Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_QXKA01000008 Listeria monocytogenes strain PNUSAL000361 DYZ36_8, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QXKA01000013 Listeria monocytogenes strain PNUSAL000361 DYZ36_13, whole genome shotgun sequence 1 crisprs cas5 0 0 0 1
NZ_QXKA01000006 Listeria monocytogenes strain PNUSAL000361 DYZ36_6, whole genome shotgun sequence 0 crisprs WYL,casR 0 0 0 0
NZ_QXKA01000019 Listeria monocytogenes strain PNUSAL000361 DYZ36_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000015 Listeria monocytogenes strain PNUSAL000361 DYZ36_15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000018 Listeria monocytogenes strain PNUSAL000361 DYZ36_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000007 Listeria monocytogenes strain PNUSAL000361 DYZ36_7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000001 Listeria monocytogenes strain PNUSAL000361 DYZ36_1, whole genome shotgun sequence 1 crisprs NA 3 5 1 0
NZ_QXKA01000002 Listeria monocytogenes strain PNUSAL000361 DYZ36_2, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 1 2
NZ_QXKA01000023 Listeria monocytogenes strain PNUSAL000361 DYZ36_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000021 Listeria monocytogenes strain PNUSAL000361 DYZ36_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000026 Listeria monocytogenes strain PNUSAL000361 DYZ36_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000009 Listeria monocytogenes strain PNUSAL000361 DYZ36_9, whole genome shotgun sequence 0 crisprs cas3,DinG 0 0 0 0
NZ_QXKA01000005 Listeria monocytogenes strain PNUSAL000361 DYZ36_5, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 1 0
NZ_QXKA01000012 Listeria monocytogenes strain PNUSAL000361 DYZ36_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000022 Listeria monocytogenes strain PNUSAL000361 DYZ36_22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000025 Listeria monocytogenes strain PNUSAL000361 DYZ36_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000003 Listeria monocytogenes strain PNUSAL000361 DYZ36_3, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_QXKA01000004 Listeria monocytogenes strain PNUSAL000361 DYZ36_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000020 Listeria monocytogenes strain PNUSAL000361 DYZ36_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000014 Listeria monocytogenes strain PNUSAL000361 DYZ36_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000016 Listeria monocytogenes strain PNUSAL000361 DYZ36_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000010 Listeria monocytogenes strain PNUSAL000361 DYZ36_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000017 Listeria monocytogenes strain PNUSAL000361 DYZ36_17, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_QXKA01000011 Listeria monocytogenes strain PNUSAL000361 DYZ36_11, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QXKA01000027 Listeria monocytogenes strain PNUSAL000361 DYZ36_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QXKA01000024 Listeria monocytogenes strain PNUSAL000361 DYZ36_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_QXKA01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73203 : 81047 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_QXKA01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 90092 : 98378 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_QXKA01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QXKA01000013_1 195-305 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QXKA01000013.1|WP_061665674.1|38788_39397_+|hypothetical-protein 38788_39397_+ 202 aa aa AcrIIA16 NA NA No NA
4. NZ_QXKA01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87311 : 192898 119 Listeria_phage(67.61%) holin,tRNA,terminase,tail,capsid,portal,protease,integrase attL 112996:113014|attR 155205:155223
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QXKA01000002.1|WP_003726053.1|164034_164229_-|hypothetical-protein 164034_164229_- 64 aa aa NA WHTH_GntR NA 87311-192898 yes
NZ_QXKA01000002.1|WP_003723553.1|165474_165612_-|hypothetical-protein 165474_165612_- 45 aa aa NA WHTH_GntR NA 87311-192898 yes
5. NZ_QXKA01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QXKA01000017_1 3106-3284 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_QXKA01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QXKA01000001_1 592181-592862 Orphan I-A
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_QXKA01000001_1 1.6|592538|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592538-592575 38 NZ_QXKA01000011.1 42390-42427 0 1.0
NZ_QXKA01000001_1 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592736-592769 34 NZ_QXKA01000002.1 117693-117726 0 1.0
NZ_QXKA01000001_1 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592799-592833 35 NZ_QXKA01000002.1 140256-140290 1 0.971

1. spacer 1.6|592538|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to position: 42390-42427, mismatch: 0, identity: 1.0

gtcaatgaaggtgacttaaatataaaaggaacaccttg	CRISPR spacer
gtcaatgaaggtgacttaaatataaaaggaacaccttg	Protospacer
**************************************

2. spacer 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to position: 117693-117726, mismatch: 0, identity: 1.0

gaagctctgtgagtaaatatttacccgttgattt	CRISPR spacer
gaagctctgtgagtaaatatttacccgttgattt	Protospacer
**********************************

3. spacer 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to position: 140256-140290, mismatch: 1, identity: 0.971

cttgatgcagaggctattaaagtttttgcatccaa	CRISPR spacer
cttgatgcagaagctattaaagtttttgcatccaa	Protospacer
***********.***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 NC_003216 Listeria phage A118, complete genome 34139-34173 0 1.0
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 AJ242593 Bacteriophage A118 complete genome 34139-34173 0 1.0
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 MH341452 Listeria phage PSU-VKH-LP040, complete genome 32598-32632 0 1.0
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 DQ003642 Listeria phage A006, complete genome 31434-31468 0 1.0
NZ_QXKA01000001_1 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592736-592769 34 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 60292-60325 0 1.0
NZ_QXKA01000001_1 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592736-592769 34 KJ094023 Listeria phage LP-101, complete genome 27168-27201 0 1.0
NZ_QXKA01000001_1 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592799-592833 35 KJ094023 Listeria phage LP-101, complete genome 6873-6907 0 1.0
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 MH299806 Listeria phage LP-KV022, complete genome 93-128 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 JB137888 Sequence 7 from Patent WO2012159774 53552-53587 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 KJ094025 Listeria phage LP-032 contig 2, partial genome 42923-42958 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 MN114083 Listeria phage LP-013, complete genome 60238-60273 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 NC_021785 Listeria phage LP-110, complete genome 22939-22974 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 MN128593 Listeria phage LP-031, complete genome 60098-60133 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 NC_021787 Listeria phage LP-037, complete genome 16970-17005 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 MN904502 Listeria phage LP-018, complete genome 59862-59897 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 JX442241 Listeria phage P70, complete genome 93-128 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 KJ094020 Listeria phage LP-026, complete genome 44140-44175 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 KJ094021 Listeria phage LP-114, complete genome 50089-50124 1 0.972
NZ_QXKA01000001_1 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592473-592508 36 MN114082 Listeria phage LP-010, complete genome 59207-59242 1 0.972
NZ_QXKA01000001_1 1.8|592669|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592669-592706 38 MH341451 Listeria phage PSU-VKH-LP019, complete genome 10625-10662 1 0.974
NZ_QXKA01000001_1 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592799-592833 35 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 216400-216434 1 0.971
NZ_QXKA01000001_1 1.8|592669|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592669-592706 38 DQ003642 Listeria phage A006, complete genome 10641-10678 2 0.947
NZ_QXKA01000001_1 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592736-592769 34 NC_021539 Listeria phage LP-030-2, complete genome 23033-23066 2 0.941
NZ_QXKA01000001_1 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592736-592769 34 AJ312240 Bacteriophage PSA complete genome 22756-22789 2 0.941
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 KP399677 Listeria phage vB_LmoS_188, complete genome 31932-31966 4 0.886
NZ_QXKA01000001_1 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT 592605-592639 35 KP399678 Listeria phage vB_LmoS_293, complete genome 33169-33203 4 0.886

1. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagcagtttttctagttcaac	Protospacer
***********************************

2. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagcagtttttctagttcaac	Protospacer
***********************************

3. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagcagtttttctagttcaac	Protospacer
***********************************

4. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagcagtttttctagttcaac	Protospacer
***********************************

5. spacer 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 0, identity: 1.0

gaagctctgtgagtaaatatttacccgttgattt	CRISPR spacer
gaagctctgtgagtaaatatttacccgttgattt	Protospacer
**********************************

6. spacer 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

gaagctctgtgagtaaatatttacccgttgattt	CRISPR spacer
gaagctctgtgagtaaatatttacccgttgattt	Protospacer
**********************************

7. spacer 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

cttgatgcagaggctattaaagtttttgcatccaa	CRISPR spacer
cttgatgcagaggctattaaagtttttgcatccaa	Protospacer
***********************************

8. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

9. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctctcgcagcacgagaaacatta	Protospacer
*****************.******************

10. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctctcgcagcacgagaaacatta	Protospacer
*****************.******************

11. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

12. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

13. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

14. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctctcgcagcacgagaaacatta	Protospacer
*****************.******************

15. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctctcgcagcacgagaaacatta	Protospacer
*****************.******************

16. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

17. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctctcgcagcacgagaaacatta	Protospacer
*****************.******************

18. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

19. spacer 1.5|592473|36|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 1, identity: 0.972

gtatatccagactctcttgcagcacgagaaacatta	CRISPR spacer
gtatatccagactctcttgcagcacgagaaacgtta	Protospacer
********************************.***

20. spacer 1.8|592669|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 1, identity: 0.974

tgttactagttttccgccaatcatcagcacaggaccag	CRISPR spacer
tgatactagttttccgccaatcatcagcacaggaccag	Protospacer
** ***********************************

21. spacer 1.10|592799|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.971

cttgatgcagaggctattaaagtttttgcatccaa	CRISPR spacer
cttgatgcagaagctattaaagtttttgcatccaa	Protospacer
***********.***********************

22. spacer 1.8|592669|38|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 2, identity: 0.947

tgttactagttttccgccaatcatcagcacaggaccag	CRISPR spacer
tgatactagttttccgccaatcattagcacaggaccag	Protospacer
** *********************.*************

23. spacer 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 2, identity: 0.941

gaagctctgtgagtaaatatttacccgttgattt	CRISPR spacer
gaagctctgtgagtaagtatttgcccgttgattt	Protospacer
****************.*****.***********

24. spacer 1.9|592736|34|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 2, identity: 0.941

gaagctctgtgagtaaatatttacccgttgattt	CRISPR spacer
gaagctctgtgagtaagtatttgcccgttgattt	Protospacer
****************.*****.***********

25. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 4, identity: 0.886

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagtagtttttcgagttcgat	Protospacer
*****************.******** *****.*.

26. spacer 1.7|592605|35|NZ_QXKA01000001|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 4, identity: 0.886

tcatctacccaagcaagcagtttttctagttcaac	CRISPR spacer
tcatctacccaagcaagtagtttttcgagttcgat	Protospacer
*****************.******** *****.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4433 : 11855 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_QXKA01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14804 : 25531 17 Listeria_phage(40.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage