Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_QSQN01000085 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000049 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000018 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf18, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QSQN01000022 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000038 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000061 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000059 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf59, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_QSQN01000071 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000039 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000083 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000067 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000030 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000002 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000056 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000043 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000052 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf52, whole genome shotgun sequence 0 crisprs cas14j 0 0 0 0
NZ_QSQN01000005 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf5, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QSQN01000006 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf6, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_QSQN01000012 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000026 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000076 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000015 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf15, whole genome shotgun sequence 1 crisprs cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,cas1,cas2,csm6 0 4 0 0
NZ_QSQN01000013 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf13, whole genome shotgun sequence 0 crisprs PD-DExK 0 0 0 0
NZ_QSQN01000051 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000044 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000073 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000068 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000045 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000011 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf11, whole genome shotgun sequence 1 crisprs RT 0 0 2 1
NZ_QSQN01000065 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf65, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QSQN01000008 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf8, whole genome shotgun sequence 0 crisprs DinG,DEDDh 0 0 0 0
NZ_QSQN01000021 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000031 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf31, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QSQN01000077 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000062 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000057 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000086 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf86, whole genome shotgun sequence 0 crisprs cas14j 0 0 0 0
NZ_QSQN01000084 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000075 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000042 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000003 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000055 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000074 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000001 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000047 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000063 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf63, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QSQN01000034 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf34, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_QSQN01000035 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000036 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000007 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000027 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf27, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_QSQN01000070 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000046 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000040 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf40, whole genome shotgun sequence 0 crisprs c2c9_V-U4 0 0 0 0
NZ_QSQN01000025 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf25, whole genome shotgun sequence 2 crisprs csn2,cas2,cas1,cas9 1 13 0 0
NZ_QSQN01000064 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000028 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000041 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf41, whole genome shotgun sequence 1 crisprs csx1,csx20,cas10,csm3gr7,cas6,cas1,cas2 0 4 0 0
NZ_QSQN01000037 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000054 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000080 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000017 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf17, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_QSQN01000024 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf24, whole genome shotgun sequence 0 crisprs cas3HD 0 0 0 0
NZ_QSQN01000004 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf4, whole genome shotgun sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2 2 0 0 0
NZ_QSQN01000019 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000048 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000060 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000033 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000079 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000010 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000081 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000023 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000020 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf20, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QSQN01000058 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000029 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000082 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000014 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf14, whole genome shotgun sequence 0 crisprs DinG,RT 0 0 0 0
NZ_QSQN01000072 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000050 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000053 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000069 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000032 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf32, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_QSQN01000066 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000078 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000009 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QSQN01000016 [Ruminococcus] lactaris strain TF11-7 TF11-7.Scaf16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_QSQN01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2182 : 29729 36 Paenibacillus_phage(21.05%) tail,portal,terminase,capsid,protease,integrase attL 887:900|attR 9141:9154
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_QSQN01000063
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 239 : 4106 6 uncultured_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_QSQN01000034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000034_1 14055-14263 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_QSQN01000059
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000059_1 2849-2993 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_QSQN01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32989 : 48296 18 Streptococcus_phage(91.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_QSQN01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000011_1 52029-52137 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31999 : 38147 10 unidentified_phage(50.0%) NA NA
DBSCAN-SWA_2 41667 : 51819 10 Faecalibacterium_phage(44.44%) capsid,terminase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QSQN01000011.1|WP_064786071.1|77045_77591_+|hypothetical-protein 77045_77591_+ 181 aa aa AcrIIA11 NA NA No NA
7. NZ_QSQN01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1880 : 8387 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 53160 : 59965 9 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_QSQN01000041
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000041_1 20779-22591 TypeIII NA
25 spacers
cas6,csm3gr7,cas10,csx20,csx1,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QSQN01000041_1 1.3|20953|36|NZ_QSQN01000041|PILER-CR 20953-20988 36 MN693557 Marine virus AFVG_25M454, complete genome 21148-21183 8 0.778
NZ_QSQN01000041_1 1.3|20953|36|NZ_QSQN01000041|PILER-CR 20953-20988 36 MN693126 Marine virus AFVG_25M164, complete genome 20522-20557 8 0.778
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP014849 Bacillus thuringiensis strain HD12 plasmid pHD120038, complete sequence 14104-14136 8 0.758
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 JQ062992 Bacillus phage phIS3501, complete genome 41568-41600 8 0.758
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 MG945472 UNVERIFIED: Microviridae sp. isolate 418-18011, complete genome 1530-1562 9 0.727
NZ_QSQN01000041_1 1.28|22528|35|NZ_QSQN01000041|CRT 22528-22562 35 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 57842-57876 9 0.743
NZ_QSQN01000041_1 1.6|20952|38|NZ_QSQN01000041|CRISPRCasFinder,CRT 20952-20989 38 MN693557 Marine virus AFVG_25M454, complete genome 21148-21185 10 0.737
NZ_QSQN01000041_1 1.6|20952|38|NZ_QSQN01000041|CRISPRCasFinder,CRT 20952-20989 38 MN693126 Marine virus AFVG_25M164, complete genome 20522-20559 10 0.737
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP016361 Bacillus cereus strain M13 plasmid pBCM1301, complete sequence 51072-51104 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024099 Bacillus cytotoxicus strain CH_38 plasmid pCh38_53, complete sequence 22383-22415 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024121 Bacillus cytotoxicus strain CH_1 plasmid pCh1_53, complete sequence 11471-11503 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024114 Bacillus cytotoxicus strain CH_3 plasmid pCh3_53, complete sequence 28004-28036 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP047088 Bacillus paranthracis strain BC307 plasmid pCE3, complete sequence 34400-34432 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024105 Bacillus cytotoxicus strain CH_23 plasmid pCh23_53, complete sequence 13824-13856 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024117 Bacillus cytotoxicus strain CH_2 plasmid pCh2_53, complete sequence 50444-50476 11 0.667
NZ_QSQN01000041_1 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT 21094-21126 33 NZ_CP024102 Bacillus cytotoxicus strain CH_25 plasmid pCh25_53, complete sequence 47494-47526 11 0.667

1. spacer 1.3|20953|36|NZ_QSQN01000041|PILER-CR matches to MN693557 (Marine virus AFVG_25M454, complete genome) position: , mismatch: 8, identity: 0.778

cataatcattaatagcttttgtaagttttttcaaag	CRISPR spacer
cataatcattaatagctttttttagttgaggaacag	Protospacer
******************** * ****     * **

2. spacer 1.3|20953|36|NZ_QSQN01000041|PILER-CR matches to MN693126 (Marine virus AFVG_25M164, complete genome) position: , mismatch: 8, identity: 0.778

cataatcattaatagcttttgtaagttttttcaaag	CRISPR spacer
cataatcattaatagctttttttagttgaggaacag	Protospacer
******************** * ****     * **

3. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP014849 (Bacillus thuringiensis strain HD12 plasmid pHD120038, complete sequence) position: , mismatch: 8, identity: 0.758

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
acttgtatcttctttttatcatctattttactt	Protospacer
*.   * .**.************* ********

4. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to JQ062992 (Bacillus phage phIS3501, complete genome) position: , mismatch: 8, identity: 0.758

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
acttgtatcttctttttatcatctattttactt	Protospacer
*.   * .**.************* ********

5. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to MG945472 (UNVERIFIED: Microviridae sp. isolate 418-18011, complete genome) position: , mismatch: 9, identity: 0.727

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tacttttcctcctttttctcttcttttttcgct	Protospacer
    ************* ** ********  .*

6. spacer 1.28|22528|35|NZ_QSQN01000041|CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 9, identity: 0.743

aagtacggtattagaactttccaatttgttttatc	CRISPR spacer
agagacggtattagaacttttcaatctgtgatttt	Protospacer
*.. ****************.****.***  * *.

7. spacer 1.6|20952|38|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to MN693557 (Marine virus AFVG_25M454, complete genome) position: , mismatch: 10, identity: 0.737

cataatcattaatagcttttgtaagttttttcaaagtt	CRISPR spacer
cataatcattaatagctttttttagttgaggaacagaa	Protospacer
******************** * ****     * **  

8. spacer 1.6|20952|38|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to MN693126 (Marine virus AFVG_25M164, complete genome) position: , mismatch: 10, identity: 0.737

cataatcattaatagcttttgtaagttttttcaaagtt	CRISPR spacer
cataatcattaatagctttttttagttgaggaacagaa	Protospacer
******************** * ****     * **  

9. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

10. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024099 (Bacillus cytotoxicus strain CH_38 plasmid pCh38_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

11. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024121 (Bacillus cytotoxicus strain CH_1 plasmid pCh1_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

12. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024114 (Bacillus cytotoxicus strain CH_3 plasmid pCh3_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

13. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP047088 (Bacillus paranthracis strain BC307 plasmid pCE3, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

14. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024105 (Bacillus cytotoxicus strain CH_23 plasmid pCh23_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

15. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024117 (Bacillus cytotoxicus strain CH_2 plasmid pCh2_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

16. spacer 1.8|21094|33|NZ_QSQN01000041|CRISPRCasFinder,CRT matches to NZ_CP024102 (Bacillus cytotoxicus strain CH_25 plasmid pCh25_53, complete sequence) position: , mismatch: 11, identity: 0.667

ataatttcctcctttttatcatcttttttactt	CRISPR spacer
tagatttcatccttttaatcatcttttcgctca	Protospacer
  .***** ******* **********.  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_QSQN01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000017_1 12804-12874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QSQN01000017_1 1.1|12827|25|NZ_QSQN01000017|CRISPRCasFinder 12827-12851 25 NZ_CP009317 Bacillus cereus 03BB102 plasmid unnamed, complete sequence 96100-96124 4 0.84
NZ_QSQN01000017_1 1.1|12827|25|NZ_QSQN01000017|CRISPRCasFinder 12827-12851 25 NC_012473 Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence 40799-40823 4 0.84

1. spacer 1.1|12827|25|NZ_QSQN01000017|CRISPRCasFinder matches to NZ_CP009317 (Bacillus cereus 03BB102 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

taactttttatgatttacgactaac	CRISPR spacer
aaactttttataatttacaactaaa	Protospacer
 **********.******.***** 

2. spacer 1.1|12827|25|NZ_QSQN01000017|CRISPRCasFinder matches to NC_012473 (Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence) position: , mismatch: 4, identity: 0.84

taactttttatgatttacgactaac	CRISPR spacer
aaactttttataatttacaactaaa	Protospacer
 **********.******.***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_QSQN01000025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000025_1 37852-37954 TypeII NA
1 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000025_2 38634-39784 TypeII NA
17 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_QSQN01000025_2 2.10|39260|31|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39260-39290 31 NZ_QSQN01000005.1 35980-36010 0 1.0

1. spacer 2.10|39260|31|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to position: 35980-36010, mismatch: 0, identity: 1.0

ggcagtacataatataatacgtgttgccatt	CRISPR spacer
ggcagtacataatataatacgtgttgccatt	Protospacer
*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QSQN01000025_2 2.2|38736|30|NZ_QSQN01000025|CRISPRCasFinder,CRT 38736-38765 30 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 377310-377339 5 0.833
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MF042360 Pseudomonas phage Phabio, complete genome 45980-46008 5 0.828
NZ_QSQN01000025_2 2.1|38670|30|NZ_QSQN01000025|CRISPRCasFinder,CRT 38670-38699 30 NZ_CP014769 Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence 137417-137446 6 0.8
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 KP027447 Staphylococcus phage phiIPLA-C1C, complete genome 97327-97355 6 0.793
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 MH107118 Staphylococcus phage CSA13, complete genome 814-842 6 0.793
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 220718-220746 6 0.793
NZ_QSQN01000025_2 2.17|39720|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39720-39748 29 NZ_MK275620 Clostridium perfringens strain JXJA17 plasmid p2, complete sequence 11897-11925 6 0.793
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 360215-360244 7 0.767
NZ_QSQN01000025_2 2.1|38670|30|NZ_QSQN01000025|CRISPRCasFinder,CRT 38670-38699 30 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 82426-82455 7 0.767
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 MK936476 Staphylococcus phage SA46-CL1, complete genome 16713-16741 7 0.759
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 MK764384 Staphylococcus phage SA46-CTH2, complete genome 16711-16739 7 0.759
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 MK903033 Staphylococcus phage SA44-CTH7, complete genome 16712-16740 7 0.759
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 EU136189 Staphylococcus phage SAP-2, complete genome 17204-17232 7 0.759
NZ_QSQN01000025_2 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 38999-39027 29 NZ_CP020032 Geobacillus thermodenitrificans strain T12 plasmid pGeo12b, complete sequence 28688-28716 7 0.759
NZ_QSQN01000025_2 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 38999-39027 29 NZ_CP017691 Geobacillus thermodenitrificans strain ID-1 plasmid pLDW-2, complete sequence 3741-3769 7 0.759
NZ_QSQN01000025_2 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 38999-39027 29 NZ_CP017691 Geobacillus thermodenitrificans strain ID-1 plasmid pLDW-2, complete sequence 73849-73877 7 0.759
NZ_QSQN01000025_2 2.8|39129|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39129-39158 30 MN694159 Marine virus AFVG_250M1044, complete genome 24421-24450 7 0.767
NZ_QSQN01000025_2 2.8|39129|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39129-39158 30 KT997847 Uncultured phage_Deep1-GF2-KM23-C739 genomic sequence 25525-25554 7 0.767
NZ_QSQN01000025_2 2.12|39393|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39393-39421 29 NZ_AP014640 Leptolyngbya boryana IAM M-101 plasmid pLBX 399850-399878 7 0.759
NZ_QSQN01000025_2 2.12|39393|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39393-39421 29 NZ_AP018205 Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome 105624-105652 7 0.759
NZ_QSQN01000025_2 2.13|39458|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39458-39487 30 NC_009931 Acaryochloris marina MBIC11017 plasmid pREB6, complete sequence 28840-28869 7 0.767
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 CP003185 Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome 47841-47869 7 0.759
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 NC_019956 Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence 108070-108098 7 0.759
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 318962-318991 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 MN695335 Synechococcus phage B23, complete genome 75261-75290 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 MN695334 Synechococcus phage B3, complete genome 75258-75287 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP043762 Paenibacillus sp. 37 plasmid pART37, complete sequence 336040-336069 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_LT904880 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 3 25303-25332 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_KX833209 Salmonella enterica subsp. enterica serovar Typhi strain Ty004 plasmid pTy004_01, complete sequence 40397-40426 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_LT904895 Salmonella enterica subsp. enterica serovar Typhi strain ERL12960 genome assembly, plasmid: 2 63413-63442 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029647 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM2, complete sequence 99798-99827 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_LT904853 Salmonella enterica subsp. enterica serovar Typhi strain TY585 genome assembly, plasmid: 2 33116-33145 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NC_003385 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM2, complete sequence 38594-38623 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 45531-45560 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 260102-260131 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1767587-1767616 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029859 Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 plasmid pHCM2, complete sequence 2466-2495 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029847 Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 plasmid pHCM2, complete sequence 33934-33963 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029916 Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 plasmid pHCM2, complete sequence 78751-78780 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029893 Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 plasmid pHCM2, complete sequence 105960-105989 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029876 Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 plasmid pHCM2, complete sequence 97553-97582 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029884 Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 plasmid pHCM2, complete sequence 81179-81208 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029961 Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 plasmid pHCM2, complete sequence 1140-1169 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029849 Salmonella enterica subsp. enterica serovar Typhi strain 343078_211126 plasmid pHCM2, complete sequence 85382-85411 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029857 Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 plasmid pHCM2, complete sequence 48655-48684 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029929 Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 plasmid pHCM2, complete sequence 42571-42600 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029865 Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 plasmid pHCM2, complete sequence 56677-56706 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_LT883154 Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, plasmid: 2 1854-1883 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029905 Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 plasmid pHCM2, complete sequence 61686-61715 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029851 Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 plasmid pHCM2, complete sequence 75165-75194 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029889 Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 plasmid pHCM2, complete sequence 48926-48955 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029891 Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 plasmid pHCM2, complete sequence 94325-94354 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029898 Salmonella enterica subsp. enterica serovar Typhi strain 343077_213147 plasmid pHCM2, complete sequence 96885-96914 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029951 Salmonella enterica subsp. enterica serovar Typhi strain 311189_205186 plasmid pHCM2, complete sequence 78244-78273 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029867 Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 plasmid pHCM2, complete sequence 64216-64245 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029901 Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 plasmid pHCM2, complete sequence 63859-63888 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NZ_CP029921 Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 plasmid pHCM2, complete sequence 69490-69519 8 0.733
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 MK448671 Streptococcus phage Javan115, complete genome 24344-24373 8 0.733
NZ_QSQN01000025_2 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT 38802-38830 29 MN694677 Marine virus AFVG_250M798, complete genome 12243-12271 8 0.724
NZ_QSQN01000025_2 2.9|39195|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39195-39223 29 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 401285-401313 8 0.724
NZ_QSQN01000025_2 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39327-39356 30 NZ_LT963405 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence 9759-9788 8 0.733
NZ_QSQN01000025_2 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39327-39356 30 NZ_LT985191 Pseudomonas syringae group genomosp. 3 strain CFBP 3800 plasmid PP2, complete sequence 61432-61461 8 0.733
NZ_QSQN01000025_2 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39327-39356 30 NZ_CP026564 Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence 28842-28871 8 0.733
NZ_QSQN01000025_2 2.15|39589|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39589-39618 30 AJ245616 Lactococcus lactis phage BK5-T complete genome 13565-13594 8 0.733
NZ_QSQN01000025_2 2.15|39589|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39589-39618 30 AF176025 Lactococcus phage BK5-T, complete genome 13565-13594 8 0.733
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 NZ_CP030222 Salmonella enterica strain SA20021456 plasmid pSA20021456.3, complete sequence 34173-34201 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MW067001 CrAssphage sp. C0521BW15, complete genome 62545-62573 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK415404 CrAssphage FA1-2_000172F, complete genome 16562-16590 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MW067003 CrAssphage sp. C0531BW4, complete genome 64321-64349 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MT001829 Salmonella phage SE_PL, complete genome 254188-254216 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK238400 CrAssphage ZA, complete genome 61598-61626 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MW067000 CrAssphage sp. C0521BD4, complete genome 62545-62573 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK773491 Salmonella phage 7t3, complete genome 94549-94577 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK415403 CrAssphage ES_ALL_000190F, complete genome 16789-16817 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK415410 CrAssphage YS1-2_2437, complete genome 17063-17091 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 BK010471 TPA_asm: Uncultured crAssphage, complete genome 61460-61488 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MK268344 Salmonella phage Munch, complete genome 31861-31889 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 MW067002 CrAssphage sp. C0526BW15, complete genome 63591-63619 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 NC_024711 Uncultured crAssphage, complete genome 61460-61488 8 0.724
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 JQ995537 Uncultured phage crAssphage, complete genome 61460-61488 8 0.724
NZ_QSQN01000025_2 2.13|39458|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39458-39487 30 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 474720-474749 9 0.7
NZ_QSQN01000025_2 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR 39655-39683 29 NC_004349 Shewanella oneidensis MR-1 megaplasmid, complete sequence 116729-116757 9 0.69
NZ_QSQN01000025_1 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder 37888-37917 30 NC_049978 IAS virus, complete genome 32032-32061 10 0.667

1. spacer 2.2|38736|30|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 5, identity: 0.833

cggatcatacgattccattgaa-gaagatga	CRISPR spacer
cggatcatacgattccgttgaatcattatg-	Protospacer
****************.*****  *  *** 

2. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 5, identity: 0.828

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gcatttacaatagaaaaaattctagattt	Protospacer
***.. *********** **** ******

3. spacer 2.1|38670|30|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttacac-tgctgcccgatatctgccaccgca	CRISPR spacer
-tgcgctttctgcccgatttctgccaccgcg	Protospacer
 *.*.* * ********* ***********.

4. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to KP027447 (Staphylococcus phage phiIPLA-C1C, complete genome) position: , mismatch: 6, identity: 0.793

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaacagatgaaaagaaac	Protospacer
 ************* ***** *****   

5. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to MH107118 (Staphylococcus phage CSA13, complete genome) position: , mismatch: 6, identity: 0.793

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaatagatgcaaacaaaa	Protospacer
 ************* ********* *  .

6. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
agaaaaaaaatagaaaatattcaacattt	Protospacer
. *  ** **************** ****

7. spacer 2.17|39720|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK275620 (Clostridium perfringens strain JXJA17 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.793

cgatgtcgtcaagatgcctctgacatgca	CRISPR spacer
ctaaatcatcaagatgcctttgacatgct	Protospacer
* * .**.***********.******** 

8. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.767

attttcatattcatcaatctgttcagccac	CRISPR spacer
tttttcatattcagcaatttgttcaagtaa	Protospacer
 ************ ****.******. .* 

9. spacer 2.1|38670|30|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 7, identity: 0.767

ttacactgctgcccgatatctgccaccgca	CRISPR spacer
tcaacctggtgccggatatctgccaccggc	Protospacer
*.*  *** **** **************  

10. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to MK936476 (Staphylococcus phage SA46-CL1, complete genome) position: , mismatch: 7, identity: 0.759

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaatagatgtaaacaaaa	Protospacer
 ************* *****.*** *  .

11. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to MK764384 (Staphylococcus phage SA46-CTH2, complete genome) position: , mismatch: 7, identity: 0.759

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaatagatgtaaacaaaa	Protospacer
 ************* *****.*** *  .

12. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to MK903033 (Staphylococcus phage SA44-CTH7, complete genome) position: , mismatch: 7, identity: 0.759

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaatagatgtaaacaaaa	Protospacer
 ************* *****.*** *  .

13. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to EU136189 (Staphylococcus phage SAP-2, complete genome) position: , mismatch: 7, identity: 0.759

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
tgaaaatatgtcaatagatgtaaacaaaa	Protospacer
 ************* *****.*** *  .

14. spacer 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020032 (Geobacillus thermodenitrificans strain T12 plasmid pGeo12b, complete sequence) position: , mismatch: 7, identity: 0.759

cgctggtttaaaattcccgagaattttgt	CRISPR spacer
cgccggtttaaaattccccagaaggacct	Protospacer
***.************** ****   . *

15. spacer 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017691 (Geobacillus thermodenitrificans strain ID-1 plasmid pLDW-2, complete sequence) position: , mismatch: 7, identity: 0.759

cgctggtttaaaattcccgagaattttgt	CRISPR spacer
cgccggtttaaaattccccagaaggacct	Protospacer
***.************** ****   . *

16. spacer 2.6|38999|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017691 (Geobacillus thermodenitrificans strain ID-1 plasmid pLDW-2, complete sequence) position: , mismatch: 7, identity: 0.759

cgctggtttaaaattcccgagaattttgt	CRISPR spacer
cgccggtttaaaattccccagaaggacct	Protospacer
***.************** ****   . *

17. spacer 2.8|39129|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MN694159 (Marine virus AFVG_250M1044, complete genome) position: , mismatch: 7, identity: 0.767

agcaacagtagttacgtaagcaagtgcgat	CRISPR spacer
agcaacagtagatacgtcagcaaattattt	Protospacer
*********** ***** *****.*    *

18. spacer 2.8|39129|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to KT997847 (Uncultured phage_Deep1-GF2-KM23-C739 genomic sequence) position: , mismatch: 7, identity: 0.767

agcaacagtagttacgtaagcaagtgcgat	CRISPR spacer
agcaacagtagatacgtcagcaaattattt	Protospacer
*********** ***** *****.*    *

19. spacer 2.12|39393|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 7, identity: 0.759

attctgtatcatttctgattcattgattg	CRISPR spacer
attttgtatcatttctgattcaatctgct	Protospacer
***.****************** *   . 

20. spacer 2.12|39393|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.759

attctgtatcatttctgattcattgattg	CRISPR spacer
attttgtatcatttctgattcaatctgct	Protospacer
***.****************** *   . 

21. spacer 2.13|39458|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_009931 (Acaryochloris marina MBIC11017 plasmid pREB6, complete sequence) position: , mismatch: 7, identity: 0.767

aacccgtccctgctcttcttctttgaccac	CRISPR spacer
gagctttccctgatctttttctttgaccaa	Protospacer
.* *. ****** ****.*********** 

22. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to CP003185 (Thermoanaerobacterium saccharolyticum JW/SL-YS485 plasmid pMU3262, complete genome) position: , mismatch: 7, identity: 0.759

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
aaaaatacaatagaaaatattgaaaattt	Protospacer
. *   *************** **.****

23. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_019956 (Thermoanaerobacterium thermosaccharolyticum M0795 plasmid pTHETHE01, complete sequence) position: , mismatch: 7, identity: 0.759

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
aaaaatacaatagaaaatattgaaaattt	Protospacer
. *   *************** **.****

24. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
ggccatatattcatcaatttgttcagccat	Protospacer
. .. .************.**********.

25. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to MN695335 (Synechococcus phage B23, complete genome) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
cttttcatattcatcaatttcttcaattga	Protospacer
 *****************.* ****.... 

26. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to MN695334 (Synechococcus phage B3, complete genome) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
cttttcatattcatcaatttcttcaattga	Protospacer
 *****************.* ****.... 

27. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP043762 (Paenibacillus sp. 37 plasmid pART37, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
atttccatcttcatcaatctgtttgcttcc	Protospacer
****.*** **************.. .. *

28. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_LT904880 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 3) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

29. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_KX833209 (Salmonella enterica subsp. enterica serovar Typhi strain Ty004 plasmid pTy004_01, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

30. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_LT904895 (Salmonella enterica subsp. enterica serovar Typhi strain ERL12960 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

31. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029647 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

32. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_LT904853 (Salmonella enterica subsp. enterica serovar Typhi strain TY585 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

33. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NC_003385 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

34. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
attttcattttcatcaagctgttagtgtgc	Protospacer
******** ******** ***** .  ..*

35. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
tttgtcatattcatcaaactgttcgttaaa	Protospacer
 ** ************* ******. . * 

36. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
attttcattttcatcaagctgttagtgtgc	Protospacer
******** ******** ***** .  ..*

37. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029859 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

38. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029847 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

39. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029916 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

40. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029893 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

41. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029876 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

42. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029884 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

43. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029961 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

44. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029849 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_211126 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

45. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029857 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

46. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029929 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

47. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029865 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

48. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_LT883154 (Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

49. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029905 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

50. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029851 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

51. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029889 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

52. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029891 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

53. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029898 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_213147 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

54. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029951 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_205186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

55. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029867 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

56. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029901 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

57. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NZ_CP029921 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatct-------gttcagccac	CRISPR spacer
atttccatattcatcaatctgaaaatagtt-------	Protospacer
****.***************       ***       

58. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to MK448671 (Streptococcus phage Javan115, complete genome) position: , mismatch: 8, identity: 0.733

attttcatattcatcaatctgttcagccac	CRISPR spacer
cgtaccagattcatcaatctgctcagcctt	Protospacer
  * .** *************.****** .

59. spacer 2.3|38802|29|NZ_QSQN01000025|CRISPRCasFinder,CRT matches to MN694677 (Marine virus AFVG_250M798, complete genome) position: , mismatch: 8, identity: 0.724

agaaaatatgtcaagagatgcaaagattg	CRISPR spacer
ggaaaatctgtcaagtgatgcaaacgcga	Protospacer
.****** ******* ******** .. .

60. spacer 2.9|39195|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.724

ggaggctgtggaagaatcagcgaaaaaag	CRISPR spacer
agaggccgtggaagaatccgcgaagcccc	Protospacer
.*****.*********** *****.    

61. spacer 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963405 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence) position: , mismatch: 8, identity: 0.733

gtataatttttattggaaacccgtccgcat	CRISPR spacer
ggctaatttttcttggaaagccgtcctggc	Protospacer
*  ******** ******* ******  ..

62. spacer 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985191 (Pseudomonas syringae group genomosp. 3 strain CFBP 3800 plasmid PP2, complete sequence) position: , mismatch: 8, identity: 0.733

gtataatttttattggaaacccgtccgcat	CRISPR spacer
ggctaatttttcttggaaagccgtcctggc	Protospacer
*  ******** ******* ******  ..

63. spacer 2.11|39327|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026564 (Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence) position: , mismatch: 8, identity: 0.733

gtataatttttattggaaacccgtccgcat	CRISPR spacer
ggctaatttttcttggaaagccgtcctggc	Protospacer
*  ******** ******* ******  ..

64. spacer 2.15|39589|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to AJ245616 (Lactococcus lactis phage BK5-T complete genome) position: , mismatch: 8, identity: 0.733

agcttgtatcagatgcgaatggatcggttg	CRISPR spacer
gattcttatcagatgcgcttggatcggtta	Protospacer
...*. ***********  **********.

65. spacer 2.15|39589|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to AF176025 (Lactococcus phage BK5-T, complete genome) position: , mismatch: 8, identity: 0.733

agcttgtatcagatgcgaatggatcggttg	CRISPR spacer
gattcttatcagatgcgcttggatcggtta	Protospacer
...*. ***********  **********.

66. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030222 (Salmonella enterica strain SA20021456 plasmid pSA20021456.3, complete sequence) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
cagccaacaatagaagatattcaaactca	Protospacer
  .************.********. *. 

67. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MW067001 (CrAssphage sp. C0521BW15, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

68. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK415404 (CrAssphage FA1-2_000172F, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

69. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MW067003 (CrAssphage sp. C0531BW4, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

70. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MT001829 (Salmonella phage SE_PL, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
attagtacaatagaagatattccagattt	Protospacer
..    *********.****** ******

71. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK238400 (CrAssphage ZA, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

72. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MW067000 (CrAssphage sp. C0521BD4, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

73. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK773491 (Salmonella phage 7t3, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
attagtacaatagaagatattccagattt	Protospacer
..    *********.****** ******

74. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK415403 (CrAssphage ES_ALL_000190F, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

75. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK415410 (CrAssphage YS1-2_2437, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

76. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to BK010471 (TPA_asm: Uncultured crAssphage, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatgttacaatagataatattcaagataa	Protospacer
*   . ******** ************  

77. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
attagtacaatagaagatattccagattt	Protospacer
..    *********.****** ******

78. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to MW067002 (CrAssphage sp. C0526BW15, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatattacaatagataatattcaagataa	Protospacer
*   . ******** ************  

79. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_024711 (Uncultured crAssphage, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatgttacaatagataatattcaagataa	Protospacer
*   . ******** ************  

80. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to JQ995537 (Uncultured phage crAssphage, complete genome) position: , mismatch: 8, identity: 0.724

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
gatgttacaatagataatattcaagataa	Protospacer
*   . ******** ************  

81. spacer 2.13|39458|30|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7

aacccgtccctgctcttcttctttgaccac	CRISPR spacer
ttgccgtccttgctcttcttcttttgcacg	Protospacer
   ******.************** .*   

82. spacer 2.16|39655|29|NZ_QSQN01000025|CRISPRCasFinder,CRT,PILER-CR matches to NC_004349 (Shewanella oneidensis MR-1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.69

gcaccaacaatagaaaatattcaagattt	CRISPR spacer
ttttttcaaaaagaaaatattcaagattt	Protospacer
 . ..   ** ******************

83. spacer 1.1|37888|30|NZ_QSQN01000025|CRISPRCasFinder matches to NC_049978 (IAS virus, complete genome) position: , mismatch: 10, identity: 0.667

attttcatattcatcaatctgttcagccac	CRISPR spacer
cttttcatattcatcaagctgtgttatatt	Protospacer
 **************** **** . ..  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_QSQN01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000015_1 64997-66900 TypeIII NA
26 spacers
csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6,cas1,cas2,csm6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 MK448993 Streptococcus phage Javan616, complete genome 4438-4471 7 0.794
NZ_QSQN01000015_1 1.11|65751|36|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65751-65786 36 NC_047764 Lactobacillus phage P1, complete genome 69737-69772 8 0.778
NZ_QSQN01000015_1 1.11|65751|36|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65751-65786 36 KY381600 Lactobacillus phage P2, complete genome 73309-73344 8 0.778
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NZ_CP046399 Bacillus sp. A260 plasmid unnamed11, complete sequence 138139-138172 8 0.765
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 LR721753 Aliivibrio wodanis 06/09/160 plasmid 2 complete sequence 107567-107600 8 0.765
NZ_QSQN01000015_1 1.26|66830|35|NZ_QSQN01000015|CRISPRCasFinder,CRT 66830-66864 35 NZ_CP053194 Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37d, complete sequence 5174-5208 8 0.771
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 54298-54330 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 196662-196694 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 228126-228158 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 239467-239499 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 175212-175244 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 183010-183042 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 199141-199173 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 LC554890 Ralstonia phage RP13 DNA, nearly complete genome 2342-2374 9 0.727
NZ_QSQN01000015_1 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65176-65208 33 LC554890 Ralstonia phage RP13 DNA, nearly complete genome 166984-167016 9 0.727
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NZ_CP018844 Staphylococcus epidermidis strain 14.1.R1 plasmid pHOB2, complete sequence 613-646 9 0.735
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NC_028853 Mannheimia phage vB_MhS_535AP2, complete genome 10861-10894 10 0.706
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 KP137439 Mannheimia phage vB_MhS_3927AP1, complete genome 10861-10894 10 0.706
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NC_028743 Mannheimia phage vB_MhS_587AP2, complete genome 10843-10876 10 0.706
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NC_014628 Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence 190040-190073 10 0.706
NZ_QSQN01000015_1 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT 65965-65998 34 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 62740-62773 10 0.706

1. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to MK448993 (Streptococcus phage Javan616, complete genome) position: , mismatch: 7, identity: 0.794

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
aaaaaagaaaaaaatcattgtttttgtattgaca	Protospacer
.**** ******************* ** *.*  

2. spacer 1.11|65751|36|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_047764 (Lactobacillus phage P1, complete genome) position: , mismatch: 8, identity: 0.778

cagactttataatatttatttttttga-tttgatatt	CRISPR spacer
acaactttttaaaatttatttttttgattttcatag-	Protospacer
  .***** *** ************** *** ***  

3. spacer 1.11|65751|36|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to KY381600 (Lactobacillus phage P2, complete genome) position: , mismatch: 8, identity: 0.778

cagactttataatatttatttttttga-tttgatatt	CRISPR spacer
acaactttttaaaatttatttttttgattttcatag-	Protospacer
  .***** *** ************** *** ***  

4. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046399 (Bacillus sp. A260 plasmid unnamed11, complete sequence) position: , mismatch: 8, identity: 0.765

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
ttatacaaaataaataattgtttttttagtaatt	Protospacer
  * *..*** **** **************** *

5. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to LR721753 (Aliivibrio wodanis 06/09/160 plasmid 2 complete sequence) position: , mismatch: 8, identity: 0.765

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
cattataaaaaaaatcattatttttttaaaaaat	Protospacer
 *  **.************.********. **.*

6. spacer 1.26|66830|35|NZ_QSQN01000015|CRISPRCasFinder,CRT matches to NZ_CP053194 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37d, complete sequence) position: , mismatch: 8, identity: 0.771

tagtctgggcatttgctaagctctttttcccagtt	CRISPR spacer
cagcctgggcatttgctaagttcttttttgaacta	Protospacer
.**.****************.*******.  * * 

7. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

8. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

9. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

10. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

11. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

12. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

13. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
tctaacaattcatcaaaaaataattccttggta	Protospacer
*  *.*************. *********  . 

14. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to LC554890 (Ralstonia phage RP13 DNA, nearly complete genome) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
taaagatattcatcaaaagttaataatactctt	Protospacer
*****  *****************  . .*..*

15. spacer 1.3|65176|33|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to LC554890 (Ralstonia phage RP13 DNA, nearly complete genome) position: , mismatch: 9, identity: 0.727

taaagcaattcatcaaaagttaattccttttct	CRISPR spacer
taaagatattcatcaaaagttaataatactctt	Protospacer
*****  *****************  . .*..*

16. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018844 (Staphylococcus epidermidis strain 14.1.R1 plasmid pHOB2, complete sequence) position: , mismatch: 9, identity: 0.735

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
ttatatgaaaaaaatcatgatttttttactcttt	Protospacer
  * ************** .******** *   *

17. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_028853 (Mannheimia phage vB_MhS_535AP2, complete genome) position: , mismatch: 10, identity: 0.706

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
ttttatgaaaaaaatgattgtttttgtagcttct	Protospacer
    *********** ********* ***.   *

18. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to KP137439 (Mannheimia phage vB_MhS_3927AP1, complete genome) position: , mismatch: 10, identity: 0.706

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
ttttatgaaaaaaatgattgtttttgtagcttct	Protospacer
    *********** ********* ***.   *

19. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_028743 (Mannheimia phage vB_MhS_587AP2, complete genome) position: , mismatch: 10, identity: 0.706

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
ttttatgaaaaaaatgattgtttttgtagcttct	Protospacer
    *********** ********* ***.   *

20. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NC_014628 (Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence) position: , mismatch: 10, identity: 0.706

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
tattatgaaaaaaatcaaagtttttttacctgct	Protospacer
 *  *************  ********* . . *

21. spacer 1.14|65965|34|NZ_QSQN01000015|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 10, identity: 0.706

gaaaatgaaaaaaatcattgtttttttagtaagt	CRISPR spacer
aaaaatgaaaaaaatatttgtttttaatgcttat	Protospacer
.**************  ********   *.  .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_QSQN01000027
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000027_1 27443-27536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34884 : 42712 9 Streptococcus_phage(42.86%) integrase attL 30918:30931|attR 39738:39751
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_QSQN01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QSQN01000004_1 91967-92791 TypeI NA
12 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_QSQN01000004_1 1.6|92327|35|NZ_QSQN01000004|PILER-CR,CRISPRCasFinder,CRT 92327-92361 35 NZ_QSQN01000005.1 33274-33308 2 0.943
NZ_QSQN01000004_1 1.11|92656|36|NZ_QSQN01000004|PILER-CR,CRISPRCasFinder,CRT 92656-92691 36 NZ_QSQN01000005.1 31831-31866 1 0.972

1. spacer 1.6|92327|35|NZ_QSQN01000004|PILER-CR,CRISPRCasFinder,CRT matches to position: 33274-33308, mismatch: 2, identity: 0.943

tgccatactgtcggctcaggatcggatggagtgcc	CRISPR spacer
tgccatactgtcggctcagggtcggatggagtacc	Protospacer
********************.***********.**

2. spacer 1.11|92656|36|NZ_QSQN01000004|PILER-CR,CRISPRCasFinder,CRT matches to position: 31831-31866, mismatch: 1, identity: 0.972

gatttctgatgagctgtttttccggtatctcctcac	CRISPR spacer
gatttccgatgagctgtttttccggtatctcctcac	Protospacer
******.*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage