Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_QZDI01000029 Pectobacterium carotovorum strain S4.16.03.1C contig_29, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_QZDI01000055 Pectobacterium carotovorum strain S4.16.03.1C contig_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000005 Pectobacterium carotovorum strain S4.16.03.1C contig_5, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QZDI01000006 Pectobacterium carotovorum strain S4.16.03.1C contig_6, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000008 Pectobacterium carotovorum strain S4.16.03.1C contig_8, whole genome shotgun sequence 0 crisprs csa3,cas3 0 0 0 0
NZ_QZDI01000056 Pectobacterium carotovorum strain S4.16.03.1C contig_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000009 Pectobacterium carotovorum strain S4.16.03.1C contig_9, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_QZDI01000004 Pectobacterium carotovorum strain S4.16.03.1C contig_4, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QZDI01000035 Pectobacterium carotovorum strain S4.16.03.1C contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000040 Pectobacterium carotovorum strain S4.16.03.1C contig_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000048 Pectobacterium carotovorum strain S4.16.03.1C contig_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000025 Pectobacterium carotovorum strain S4.16.03.1C contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000054 Pectobacterium carotovorum strain S4.16.03.1C contig_54, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_QZDI01000014 Pectobacterium carotovorum strain S4.16.03.1C contig_14, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QZDI01000016 Pectobacterium carotovorum strain S4.16.03.1C contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000068 Pectobacterium carotovorum strain S4.16.03.1C contig_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000053 Pectobacterium carotovorum strain S4.16.03.1C contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000058 Pectobacterium carotovorum strain S4.16.03.1C contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000042 Pectobacterium carotovorum strain S4.16.03.1C contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000003 Pectobacterium carotovorum strain S4.16.03.1C contig_3, whole genome shotgun sequence 1 crisprs NA 0 0 1 4
NZ_QZDI01000027 Pectobacterium carotovorum strain S4.16.03.1C contig_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000057 Pectobacterium carotovorum strain S4.16.03.1C contig_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000045 Pectobacterium carotovorum strain S4.16.03.1C contig_45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000072 Pectobacterium carotovorum strain S4.16.03.1C contig_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000036 Pectobacterium carotovorum strain S4.16.03.1C contig_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000063 Pectobacterium carotovorum strain S4.16.03.1C contig_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000007 Pectobacterium carotovorum strain S4.16.03.1C contig_7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000023 Pectobacterium carotovorum strain S4.16.03.1C contig_23, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QZDI01000033 Pectobacterium carotovorum strain S4.16.03.1C contig_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000047 Pectobacterium carotovorum strain S4.16.03.1C contig_47, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QZDI01000015 Pectobacterium carotovorum strain S4.16.03.1C contig_15, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_QZDI01000021 Pectobacterium carotovorum strain S4.16.03.1C contig_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000011 Pectobacterium carotovorum strain S4.16.03.1C contig_11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000038 Pectobacterium carotovorum strain S4.16.03.1C contig_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000010 Pectobacterium carotovorum strain S4.16.03.1C contig_10, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QZDI01000064 Pectobacterium carotovorum strain S4.16.03.1C contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000012 Pectobacterium carotovorum strain S4.16.03.1C contig_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000013 Pectobacterium carotovorum strain S4.16.03.1C contig_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000028 Pectobacterium carotovorum strain S4.16.03.1C contig_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000030 Pectobacterium carotovorum strain S4.16.03.1C contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000061 Pectobacterium carotovorum strain S4.16.03.1C contig_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000074 Pectobacterium carotovorum strain S4.16.03.1C contig_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000020 Pectobacterium carotovorum strain S4.16.03.1C contig_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000062 Pectobacterium carotovorum strain S4.16.03.1C contig_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000066 Pectobacterium carotovorum strain S4.16.03.1C contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000065 Pectobacterium carotovorum strain S4.16.03.1C contig_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000022 Pectobacterium carotovorum strain S4.16.03.1C contig_22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000059 Pectobacterium carotovorum strain S4.16.03.1C contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000032 Pectobacterium carotovorum strain S4.16.03.1C contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000001 Pectobacterium carotovorum strain S4.16.03.1C contig_1, whole genome shotgun sequence 1 crisprs DEDDh 0 0 1 0
NZ_QZDI01000043 Pectobacterium carotovorum strain S4.16.03.1C contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000024 Pectobacterium carotovorum strain S4.16.03.1C contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000051 Pectobacterium carotovorum strain S4.16.03.1C contig_51, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_QZDI01000002 Pectobacterium carotovorum strain S4.16.03.1C contig_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000046 Pectobacterium carotovorum strain S4.16.03.1C contig_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000069 Pectobacterium carotovorum strain S4.16.03.1C contig_69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000026 Pectobacterium carotovorum strain S4.16.03.1C contig_26, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_QZDI01000039 Pectobacterium carotovorum strain S4.16.03.1C contig_39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000034 Pectobacterium carotovorum strain S4.16.03.1C contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000052 Pectobacterium carotovorum strain S4.16.03.1C contig_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000031 Pectobacterium carotovorum strain S4.16.03.1C contig_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000037 Pectobacterium carotovorum strain S4.16.03.1C contig_37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000018 Pectobacterium carotovorum strain S4.16.03.1C contig_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000060 Pectobacterium carotovorum strain S4.16.03.1C contig_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000041 Pectobacterium carotovorum strain S4.16.03.1C contig_41, whole genome shotgun sequence 3 crisprs cas6f,cas7f,cas5f,cas8f,cas3f,cas1 0 17 0 0
NZ_QZDI01000067 Pectobacterium carotovorum strain S4.16.03.1C contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000044 Pectobacterium carotovorum strain S4.16.03.1C contig_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000071 Pectobacterium carotovorum strain S4.16.03.1C contig_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000017 Pectobacterium carotovorum strain S4.16.03.1C contig_17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000070 Pectobacterium carotovorum strain S4.16.03.1C contig_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000073 Pectobacterium carotovorum strain S4.16.03.1C contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000050 Pectobacterium carotovorum strain S4.16.03.1C contig_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000019 Pectobacterium carotovorum strain S4.16.03.1C contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QZDI01000049 Pectobacterium carotovorum strain S4.16.03.1C contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_QZDI01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000003_1 93015-93117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 126484 : 175591 64 Pectobacterium_phage(65.38%) head,plate,integrase,terminase,holin,tail attL 126359:126384|attR 174696:174721
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QZDI01000003.1|WP_119870653.1|147484_147844_-|hypothetical-protein 147484_147844_- 119 aa aa AcrIF17.1 NA NZ_QZDI01000003.1_147055_147262_- 126484-175591 NA
NZ_QZDI01000003.1|WP_119870654.1|147859_148141_-|hypothetical-protein 147859_148141_- 93 aa aa AcrIF19 NA NZ_QZDI01000003.1_147055_147262_- 126484-175591 NA
NZ_QZDI01000003.1|WP_119870655.1|148148_148514_-|hypothetical-protein 148148_148514_- 121 aa aa AcrIF20.1 NA NA 126484-175591 NA
NZ_QZDI01000003.1|WP_119870652.1|147248_147476_-|hypothetical-protein 147248_147476_- 75 aa aa NA NA NZ_QZDI01000003.1_147055_147262_- 126484-175591 NA
2. NZ_QZDI01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62361 : 69734 9 Mycoplasma_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_QZDI01000041
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000041_1 5297-5924 TypeI-F I-F:NA
10 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000041_2 14871-15920 TypeI-F I-F
17 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000041_3 22264-22772 TypeI-F I-F
8 spacers
cas1,cas3f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP035512 Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence 229085-229116 6 0.812
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 272886-272917 6 0.812
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 3334-3365 7 0.781
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 215953-215984 7 0.781
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 254584-254615 7 0.781
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 300901-300932 7 0.781
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 380579-380610 7 0.781
NZ_QZDI01000041_3 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22593-22624 32 MT011984 Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence 77174-77205 7 0.781
NZ_QZDI01000041_1 1.15|5617|30|NZ_QZDI01000041|CRT 5617-5646 30 NZ_CP013139 Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence 215919-215948 8 0.733
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 NZ_CP049914 Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence 129010-129041 8 0.75
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 MT104465 Pseudomonas phage MR1, complete genome 31831-31862 8 0.75
NZ_QZDI01000041_2 2.8|15319|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15319-15350 32 NZ_CP042265 Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence 43817-43848 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 13235-13266 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 2268-2299 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 20374-20405 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 12624-12655 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 16926-16957 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NC_049342 Escherichia phage 500465-1, complete genome 17590-17621 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 23100-23131 8 0.75
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 CP025900 Escherichia phage sp., complete genome 17590-17621 8 0.75
NZ_QZDI01000041_3 3.8|22713|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22713-22744 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 651004-651035 8 0.75
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 MK937601 Gordonia phage Charming, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 MH976519 Gordonia phage Tangent, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 MH976510 Gordonia phage Fosterous, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 MH479924 Gordonia phage Rofo, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 MH976514 Gordonia phage Nordenberg, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder 5325-5356 32 NC_031239 Gordonia phage Vivi2, complete genome 1379-1410 9 0.719
NZ_QZDI01000041_1 1.8|5745|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR 5745-5776 32 NZ_CP047096 Bacillus marisflavi strain 151-25 plasmid p25, complete sequence 20202-20233 9 0.719
NZ_QZDI01000041_2 2.1|14899|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 14899-14930 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 264774-264805 9 0.719
NZ_QZDI01000041_2 2.1|14899|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 14899-14930 32 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 264591-264622 9 0.719
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 KU064779 Pseudomonas phage PPPL-1, complete genome 33988-34019 9 0.719
NZ_QZDI01000041_2 2.11|15499|33|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15499-15531 33 MH717709 Escherichia phage LL2, complete genome 11181-11213 9 0.727
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP049911 Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence 240045-240076 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP020927 Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence 23596-23627 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 151059-151090 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 25803-25834 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP053227 Sphingobium sp. RSMS plasmid pRSMS4 8278-8309 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 209206-209237 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 241613-241644 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 21204-21235 9 0.719
NZ_QZDI01000041_3 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22473-22504 32 MN855885 Siphoviridae sp. isolate 38, complete genome 1544-1575 9 0.719
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 410680-410711 9 0.719
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 263322-263353 9 0.719
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1691645-1691676 9 0.719
NZ_QZDI01000041_1 1.2|5385|32|NZ_QZDI01000041|CRISPRCasFinder 5385-5416 32 MK448349 Streptococcus satellite phage Javan176, complete genome 1781-1812 10 0.688
NZ_QZDI01000041_1 1.7|5685|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR 5685-5716 32 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 640384-640415 10 0.688
NZ_QZDI01000041_1 1.10|5865|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR 5865-5896 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 379715-379746 10 0.688
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 143577-143608 10 0.688
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 327867-327898 10 0.688
NZ_QZDI01000041_2 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15199-15230 32 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1432941-1432972 10 0.688
NZ_QZDI01000041_3 3.2|22353|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22353-22384 32 NZ_CP025802 Yersinia ruckeri strain SC09 plasmid pLT, complete sequence 11979-12010 10 0.688
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 116424-116455 10 0.688
NZ_QZDI01000041_2 2.2|14959|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 14959-14990 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 39719-39750 11 0.656
NZ_QZDI01000041_2 2.2|14959|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 14959-14990 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 364142-364173 11 0.656
NZ_QZDI01000041_2 2.12|15560|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT 15560-15591 32 NZ_CP053711 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence 74002-74033 11 0.656
NZ_QZDI01000041_3 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR 22653-22684 32 NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 106164-106195 11 0.656

1. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 6, identity: 0.812

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
tcagcgccgacaggcgggtggcggatagttcg	Protospacer
 **********.**** *********.  ***

2. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.812

gcagcgccgacgggcgtgtggcggatg-tgtcg	CRISPR spacer
ccaacgccgacgggcttgtggcggtcgctgtc-	Protospacer
 **.*********** ******** .* **** 

3. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

4. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

5. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

6. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

7. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

8. spacer 3.6|22593|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to MT011984 (Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence) position: , mismatch: 7, identity: 0.781

ccagtgctgcgcaatcaacgcgcacagcgtgt	CRISPR spacer
ccgcaactgcgcagtcaacgcgcccagcgtga	Protospacer
**.  .*******.********* ******* 

9. spacer 1.15|5617|30|NZ_QZDI01000041|CRT matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgaactttttccagatggtacagacgt	CRISPR spacer
gggtgagctttttcaagatggtacacgccg	Protospacer
 .****.******* ********** .*  

10. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
cgtgaaatacttcactgagcttgaagcaaaaa	Protospacer
.* **************** ******  * ..

11. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to MT104465 (Pseudomonas phage MR1, complete genome) position: , mismatch: 8, identity: 0.75

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
cgctcagaacttcactgaggttgccggtatgg	Protospacer
.*   *. ***************  *******

12. spacer 2.8|15319|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gtgaaaaagtcggttttcgtctggctgatact	CRISPR spacer
gtgaaaaagtgggtttgcgtctgaacggtgcg	Protospacer
********** ***** ******. .*.*.* 

13. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

14. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

15. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

16. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

17. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

18. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

19. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

20. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 8, identity: 0.75

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
gaagcgccgacggtcgggtggcggatgccagt	Protospacer
* *********** ** **********.    

21. spacer 3.8|22713|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cggtatggtccgctcaaaacatggcggcacca	CRISPR spacer
gccgatggtccgcgcaaaacagggcggccgca	Protospacer
    ********* ******* ******  **

22. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

23. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

24. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

25. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

26. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

27. spacer 1.1|5325|32|NZ_QZDI01000041|CRISPRCasFinder matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 9, identity: 0.719

ctctttatcttccagtcgcacccacgcgccct	CRISPR spacer
ccttagtgattccagtcgcacccatacgccct	Protospacer
*..*     ***************..******

28. spacer 1.8|5745|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR matches to NZ_CP047096 (Bacillus marisflavi strain 151-25 plasmid p25, complete sequence) position: , mismatch: 9, identity: 0.719

gttatggtttatgttggtgacatttcgcggcg	CRISPR spacer
tatatgttttatattggtgacattttcagtgg	Protospacer
  **** *****.************.  *  *

29. spacer 2.1|14899|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719

cttgcctgacgggttgcggcacgcactcgaaa	CRISPR spacer
ggatcatgacaggctgcggcacgcactcgacg	Protospacer
    * ****.**.**************** .

30. spacer 2.1|14899|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

cttgcctgacgggttgcggcacgcactcgaaa	CRISPR spacer
catcggcgacgggttgcgcgacgcactcgacc	Protospacer
* *   .***********  **********  

31. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to KU064779 (Pseudomonas phage PPPL-1, complete genome) position: , mismatch: 9, identity: 0.719

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
cgctcagaacttcactgaggttgccggtatga	Protospacer
.*   *. ***************  ******.

32. spacer 2.11|15499|33|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to MH717709 (Escherichia phage LL2, complete genome) position: , mismatch: 9, identity: 0.727

agcctggccagcattcaacttgaaaaaacggat	CRISPR spacer
agcctgcccatcattcaacttgaagcgctggtg	Protospacer
****** *** *************. . .**  

33. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
gaatacgacgcaacgtttaaaggggttctttt	Protospacer
************.***** *****  .  *  

34. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020927 (Sphingobium yanoikuyae strain SHJ plasmid pSES189, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
cgacaggacgctgcggttcaagggcgcggact	Protospacer
 .*.* ***** *** *************   

35. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
ggttttatcgcaccgtttcaaggacgcggtaa	Protospacer
*. * .. **** **********.*******.

36. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
cgacaggacgctgcggttcaagggcgcggact	Protospacer
 .*.* ***** *** *************   

37. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053227 (Sphingobium sp. RSMS plasmid pRSMS4) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
cgacaggacgctgcggttcaagggcgcggact	Protospacer
 .*.* ***** *** *************   

38. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
ggcgatcccgcagcgtttcagggccgcggtaa	Protospacer
*.  *.  ************.** *******.

39. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
cgacaggacgctgcggttcaagggcgcggact	Protospacer
 .*.* ***** *** *************   

40. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
cgacaggacgctgcggttcaagggcgcggact	Protospacer
 .*.* ***** *** *************   

41. spacer 3.4|22473|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to MN855885 (Siphoviridae sp. isolate 38, complete genome) position: , mismatch: 9, identity: 0.719

gaatacgacgcagcgtttcaagggcgcggtag	CRISPR spacer
gaatacgacgtagagtttcaaggctgatattt	Protospacer
**********.** ********* .*  .*  

42. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
aatgcgccgacggccgtgcggcggatctctgc	Protospacer
.  ********** ****.******* * *  

43. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
ccagcgccgtctggcgtgtggcggccgtcgat	Protospacer
 ******** * ************ .**    

44. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
ccagcgccgtctggcgtgtggcggccgtcgat	Protospacer
 ******** * ************ .**    

45. spacer 1.2|5385|32|NZ_QZDI01000041|CRISPRCasFinder matches to MK448349 (Streptococcus satellite phage Javan176, complete genome) position: , mismatch: 10, identity: 0.688

gtctggagcatcaaacaaagtggcaccccacg	CRISPR spacer
aactggaacatcaaaaaaagtggcaatatatt	Protospacer
. *****.******* ********* . .*. 

46. spacer 1.7|5685|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgatggccgacatcgcagcaattttccatt	CRISPR spacer
ggtgatggccaacatcgccgcaagctggatca	Protospacer
**********.******* **** .*    . 

47. spacer 1.10|5865|32|NZ_QZDI01000041|CRISPRCasFinder,PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gctctggcgtcctttataggctttcagcgccg	CRISPR spacer
cgcttggcgtccttgatgggctttcagcaatc	Protospacer
  ..********** **.**********. . 

48. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 10, identity: 0.688

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
agtgaaatacttcacagagcttgaagcagaaa	Protospacer
 * ************ *** ******  . ..

49. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 10, identity: 0.688

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
agtgaaatacttcacagagcttgaagcagaaa	Protospacer
 * ************ *** ******  . ..

50. spacer 2.6|15199|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 10, identity: 0.688

tgagaaatacttcactgaggttgaaggtatgg	CRISPR spacer
agtgaaatacttcacagagcttgaagcagaaa	Protospacer
 * ************ *** ******  . ..

51. spacer 3.2|22353|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025802 (Yersinia ruckeri strain SC09 plasmid pLT, complete sequence) position: , mismatch: 10, identity: 0.688

agactatctgttttgtcgccattactagttca	CRISPR spacer
tagcgtgctgttttgtcgccataaatagtttc	Protospacer
 ..*   *************** * *****. 

52. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
aatgcgccgacggccgtgcggcggatctccgc	Protospacer
.  ********** ****.******* * .  

53. spacer 2.2|14959|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

gtctgctgcaaacagactggcaaacatacccg	CRISPR spacer
ccatgctgcaatcagaccggcaaacagcgtaa	Protospacer
 . ******** *****.********   . .

54. spacer 2.2|14959|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 11, identity: 0.656

gtctgctgcaaacagactggcaaacatacccg	CRISPR spacer
ccatgctgcaatcagaccggcaaacagcgtaa	Protospacer
 . ******** *****.********   . .

55. spacer 2.12|15560|32|NZ_QZDI01000041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656

tggaataaatacgtcgccgatgccaactttac	CRISPR spacer
aacgatgaacacgtcgccgatgccaaccaggt	Protospacer
 . .**.**.*****************.  ..

56. spacer 3.7|22653|32|NZ_QZDI01000041|CRISPRCasFinder,CRT,PILER-CR matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 11, identity: 0.656

gcagcgccgacgggcgtgtggcggatgtgtcg	CRISPR spacer
agcacgccgatgggcgtgtggtggatgccatc	Protospacer
.  .******.**********.*****.  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_QZDI01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000001_1 112019-112099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81896 : 117746 39 Burkholderia_phage(31.58%) plate,tail,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_QZDI01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25211 : 38662 11 Pseudomonas_phage(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_QZDI01000054
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11322 : 17877 7 uncultured_Caudovirales_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_QZDI01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000015_1 261969-262065 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 285378 : 312376 34 Cronobacter_phage(70.37%) portal,capsid,tail,head,terminase,holin,integrase attL 285211:285259|attR 314684:314732
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_QZDI01000051
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44705 : 52517 8 Mycobacterium_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_QZDI01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QZDI01000009_1 100592-100698 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_QZDI01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23632 : 31667 6 Dickeya_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage