome 29222-29253 4 0.875
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NC_030931 Pseudomonas phage phi2, complete genome 5548-5579 4 0.875
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 309134-309165 7 0.781
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1498691-1498722 8 0.75
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 53473-53504 9 0.719
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 431527-431558 9 0.719
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 MT889371 Microbacterium phage DelaGarza, complete genome 20639-20670 9 0.719
NZ_RXTB01000210_1 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 371-402 32 NZ_KF418775 Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence 101470-101501 10 0.688
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 79780-79811 10 0.688
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 78090-78121 10 0.688
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 367786-367817 10 0.688
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1123676-1123707 11 0.656
NZ_RXTB01000210_1 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 431-462 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1339050-1339081 11 0.656
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NC_018583 Gordonia sp. KTR9 plasmid pGKT3, complete sequence 37659-37690 11 0.656
NZ_RXTB01000210_1 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT 491-522 32 NZ_CP047236 Gordonia sp. JH63 plasmid pJH63-1, complete sequence 120365-120396 11 0.656

1. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK034952 (Pseudomonas phage Dobby, complete genome) position: , mismatch: 0, identity: 1.0

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcggccgcgggtcggcaacgtcga	Protospacer
********************************

2. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511042 (Pseudomonas phage CF126, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

3. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511040 (Pseudomonas phage CF63, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

4. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511051 (Pseudomonas phage BR181, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

5. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

6. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_003278 (Pseudomonas phage phiCTX, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

7. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511041 (Pseudomonas phage CF69, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

8. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511049 (Pseudomonas phage BR326, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

9. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511045 (Pseudomonas phage BR208, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

10. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511044 (Pseudomonas phage BR197, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

11. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511050 (Pseudomonas phage BR150, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

12. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511048 (Pseudomonas phage BR320, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

13. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to KM389401 (UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

14. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511046 (Pseudomonas phage BR313, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

15. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to Y13918 (Pseudomonas aeruginosa phage phi CTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

16. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to AB008550 (Pseudomonas phage phiCTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

17. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

18. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511047 (Pseudomonas phage BR319, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

19. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511043 (Pseudomonas phage BR228, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

20. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511039 (Pseudomonas phage CF24, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

21. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

22. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

23. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to KM389243 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

24. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

25. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

26. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

27. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

28. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

29. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

30. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

31. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

32. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

33. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

34. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

35. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

36. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

37. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

38. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 3, identity: 0.906

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcagatcgcggtgctcaccgacgtctctactg	Protospacer
*********.*.******************.*

39. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 4, identity: 0.875

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aaagatcgccgcactcaccgacgtctctaccg	Protospacer
. ******* **.*******************

40. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 4, identity: 0.875

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
acggatcgccgccctcaccgacgtctctaccg	Protospacer
.*.****** ** *******************

41. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 7, identity: 0.781

--aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
ttgacc--gcccggccgctggtcggcaacgtcac	Protospacer
  .***  ** ******* *************. 

42. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcatatcgcagcgctcaccgtcgcatgcctcg	Protospacer
*** **************** **. * . .**

43. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaggcggcgcggcggcgggtcggccacggcct	Protospacer
.*   ******** ********** *** *  

44. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaagatggtcggcggcaggtcggcaacgtcga	Protospacer
.*  . *  **** **.***************

45. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 9, identity: 0.719

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcagatcgccacgctcaccgacgacctcgtgg	Protospacer
********* .************ *..... *

46. spacer 1.1|371|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 10, identity: 0.688

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaccgggcgcggccgcgcgccggcctggattg	Protospacer
.**************** *.****   * . .

47. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 10, identity: 0.688

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
ccagatcgccacgctcaccgacgtgagctggg	Protospacer
 ******** .*************   .   *

48. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.688

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
ccagatcgccacgctcaccgacgtgagctggg	Protospacer
 ******** .*************   .   *

49. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
ggcgatgcgtgcgggatcgtcgccatgacggg	Protospacer
..* ..  **** *********** ******.

50. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 11, identity: 0.656

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aactgtcgcagcgatcaccgacgcctctcaac	Protospacer
.   .******** *********.****    

51. spacer 1.2|431|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 11, identity: 0.656

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aactgtcgcagcgatcaccgacgcctctcaac	Protospacer
.   .******** *********.****    

52. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 11, identity: 0.656

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
tgggcgtagtgcaggatcgtcgcctggacggc	Protospacer
 .    ..**** ************ ***** 

53. spacer 1.3|491|32|NZ_RXTB01000210|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047236 (Gordonia sp. JH63 plasmid pJH63-1, complete sequence) position: , mismatch: 11, identity: 0.656

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
tgggcgtagtgcaggatcgtcgcctggacggc	Protospacer
 .    ..**** ************ ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_RXTB01000034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_RXTB01000034_1 41633-41740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510989 Pseudomonas phage BR322, partial genome 31234-31293 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510966 Pseudomonas phage CF53, partial genome 31235-31294 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 KY707339 Pseudomonas phage JBD68, complete genome 33757-33816 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510981 Pseudomonas phage BR143, partial genome 31255-31314 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510967 Pseudomonas phage CF54, partial genome 4952-5011 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510991 Pseudomonas phage BR141, partial genome 31216-31275 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510980 Pseudomonas phage BR123, partial genome 31234-31293 0 1.0
NZ_RXTB01000034_1 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder 41657-41716 60 MK510983 Pseudomonas phage BR178, partial genome 31235-31294 0 1.0

1. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510989 (Pseudomonas phage BR322, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

2. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510966 (Pseudomonas phage CF53, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

3. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to KY707339 (Pseudomonas phage JBD68, complete genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

4. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510981 (Pseudomonas phage BR143, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

5. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510967 (Pseudomonas phage CF54, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

6. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510991 (Pseudomonas phage BR141, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

7. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510980 (Pseudomonas phage BR123, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

8. spacer 1.1|41657|60|NZ_RXTB01000034|CRISPRCasFinder matches to MK510983 (Pseudomonas phage BR178, partial genome) position: , mismatch: 0, identity: 1.0

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26927 : 49479 34 Pseudomonas_phage(80.77%) portal,holin,head,protease,terminase,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_RXTB01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 83723 : 90617 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_RXTB01000125
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 528 : 28483 29 Pseudomonas_phage(79.31%) terminase NA
DBSCAN-SWA_2 42508 : 45928 6 Pseudomonas_phage(100.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_RXTB01000077
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 911 : 18236 25 Pseudomonas_phage(100.0%) integrase,transposase attL 3410:3423|attR 17203:17216
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_RXTB01000177
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_RXTB01000177_1 4477-4567 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 210486-210526 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 261779-261819 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 209984-210024 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 26557-26597 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 26715-26755 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 78857-78897 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 43163-43203 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 352188-352228 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 29964-30004 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 46635-46675 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 28143-28183 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 28143-28183 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 27909-27949 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 29318-29358 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 253489-253529 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 104456-104496 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 312300-312340 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 204335-204375 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 330177-330217 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 276757-276797 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 29340-29380 0 1.0
NZ_RXTB01000177_1 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder 4502-4542 41 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 26763-26803 1 0.976

1. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

2. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

3. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

4. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

5. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

6. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

7. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

8. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

9. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

10. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

11. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

12. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

13. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

14. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

15. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

16. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

17. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

18. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

19. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

20. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

21. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

22. spacer 1.1|4502|41|NZ_RXTB01000177|CRISPRCasFinder matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 1, identity: 0.976

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgaccttcctgcggagcatccg	Protospacer
***********************.*****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_RXTB01000149
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 494 : 24020 30 Pseudomonas_virus(78.57%) plate,tail,holin NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_RXTB01000149.1|WP_033936089.1|9292_9751_-|hypothetical-protein 9292_9751_- 152 aa aa AcrIF11 NA NZ_RXTB01000149.1_9068_9296_- 494-24020 NA
14. NZ_RXTB01000064
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 35093 51 Pseudomonas_phage(68.18%) terminase,head,holin,protease,portal,capsid,lysis,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_RXTB01000207
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87 : 8875 10 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_RXTB01000086
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12445 : 50910 33 Planktothrix_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_RXTB01000148
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 52535 : 60161 9 uncultured_Caudovirales_phage(33.33%) integrase attL 52791:52803|attR 59442:59454
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_RXTB01000134
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 909 : 19021 27 Pseudomonas_phage(100.0%) transposase,head,integrase attL 2627:2642|attR 18688:18703
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_RXTB01000208
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7206 10 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage