Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_QTWH01000014 Ruminococcus sp. AF25-13 AF25-13.Scaf14, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QTWH01000016 Ruminococcus sp. AF25-13 AF25-13.Scaf16, whole genome shotgun sequence 0 crisprs c2c9_V-U4 0 0 1 0
NZ_QTWH01000052 Ruminococcus sp. AF25-13 AF25-13.Scaf52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000059 Ruminococcus sp. AF25-13 AF25-13.Scaf59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000037 Ruminococcus sp. AF25-13 AF25-13.Scaf37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000041 Ruminococcus sp. AF25-13 AF25-13.Scaf41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000048 Ruminococcus sp. AF25-13 AF25-13.Scaf48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000033 Ruminococcus sp. AF25-13 AF25-13.Scaf33, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QTWH01000012 Ruminococcus sp. AF25-13 AF25-13.Scaf12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QTWH01000058 Ruminococcus sp. AF25-13 AF25-13.Scaf58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000027 Ruminococcus sp. AF25-13 AF25-13.Scaf27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000017 Ruminococcus sp. AF25-13 AF25-13.Scaf17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000053 Ruminococcus sp. AF25-13 AF25-13.Scaf53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000038 Ruminococcus sp. AF25-13 AF25-13.Scaf38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000051 Ruminococcus sp. AF25-13 AF25-13.Scaf51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000022 Ruminococcus sp. AF25-13 AF25-13.Scaf22, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QTWH01000042 Ruminococcus sp. AF25-13 AF25-13.Scaf42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000002 Ruminococcus sp. AF25-13 AF25-13.Scaf2, whole genome shotgun sequence 0 crisprs cas3,DEDDh,DinG 0 0 0 0
NZ_QTWH01000023 Ruminococcus sp. AF25-13 AF25-13.Scaf23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000034 Ruminococcus sp. AF25-13 AF25-13.Scaf34, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QTWH01000031 Ruminococcus sp. AF25-13 AF25-13.Scaf31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000043 Ruminococcus sp. AF25-13 AF25-13.Scaf43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000046 Ruminococcus sp. AF25-13 AF25-13.Scaf46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000020 Ruminococcus sp. AF25-13 AF25-13.Scaf20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000029 Ruminococcus sp. AF25-13 AF25-13.Scaf29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000055 Ruminococcus sp. AF25-13 AF25-13.Scaf55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000021 Ruminococcus sp. AF25-13 AF25-13.Scaf21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000056 Ruminococcus sp. AF25-13 AF25-13.Scaf56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000024 Ruminococcus sp. AF25-13 AF25-13.Scaf24, whole genome shotgun sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 8 0 0
NZ_QTWH01000004 Ruminococcus sp. AF25-13 AF25-13.Scaf4, whole genome shotgun sequence 1 crisprs NA 2 0 0 0
NZ_QTWH01000019 Ruminococcus sp. AF25-13 AF25-13.Scaf19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000030 Ruminococcus sp. AF25-13 AF25-13.Scaf30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000011 Ruminococcus sp. AF25-13 AF25-13.Scaf11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000050 Ruminococcus sp. AF25-13 AF25-13.Scaf50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000007 Ruminococcus sp. AF25-13 AF25-13.Scaf7, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_QTWH01000032 Ruminococcus sp. AF25-13 AF25-13.Scaf32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000057 Ruminococcus sp. AF25-13 AF25-13.Scaf57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000003 Ruminococcus sp. AF25-13 AF25-13.Scaf3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000025 Ruminococcus sp. AF25-13 AF25-13.Scaf25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000049 Ruminococcus sp. AF25-13 AF25-13.Scaf49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000018 Ruminococcus sp. AF25-13 AF25-13.Scaf18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000005 Ruminococcus sp. AF25-13 AF25-13.Scaf5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000028 Ruminococcus sp. AF25-13 AF25-13.Scaf28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000045 Ruminococcus sp. AF25-13 AF25-13.Scaf45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000036 Ruminococcus sp. AF25-13 AF25-13.Scaf36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000010 Ruminococcus sp. AF25-13 AF25-13.Scaf10, whole genome shotgun sequence 1 crisprs RT,WYL 0 0 3 1
NZ_QTWH01000044 Ruminococcus sp. AF25-13 AF25-13.Scaf44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000040 Ruminococcus sp. AF25-13 AF25-13.Scaf40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000047 Ruminococcus sp. AF25-13 AF25-13.Scaf47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000039 Ruminococcus sp. AF25-13 AF25-13.Scaf39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000006 Ruminococcus sp. AF25-13 AF25-13.Scaf6, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000054 Ruminococcus sp. AF25-13 AF25-13.Scaf54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000015 Ruminococcus sp. AF25-13 AF25-13.Scaf15, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QTWH01000009 Ruminococcus sp. AF25-13 AF25-13.Scaf9, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_QTWH01000035 Ruminococcus sp. AF25-13 AF25-13.Scaf35, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_QTWH01000001 Ruminococcus sp. AF25-13 AF25-13.Scaf1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000060 Ruminococcus sp. AF25-13 AF25-13.Scaf60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000008 Ruminococcus sp. AF25-13 AF25-13.Scaf8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000026 Ruminococcus sp. AF25-13 AF25-13.Scaf26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QTWH01000013 Ruminococcus sp. AF25-13 AF25-13.Scaf13, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_QTWH01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_QTWH01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13602 : 21418 9 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_QTWH01000024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QTWH01000024_1 24965-27445 TypeI NA
37 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QTWH01000024_1 1.10|25590|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25590-25623 34 EU246945 Lactobacillus phage Lrm1, complete sequence 32625-32658 5 0.853
NZ_QTWH01000024_1 1.10|25590|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25590-25623 34 NC_011104 Lactobacillus phage Lrm1, complete genome 32625-32658 5 0.853
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 MH791397 UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome 136540-136571 7 0.781
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 NZ_CP038864 Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence 34014-34045 7 0.781
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 NZ_CP011157 Bacillus cereus strain HN001 plasmid pRML02, complete sequence 25587-25618 8 0.75
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 MG592499 Vibrio phage 1.124.O._10N.286.49.B1, partial genome 45889-45920 8 0.75
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 MG592531 Vibrio phage 1.164.O._10N.261.51.A7, partial genome 46464-46495 8 0.75
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 MT648818 Acinetobacter phage FG02, partial genome 42005-42039 8 0.771
NZ_QTWH01000024_1 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25063-25095 33 NC_012226 Brachyspira hyodysenteriae WA1 plasmid pBHWA1, complete sequence 2922-2954 9 0.727
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 72997-73028 9 0.719
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 MN694172 Marine virus AFVG_250M818, complete genome 43078-43109 9 0.719
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 MN508623 UNVERIFIED: Enterobacter phage EC-F1, complete genome 153467-153501 9 0.743
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 MH823906 Citrobacter phage Maroon, complete genome 155616-155650 9 0.743
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 LC589952 Enterobacter phage vB_EkoM5VN DNA, complete genome 25711-25745 9 0.743
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 MT341500 Enterobacter phage EBPL, complete genome 158463-158497 9 0.743
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 NC_048645 Cronobacter phage vB_CsaM_leB, complete genome 154389-154423 9 0.743
NZ_QTWH01000024_1 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26249-26283 35 MK448739 Streptococcus phage Javan363, complete genome 10107-10141 9 0.743
NZ_QTWH01000024_1 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26249-26283 35 MK448918 Streptococcus phage Javan366, complete genome 11540-11574 9 0.743
NZ_QTWH01000024_1 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25063-25095 33 NZ_CP019601 Brachyspira hyodysenteriae strain BH718 plasmid pBH718, complete sequence 34973-35005 10 0.697
NZ_QTWH01000024_1 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25063-25095 33 NZ_CP016085 Brachyspira hyodysenteriae ATCC 27164 strain B-78 plasmid pBhyoB78, complete sequence 21002-21034 10 0.697
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 NC_048646 Cronobacter phage vB_CsaM_leE, complete genome 158470-158504 10 0.714
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 MN508621 UNVERIFIED: Enterobacter phage EC-W1, complete genome 171451-171485 10 0.714
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 JN882287 Cronobacter phage vB_CsaM_GAP161, complete genome 154562-154596 10 0.714
NZ_QTWH01000024_1 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25853-25887 35 KT381880 Citrobacter phage Margaery, complete genome 155196-155230 10 0.714
NZ_QTWH01000024_1 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26249-26283 35 MK448914 Streptococcus phage Javan348, complete genome 12127-12161 10 0.714
NZ_QTWH01000024_1 1.28|26778|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26778-26812 35 NZ_CP013709 Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence 11667-11701 10 0.714
NZ_QTWH01000024_1 1.28|26778|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26778-26812 35 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 47813-47847 10 0.714
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 AJ972879 Yersinia phage phiR1-37 complete genome 257181-257212 11 0.656
NZ_QTWH01000024_1 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25723-25754 32 NC_016163 Yersinia phage phiR1-37, complete genome 257181-257212 11 0.656
NZ_QTWH01000024_1 1.17|26052|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 26052-26085 34 MF959998 Marinobacter phage PS6, complete genome 19049-19082 11 0.676
NZ_QTWH01000024_1 1.6|25326|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT 25326-25359 34 NZ_CP046125 Enterococcus casseliflavus strain EC291 plasmid unnamed2, complete sequence 14418-14451 12 0.647

1. spacer 1.10|25590|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.853

atatcacaa--agatacattggaaaaattaacgatt	CRISPR spacer
--atcataatcagatacattggcaaaattaacggtt	Protospacer
  ****.**  *********** **********.**

2. spacer 1.10|25590|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.853

atatcacaa--agatacattggaaaaattaacgatt	CRISPR spacer
--atcataatcagatacattggcaaaattaacggtt	Protospacer
  ****.**  *********** **********.**

3. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MH791397 (UNVERIFIED: Enterococcus phage EfsSzw-1, complete genome) position: , mismatch: 7, identity: 0.781

aattgttcttttaaatccatttttcactctac	CRISPR spacer
taagcttcttttaaatccattattctctctcc	Protospacer
 *   **************** *** **** *

4. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038864 (Campylobacter jejuni strain SCJK2 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

aattgttcttttaaatccatttttcactctac	CRISPR spacer
atatgtttttttaaatccattttgcaccaaac	Protospacer
*  ****.*************** ***.  **

5. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011157 (Bacillus cereus strain HN001 plasmid pRML02, complete sequence) position: , mismatch: 8, identity: 0.75

aattgttcttttaaatccatttttcactctac	CRISPR spacer
aattgttcttgtaaatacattttaaaatattt	Protospacer
********** ***** ******  * * * .

6. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MG592499 (Vibrio phage 1.124.O._10N.286.49.B1, partial genome) position: , mismatch: 8, identity: 0.75

aattgttcttttaaatccatttttcactctac	CRISPR spacer
agttgttgttttaaattcatttttccattttt	Protospacer
*.***** ********.********  *.* .

7. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 8, identity: 0.75

aattgttcttttaaatccatttttcactctac	CRISPR spacer
agttgttgttttaaattcatttttccattttt	Protospacer
*.***** ********.********  *.* .

8. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MT648818 (Acinetobacter phage FG02, partial genome) position: , mismatch: 8, identity: 0.771

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
tccgcacctgttttcttcttccatgcttcggttgc	Protospacer
*  **  *..****** *************.****

9. spacer 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NC_012226 (Brachyspira hyodysenteriae WA1 plasmid pBHWA1, complete sequence) position: , mismatch: 9, identity: 0.727

aattacattctctaaatggtatgaaccaaaccc	CRISPR spacer
ctcttctttttctaaatggtatgaaccatacta	Protospacer
  .* * **.****************** **. 

10. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 9, identity: 0.719

aattgttcttttaaatccatttttcactctac	CRISPR spacer
aaatgttcttttaaattcattttataaatacc	Protospacer
** *************.****** .*  .  *

11. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MN694172 (Marine virus AFVG_250M818, complete genome) position: , mismatch: 9, identity: 0.719

aattgttcttttaaatccatttttcactctac	CRISPR spacer
tgttgttcttttatattcatttttcctcctct	Protospacer
 .*********** **.******** ..** .

12. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MN508623 (UNVERIFIED: Enterobacter phage EC-F1, complete genome) position: , mismatch: 9, identity: 0.743

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccatatcctgttttcttcttccatgcttcggttgc	Protospacer
. *  * *..****** *************.****

13. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MH823906 (Citrobacter phage Maroon, complete genome) position: , mismatch: 9, identity: 0.743

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccatatcctgttttcttcttccatgcttcggttgc	Protospacer
. *  * *..****** *************.****

14. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to LC589952 (Enterobacter phage vB_EkoM5VN DNA, complete genome) position: , mismatch: 9, identity: 0.743

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccatatcctgttttcttcttccatgcttcggttgc	Protospacer
. *  * *..****** *************.****

15. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MT341500 (Enterobacter phage EBPL, complete genome) position: , mismatch: 9, identity: 0.743

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccatatcctgttttcttcttccatgcttcggttgc	Protospacer
. *  * *..****** *************.****

16. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NC_048645 (Cronobacter phage vB_CsaM_leB, complete genome) position: , mismatch: 9, identity: 0.743

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccatatcctgttttcttcttccatgcttcggttgc	Protospacer
. *  * *..****** *************.****

17. spacer 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MK448739 (Streptococcus phage Javan363, complete genome) position: , mismatch: 9, identity: 0.743

aaaaattccatgttcttcttcctttctccgtcatg	CRISPR spacer
acaaattccatgttctacctcctttctgcaaaaca	Protospacer
* ************** *.******** *.  *..

18. spacer 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MK448918 (Streptococcus phage Javan366, complete genome) position: , mismatch: 9, identity: 0.743

aaaaattccatgttcttcttcctttctccgtcatg	CRISPR spacer
acaaattccatgttctacctcctttctgcaaaaca	Protospacer
* ************** *.******** *.  *..

19. spacer 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019601 (Brachyspira hyodysenteriae strain BH718 plasmid pBH718, complete sequence) position: , mismatch: 10, identity: 0.697

aattacattctctaaatggtatgaaccaaaccc	CRISPR spacer
ctcttttttttctaaatggtatgaaccatacta	Protospacer
  .* . **.****************** **. 

20. spacer 1.2|25063|33|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016085 (Brachyspira hyodysenteriae ATCC 27164 strain B-78 plasmid pBhyoB78, complete sequence) position: , mismatch: 10, identity: 0.697

aattacattctctaaatggtatgaaccaaaccc	CRISPR spacer
ctcttttttttctaaatggtatgaaccatacta	Protospacer
  .* . **.****************** **. 

21. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NC_048646 (Cronobacter phage vB_CsaM_leE, complete genome) position: , mismatch: 10, identity: 0.714

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccaaaaccagttttcttcttccatgcttcggttgc	Protospacer
. *.   * .****** *************.****

22. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MN508621 (UNVERIFIED: Enterobacter phage EC-W1, complete genome) position: , mismatch: 10, identity: 0.714

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccataccctgttttcttcttccatgcttcggttgc	Protospacer
. *  . *..****** *************.****

23. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to JN882287 (Cronobacter phage vB_CsaM_GAP161, complete genome) position: , mismatch: 10, identity: 0.714

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccaaaaccagttttcttcttccatgcttcggttgc	Protospacer
. *.   * .****** *************.****

24. spacer 1.14|25853|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to KT381880 (Citrobacter phage Margaery, complete genome) position: , mismatch: 10, identity: 0.714

taagctgccattttctgcttccatgcttcgattgc	CRISPR spacer
ccaaaacctgttttcttcttccatgcttcggttgc	Protospacer
. *.   *..****** *************.****

25. spacer 1.20|26249|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MK448914 (Streptococcus phage Javan348, complete genome) position: , mismatch: 10, identity: 0.714

aaaaattccatgttcttcttcctttctccgtcatg	CRISPR spacer
acaaattccatgttctacctcctttctataaaaca	Protospacer
* ************** *.******** ..  *..

26. spacer 1.28|26778|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013709 (Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence) position: , mismatch: 10, identity: 0.714

gatgatacagaagaagaaagagaggaaaatgtcgg	CRISPR spacer
atagatacagaagaagaaaaagaagaaattttatt	Protospacer
.  ****************.***.**** * *   

27. spacer 1.28|26778|35|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 10, identity: 0.714

gatgatacagaagaagaaagagaggaaaatgtcgg	CRISPR spacer
atagatacagaagaagaaaaagaagaaattttatt	Protospacer
.  ****************.***.**** * *   

28. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to AJ972879 (Yersinia phage phiR1-37 complete genome) position: , mismatch: 11, identity: 0.656

aattgttcttttaaatccatttttcactctac	CRISPR spacer
ttcatctcttttaaatccattctttactccca	Protospacer
  .  .***************.**.****.  

29. spacer 1.12|25723|32|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NC_016163 (Yersinia phage phiR1-37, complete genome) position: , mismatch: 11, identity: 0.656

aattgttcttttaaatccatttttcactctac	CRISPR spacer
ttcatctcttttaaatccattctttactccca	Protospacer
  .  .***************.**.****.  

30. spacer 1.17|26052|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to MF959998 (Marinobacter phage PS6, complete genome) position: , mismatch: 11, identity: 0.676

acctccttacgctattgccgccgtctggattgtt	CRISPR spacer
acttccttccgctattgccgccgtactgggcaca	Protospacer
**.***** *************** . *. ... 

31. spacer 1.6|25326|34|NZ_QTWH01000024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046125 (Enterococcus casseliflavus strain EC291 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.647

aggtatagcaaacaagccatcgaaaggtggcttt	CRISPR spacer
taataaagcaaacaagccaacgaaaggcattaaa	Protospacer
 ..** ************* *******.. .   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_QTWH01000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QTWH01000010_1 69859-69967 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 45958 : 55880 15 unidentified_phage(50.0%) NA NA
DBSCAN-SWA_2 59400 : 69649 11 Faecalibacterium_phage(44.44%) capsid NA
DBSCAN-SWA_3 148063 : 154667 11 Streptococcus_phage(85.71%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QTWH01000010.1|WP_064786071.1|95185_95731_+|hypothetical-protein 95185_95731_+ 181 aa aa AcrIIA11 NA NA No NA
5. NZ_QTWH01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81270 : 91613 9 Streptococcus_phage(14.29%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_QTWH01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 112312 : 122823 15 uncultured_Caudovirales_phage(37.5%) integrase attL 120130:120141|attR 122947:122958
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_QTWH01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3612 : 10493 13 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_QTWH01000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1709 : 7942 10 Streptococcus_phage(33.33%) integrase attL 277:291|attR 6084:6098
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_QTWH01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80537 : 90886 11 Bacillus_phage(22.22%) integrase,transposase attL 72585:72600|attR 96052:96067
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_QTWH01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QTWH01000004_1 127162-127305 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_QTWH01000004_1 1.1|127184|19|NZ_QTWH01000004|CRT 127184-127202 19 NZ_QTWH01000009.1 137905-137923 2 0.895
NZ_QTWH01000004_1 1.3|127265|19|NZ_QTWH01000004|CRT 127265-127283 19 NZ_QTWH01000009.1 137905-137923 2 0.895

1. spacer 1.1|127184|19|NZ_QTWH01000004|CRT matches to position: 137905-137923, mismatch: 2, identity: 0.895

tcaaaatcataactatctc	CRISPR spacer
tcaaaatcataaatttctc	Protospacer
************ * ****

2. spacer 1.3|127265|19|NZ_QTWH01000004|CRT matches to position: 137905-137923, mismatch: 2, identity: 0.895

tcaaaatcataactatctc	CRISPR spacer
tcaaaatcataaatttctc	Protospacer
************ * ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_QTWH01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42 : 8778 9 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage