Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_NVYQ01000092 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00092, whole genome shotgun sequence 1 crisprs NA 3 9 0 0
NZ_NVYQ01000270 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000221 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000264 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00265, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000019 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000023 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000088 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000222 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000137 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000177 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000250 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000246 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000084 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000281 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000072 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000261 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00261, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000182 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000053 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00053, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_NVYQ01000009 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000110 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000277 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000043 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000162 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000021 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000140 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00140, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NVYQ01000046 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000168 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000238 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000029 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000093 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00093, whole genome shotgun sequence 2 crisprs cas2,cas1,cas9 3 6 0 0
NZ_NVYQ01000257 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000213 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00213, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000235 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000108 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000005 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00005, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_NVYQ01000102 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000253 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000176 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000166 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000022 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000206 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000207 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000214 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000056 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000147 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000266 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000060 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000097 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000170 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000164 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000283 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000007 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000091 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000268 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000251 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00251, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000040 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000063 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000012 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000233 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000181 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000066 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000044 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000073 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000085 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000158 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000037 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000150 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000174 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000041 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000185 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00185, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_NVYQ01000059 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000194 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000111 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000055 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000034 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000198 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000195 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000220 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000209 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000069 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000205 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000227 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000002 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000123 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000120 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000112 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000284 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000244 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000285 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000001 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00001, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000149 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00149, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NVYQ01000086 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000047 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000096 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000095 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000193 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000282 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000131 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00131, whole genome shotgun sequence 2 crisprs NA 0 0 0 0
NZ_NVYQ01000104 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000249 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00249, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000061 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000146 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000218 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000048 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000232 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000119 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000114 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000226 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000231 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000025 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000167 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000081 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000262 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000054 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000031 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000049 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000243 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00243, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000127 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000050 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000113 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000236 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000115 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000175 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000188 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000045 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000258 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000105 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000252 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000163 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000024 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000152 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000089 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000109 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00109, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NVYQ01000269 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000076 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000161 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000136 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000071 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000154 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000276 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000082 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000077 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000237 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000169 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000241 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00241, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000211 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000173 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000217 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00217, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000099 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000130 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000183 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00183, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NVYQ01000272 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000267 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000032 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000125 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000141 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000234 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000156 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000011 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000094 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000070 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000215 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000138 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00138, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_NVYQ01000165 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00165, whole genome shotgun sequence 2 crisprs NA 2 0 0 0
NZ_NVYQ01000187 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000184 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000192 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000067 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000018 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000179 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000153 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000224 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000052 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000135 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000189 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000090 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000199 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000260 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000190 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000210 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000033 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000159 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000230 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000098 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000080 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000201 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000128 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000191 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000151 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000020 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000013 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000145 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000180 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000014 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000133 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000203 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000129 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000160 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000197 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000216 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000017 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000278 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000036 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000263 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000202 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000126 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000074 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000186 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000087 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000064 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000155 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000008 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000280 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000242 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000015 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000208 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000171 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000101 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000058 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000057 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000204 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000103 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000118 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000172 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000256 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000016 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000004 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000240 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000030 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000116 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000079 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000219 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000121 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000248 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000006 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000143 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000027 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000254 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000212 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000100 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000196 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000010 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000144 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000026 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000271 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00273, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000062 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000068 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000279 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000035 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000142 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000200 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000038 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000117 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000039 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000273 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000239 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00239, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000275 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000075 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000274 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000083 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000223 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000228 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000157 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00157, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NVYQ01000265 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000028 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00028, whole genome shotgun sequence 0 crisprs NA 0 0 1 3
NZ_NVYQ01000107 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000051 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000132 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000247 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00247, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000065 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00065, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_NVYQ01000245 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00245, whole genome shotgun sequence 1 crisprs NA 1 1 0 0
NZ_NVYQ01000078 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000124 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000255 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00255, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000106 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000122 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000225 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000178 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000134 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00134, whole genome shotgun sequence 1 crisprs NA 1 1 0 0
NZ_NVYQ01000229 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000259 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00259, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000042 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000139 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NVYQ01000148 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00148, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_NVYQ01000003 Neisseria meningitidis strain MRSN431200 MRSN431200_contig00003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_NVYQ01000092
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000092_1 381-1406 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000092_1 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1011-1040 30 NZ_NVYQ01000028.1 42064-42093 1 0.967
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 NZ_NVYQ01000028.1 7225-7254 0 1.0
NZ_NVYQ01000092_1 1.15|1341|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1341-1370 30 NZ_NVYQ01000028.1 38794-38823 0 1.0

1. spacer 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to position: 42064-42093, mismatch: 1, identity: 0.967

cggcgcatcccctttaatttaatatcactt	CRISPR spacer
cgccgcatcccctttaatttaatatcactt	Protospacer
** ***************************

2. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to position: 7225-7254, mismatch: 0, identity: 1.0

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagttttgttatgagtgagggca	Protospacer
******************************

3. spacer 1.15|1341|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to position: 38794-38823, mismatch: 0, identity: 1.0

ggaagagcggcatctgaatgcggaagaaga	CRISPR spacer
ggaagagcggcatctgaatgcggaagaaga	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NVYQ01000092_1 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1011-1040 30 NZ_CP024184 Moraxella osloensis strain KSH plasmid p4, complete sequence 53638-53667 6 0.8
NZ_NVYQ01000092_1 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1011-1040 30 NZ_CP024186 Moraxella osloensis strain TT16 plasmid p1, complete sequence 99596-99625 6 0.8
NZ_NVYQ01000092_1 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1011-1040 30 NZ_CP024177 Moraxella osloensis strain YHS plasmid pYHS1, complete sequence 99564-99593 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MN393473 Shigella phage Sfin-6, complete genome 18847-18876 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MF468274 Shigella phage Sfin-1, complete genome 48894-48923 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MN337573 Shigella phage Sfin-4, complete genome 21562-21591 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MK972831 Shigella phage Sfin-2, partial genome 12351-12380 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MN342247 Shigella phage Sfin-5, complete genome 12612-12641 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 NC_049831 Shigella virus Sfin-3, complete genome 13604-13633 6 0.8
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MH917278 Shigella phage phi2457T, complete genome 17595-17624 6 0.8
NZ_NVYQ01000092_1 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 549-578 30 NZ_CP004877 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence 110726-110755 7 0.767
NZ_NVYQ01000092_1 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 549-578 30 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 145342-145371 7 0.767
NZ_NVYQ01000092_1 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 549-578 30 NZ_CP007616 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence 247905-247934 7 0.767
NZ_NVYQ01000092_1 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 549-578 30 NZ_CP004860 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence 130520-130549 7 0.767
NZ_NVYQ01000092_1 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 615-644 30 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 757899-757928 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 592017-592046 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 MK494098 Gordonia phage Tredge, complete genome 20497-20526 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 NC_041950 Gordonia phage Katyusha, complete genome 20595-20624 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 KU963262 Gordonia phage Benczkowski14, complete genome 20595-20624 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 KU998243 Gordonia phage Kvothe, complete genome 20515-20544 7 0.767
NZ_NVYQ01000092_1 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 681-710 30 MH576976 Gordonia phage Teatealatte, complete genome 20497-20526 7 0.767
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 MG945497 UNVERIFIED: Microviridae sp. isolate 1636-1702, complete genome 3689-3718 7 0.767
NZ_NVYQ01000092_1 1.14|1275|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1275-1304 30 AP018321 Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome 81252-81281 7 0.767
NZ_NVYQ01000092_1 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 483-512 30 MN694055 Marine virus AFVG_250M1074, complete genome 23801-23830 8 0.733
NZ_NVYQ01000092_1 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 483-512 30 MN693799 Marine virus AFVG_250M1075, complete genome 23964-23993 8 0.733
NZ_NVYQ01000092_1 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 483-512 30 MN693650 Marine virus AFVG_250M1058, complete genome 23539-23568 8 0.733
NZ_NVYQ01000092_1 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 615-644 30 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 78900-78929 8 0.733
NZ_NVYQ01000092_1 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 615-644 30 MN693688 Marine virus AFVG_250M167, complete genome 27817-27846 8 0.733
NZ_NVYQ01000092_1 1.9|945|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 945-974 30 MN693063 Marine virus AFVG_25M261, complete genome 6946-6975 8 0.733
NZ_NVYQ01000092_1 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1011-1040 30 NZ_CP022984 Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence 96015-96044 8 0.733
NZ_NVYQ01000092_1 1.12|1143|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1143-1172 30 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 742108-742137 8 0.733
NZ_NVYQ01000092_1 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 615-644 30 MK929790 Caulobacter phage RW, complete genome 35547-35576 9 0.7
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 NZ_CP021643 Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence 34138-34167 9 0.7
NZ_NVYQ01000092_1 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT 1077-1106 30 NC_009795 Campylobacter concisus 13826 plasmid pCCON31, complete sequence 25612-25641 9 0.7

1. spacer 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024184 (Moraxella osloensis strain KSH plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8

cggcgcatcccctttaatttaatatcactt	CRISPR spacer
tagagcatcccctttaatttaatattacgg	Protospacer
..* *********************.**  

2. spacer 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024186 (Moraxella osloensis strain TT16 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

cggcgcatcccctttaatttaatatcactt	CRISPR spacer
tagagcatcccctttaatttaatattacgg	Protospacer
..* *********************.**  

3. spacer 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024177 (Moraxella osloensis strain YHS plasmid pYHS1, complete sequence) position: , mismatch: 6, identity: 0.8

cggcgcatcccctttaatttaatatcactt	CRISPR spacer
tagagcatcccctttaatttaatattacgg	Protospacer
..* *********************.**  

4. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN393473 (Shigella phage Sfin-6, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

5. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MF468274 (Shigella phage Sfin-1, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

6. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN337573 (Shigella phage Sfin-4, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

7. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MK972831 (Shigella phage Sfin-2, partial genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

8. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN342247 (Shigella phage Sfin-5, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

9. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NC_049831 (Shigella virus Sfin-3, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

10. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MH917278 (Shigella phage phi2457T, complete genome) position: , mismatch: 6, identity: 0.8

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttgtggagtttggttatgaatcaagaaa	Protospacer
************* *******.* *.*. *

11. spacer 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 7, identity: 0.767

gagcattgacactatttgtatggcgttaag	CRISPR spacer
catagttgacactatttgtatagtgttaat	Protospacer
 *  .****************.*.***** 

12. spacer 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 7, identity: 0.767

gagcattgacactatttgtatggcgttaag	CRISPR spacer
catagttgacactatttgtatagtgttaat	Protospacer
 *  .****************.*.***** 

13. spacer 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 7, identity: 0.767

gagcattgacactatttgtatggcgttaag	CRISPR spacer
catagttgacactatttgtatagtgttaat	Protospacer
 *  .****************.*.***** 

14. spacer 1.3|549|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 7, identity: 0.767

gagcattgacactatttgtatggcgttaag	CRISPR spacer
catagttgacactatttgtatagtgttaat	Protospacer
 *  .****************.*.***** 

15. spacer 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.767

agcatttgggcggcacgggcaaagccgtca	CRISPR spacer
agatgctgggcggcaagggcaaagccgtgg	Protospacer
**   .********* ************ .

16. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gccatgtgaacacgatggcgcgttccgtct	Protospacer
 ********** ** ********** .*  

17. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MK494098 (Gordonia phage Tredge, complete genome) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gcttgttgaactcgtcggcgcgctcgatga	Protospacer
 *.   *********.******.*******

18. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NC_041950 (Gordonia phage Katyusha, complete genome) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gcttgttgaactcgtcggcgcgctcgatga	Protospacer
 *.   *********.******.*******

19. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to KU963262 (Gordonia phage Benczkowski14, complete genome) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gcttgttgaactcgtcggcgcgctcgatga	Protospacer
 *.   *********.******.*******

20. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to KU998243 (Gordonia phage Kvothe, complete genome) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gcttgttgaactcgtcggcgcgctcgatga	Protospacer
 *.   *********.******.*******

21. spacer 1.5|681|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MH576976 (Gordonia phage Teatealatte, complete genome) position: , mismatch: 7, identity: 0.767

tccatgtgaactcgttggcgcgttcgatga	CRISPR spacer
gcttgttgaactcgtcggcgcgctcgatga	Protospacer
 *.   *********.******.*******

22. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MG945497 (UNVERIFIED: Microviridae sp. isolate 1636-1702, complete genome) position: , mismatch: 7, identity: 0.767

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ttttatggagtttttttatgagtgtttcta	Protospacer
****.********* *********    .*

23. spacer 1.14|1275|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to AP018321 (Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome) position: , mismatch: 7, identity: 0.767

ctgcaagcattttcatcatcggctgtcgta	CRISPR spacer
attcaagcattttcatcatctgttgtaaga	Protospacer
 * ***************** *.*** . *

24. spacer 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN694055 (Marine virus AFVG_250M1074, complete genome) position: , mismatch: 8, identity: 0.733

tcagggctatcggggctgaccggtttattg	CRISPR spacer
acagggctatcgggactggccggtcgagaa	Protospacer
 *************.***.*****. *  .

25. spacer 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN693799 (Marine virus AFVG_250M1075, complete genome) position: , mismatch: 8, identity: 0.733

tcagggctatcggggctgaccggtttattg	CRISPR spacer
acagggctatcgggactggccggtcgagaa	Protospacer
 *************.***.*****. *  .

26. spacer 1.2|483|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN693650 (Marine virus AFVG_250M1058, complete genome) position: , mismatch: 8, identity: 0.733

tcagggctatcggggctgaccggtttattg	CRISPR spacer
acagggctatcgggactggccggtcgagaa	Protospacer
 *************.***.*****. *  .

27. spacer 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 8, identity: 0.733

agcatttgggcggcacgggcaaagccgtca	CRISPR spacer
agcatttcggcggcacgggtaaaattttgc	Protospacer
******* ***********.***... *  

28. spacer 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN693688 (Marine virus AFVG_250M167, complete genome) position: , mismatch: 8, identity: 0.733

agcatttgggcggcacgggcaaagccgtca	CRISPR spacer
aggagttgggcggcacgggcaaaaaaccaa	Protospacer
** * ******************.   . *

29. spacer 1.9|945|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MN693063 (Marine virus AFVG_25M261, complete genome) position: , mismatch: 8, identity: 0.733

aaactaaaactttggaaagttggaaagttg	CRISPR spacer
gctttaaaactttagaacgttggaaaggag	Protospacer
.  .*********.*** *********  *

30. spacer 1.10|1011|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022984 (Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence) position: , mismatch: 8, identity: 0.733

cggcgcatcccctttaatttaatatcactt	CRISPR spacer
cgataatcgccctttaattgaatatcactt	Protospacer
**...  . ********** **********

31. spacer 1.12|1143|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.733

aagcattgacgatatttgtgtggcgttgca	CRISPR spacer
cagcattgacgatatttgtcaggccggggc	Protospacer
 ******************  ***   *  

32. spacer 1.4|615|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 9, identity: 0.7

agcatttgggcggcacgggcaaagccgtca	CRISPR spacer
aaggcatgggcggcacgggcaacgccgcgc	Protospacer
*. .. **************** ****.  

33. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 9, identity: 0.7

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ctttgtagagttttgttatgagaataatga	Protospacer
.*****.*************** . ..  *

34. spacer 1.11|1077|30|NZ_NVYQ01000092|PILER-CR,CRISPRCasFinder,CRT matches to NC_009795 (Campylobacter concisus 13826 plasmid pCCON31, complete sequence) position: , mismatch: 9, identity: 0.7

ttttgtggagttttgttatgagtgagggca	CRISPR spacer
ctttgtagagttttgttatgagaataatga	Protospacer
.*****.*************** . ..  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_NVYQ01000145
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_NVYQ01000138
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000138_1 26111-26286 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000209.1 1678-1722 0 1.0
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000209.1 2284-2328 1 0.978
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000210.1 278-322 0 1.0
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000210.1 352-396 0 1.0
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000210.1 976-1020 1 0.978
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000224.1 525-569 1 0.978
NZ_NVYQ01000138_1 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder 26140-26184 45 NZ_NVYQ01000240.1 12-56 1 0.978

1. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 1678-1722, mismatch: 0, identity: 1.0

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
*********************************************

2. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 2284-2328, mismatch: 1, identity: 0.978

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gattaaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
**** ****************************************

3. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 278-322, mismatch: 0, identity: 1.0

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
*********************************************

4. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 352-396, mismatch: 0, identity: 1.0

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
*********************************************

5. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 976-1020, mismatch: 1, identity: 0.978

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gattaaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
**** ****************************************

6. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 525-569, mismatch: 1, identity: 0.978

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gattaaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
**** ****************************************

7. spacer 1.1|26140|45|NZ_NVYQ01000138|CRISPRCasFinder matches to position: 12-56, mismatch: 1, identity: 0.978

gatttaagtttcaaaatttattctaaataactgaaactcaacgaa	CRISPR spacer
gattaaagtttcaaaatttattctaaataactgaaactcaacgaa	Protospacer
**** ****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_NVYQ01000005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000005_1 6581-6683 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_NVYQ01000267
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_NVYQ01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_NVYQ01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_NVYQ01000246
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_NVYQ01000147
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_NVYQ01000209
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_NVYQ01000280
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_NVYQ01000240
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_NVYQ01000214
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_NVYQ01000165
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000165_1 341-447 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000165_2 683-850 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000165_2 2.1|709|42|NZ_NVYQ01000165|CRISPRCasFinder 709-750 42 NZ_NVYQ01000145.1 1907-1948 0 1.0
NZ_NVYQ01000165_2 2.2|777|48|NZ_NVYQ01000165|CRISPRCasFinder 777-824 48 NZ_NVYQ01000049.1 451-498 1 0.979

1. spacer 2.1|709|42|NZ_NVYQ01000165|CRISPRCasFinder matches to position: 1907-1948, mismatch: 0, identity: 1.0

gtcttttataatctttgaatattgctgttgttctaaggtcta	CRISPR spacer
gtcttttataatctttgaatattgctgttgttctaaggtcta	Protospacer
******************************************

2. spacer 2.2|777|48|NZ_NVYQ01000165|CRISPRCasFinder matches to position: 451-498, mismatch: 1, identity: 0.979

tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg	CRISPR spacer
tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagccg	Protospacer
*******************************.****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_NVYQ01000093
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000093_1 30-593 TypeII NA
8 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000093_2 25196-25420 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_NVYQ01000032.1 17299-17328 0 1.0
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_NVYQ01000042.1 988-1017 0 1.0
NZ_NVYQ01000093_2 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder 25345-25394 50 NZ_NVYQ01000214.1 2121-2170 1 0.98
NZ_NVYQ01000093_2 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder 25345-25394 50 NZ_NVYQ01000246.1 234-283 0 1.0
NZ_NVYQ01000093_2 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder 25345-25394 50 NZ_NVYQ01000254.1 8-57 0 1.0

1. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to position: 17299-17328, mismatch: 0, identity: 1.0

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
tgaatcgatatcgagcctgccggcgggggc	Protospacer
******************************

2. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to position: 988-1017, mismatch: 0, identity: 1.0

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
aaaccgagttcaaccgccacgtcgaagaca	Protospacer
******************************

3. spacer 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder matches to position: 2121-2170, mismatch: 1, identity: 0.98

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatacctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
************.*************************************

4. spacer 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder matches to position: 234-283, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

5. spacer 2.3|25345|50|NZ_NVYQ01000093|CRISPRCasFinder matches to position: 8-57, mismatch: 0, identity: 1.0

tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NVYQ01000093_1 1.1|66|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 66-95 30 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 409560-409589 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013461 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S24-C21 26858-26887 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013749 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S45-C34, *** SEQUENCING IN PROGRESS *** 18574-18603 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013462 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S33-C24 35796-35825 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013743 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S34-C32, *** SEQUENCING IN PROGRESS *** 21220-21249 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP014436 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S31-C13, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces 16839-16868 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013742 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S30-C25, *** SEQUENCING IN PROGRESS *** 18964-18993 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013463 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S42-C45 3343-3372 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013747 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S43-C36, *** SEQUENCING IN PROGRESS *** 18562-18591 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013746 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S40-C25, *** SEQUENCING IN PROGRESS *** 22138-22167 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013745 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S39-C31, *** SEQUENCING IN PROGRESS *** 18838-18867 6 0.8
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 AP013748 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S44-C33, *** SEQUENCING IN PROGRESS *** 17245-17274 6 0.8
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 674133-674162 6 0.8
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 551584-551613 6 0.8
NZ_NVYQ01000093_1 1.2|132|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 132-161 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 1228533-1228562 7 0.767
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 211977-212006 7 0.767
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1001751-1001780 7 0.767
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 556502-556531 7 0.767
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1110670-1110699 7 0.767
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1477709-1477738 7 0.767
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 434475-434504 7 0.767
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1349246-1349275 7 0.767
NZ_NVYQ01000093_1 1.2|132|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 132-161 30 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 341870-341899 8 0.733
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 NZ_CP053818 Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence 26216-26245 8 0.733
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 605159-605188 8 0.733
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 425712-425741 8 0.733
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP009294 Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence 32083-32112 8 0.733
NZ_NVYQ01000093_1 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 462-491 30 NZ_CP011771 Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence 110603-110632 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 381316-381345 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1048697-1048726 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1071135-1071164 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 537429-537458 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1033988-1034017 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 11163-11192 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 478552-478581 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 333614-333643 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 38633-38662 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1251017-1251046 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 968770-968799 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 936161-936190 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 122346-122375 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1336744-1336773 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 582171-582200 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 903141-903170 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 865890-865919 8 0.733
NZ_NVYQ01000093_1 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 528-557 30 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1047036-1047065 8 0.733
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592606 Vibrio phage 1.240.O._10N.261.52.F8, partial genome 9805-9834 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592557 Vibrio phage 1.189.B._10N.286.51.B5, partial genome 9330-9359 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592559 Vibrio phage 1.189.O._10N.286.51.B5, partial genome 9329-9358 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592543 Vibrio phage 1.176.O._10N.261.55.F5, partial genome 9516-9545 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592490 Vibrio phage 1.116.O._10N.222.52.C10, partial genome 9333-9362 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592558 Vibrio phage 1.189.C._10N.286.51.B5, partial genome 9330-9359 9 0.7
NZ_NVYQ01000093_1 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 264-293 30 MG592539 Vibrio phage 1.172.O._10N.261.52.F5, partial genome 9334-9363 9 0.7
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 NZ_CP013935 Weissella cibaria strain CMS3 plasmid unnamed, complete sequence 17677-17706 9 0.7
NZ_NVYQ01000093_1 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT 330-359 30 NZ_CP013937 Weissella cibaria strain CMU plasmid unnamed1, complete sequence 15787-15816 9 0.7

1. spacer 1.1|66|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcggaa-agcctccatgctttgcagcactg	CRISPR spacer
-gcgggacagcctccatgctttgcaggtcga	Protospacer
 ****.* ******************  * .

2. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013461 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S24-C21) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

3. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013749 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S45-C34, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

4. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013462 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S33-C24) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

5. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013743 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S34-C32, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

6. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP014436 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S31-C13, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

7. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013742 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S30-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

8. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013463 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S42-C45) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

9. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013747 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S43-C36, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

10. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013746 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S40-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

11. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013745 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S39-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

12. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to AP013748 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S44-C33, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

tttttcgattttttatattgagcgtttttg	CRISPR spacer
atggttgatttattatatttagcgtttttg	Protospacer
 *  *.***** ******* **********

13. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
tgaatcgatatcgagcctgacgccgaaacc	Protospacer
******************* ** **... *

14. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 6, identity: 0.8

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
cagcggtgttcatccgccacgtcgacgaca	Protospacer
 *.* * ***** ************ ****

15. spacer 1.2|132|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 7, identity: 0.767

aatttgcgccttgctgcattgtgtagtttg	CRISPR spacer
aatttacgccttgctgaattgtgatatcta	Protospacer
*****.********** ******  .*.*.

16. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.767

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
gaaatcgatatcgagcgtgccggcggccag	Protospacer
 .************** *********  . 

17. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
gagatcgatatcgattctgccggcggggtt	Protospacer
 ..*********** .************ .

18. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.767

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcaaccgccacgtcgaagacg	Protospacer
  . *.** ********************.

19. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcaaccgccacgtcgaagacg	Protospacer
  . *.** ********************.

20. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcaaccgccacgtcgaagacg	Protospacer
  . *.** ********************.

21. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcaaccgccacgtcgaagacg	Protospacer
  . *.** ********************.

22. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.767

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcaaccgccacgtcgaagacg	Protospacer
  . *.** ********************.

23. spacer 1.2|132|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

aatttgcgccttgctgcattgtgtagtttg	CRISPR spacer
catttgcgccttgctgcttggtgtggaaca	Protospacer
 **************** * ****.*  ..

24. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053818 (Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence) position: , mismatch: 8, identity: 0.733

tttttcgattttttatattgagcgtttttg	CRISPR spacer
aaagtagattttttaaatttagcgtttttc	Protospacer
    * ********* *** ********* 

25. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
gaccatgatatcgagcgtgccggcggcggc	Protospacer
 .   .********** ********* ***

26. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.733

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
gaccatgatatcgagcgtgccggcggcggc	Protospacer
 .   .********** ********* ***

27. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 8, identity: 0.733

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
ttctatgatctcgagcctgccggcgggagt	Protospacer
*    .*** *****************.*.

28. spacer 1.7|462|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

tgaatcgatatcgagcctgccggcgggggc	CRISPR spacer
ttctatgatctcgagcctgccggcgggagt	Protospacer
*    .*** *****************.*.

29. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

30. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

31. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

32. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

33. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

34. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

35. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

36. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

37. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

38. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

39. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

40. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

41. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

42. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

43. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tgaccgcgttcaacggccacgtcgatctcg	Protospacer
 .**** ******* **********   *.

44. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

45. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

46. spacer 1.8|528|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

aaaccgagttcaaccgccacgtcgaagaca	CRISPR spacer
tcgacaagatcgaccgccacgtcgaagacg	Protospacer
  . *.** **.*****************.

47. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592606 (Vibrio phage 1.240.O._10N.261.52.F8, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

48. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592557 (Vibrio phage 1.189.B._10N.286.51.B5, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

49. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592559 (Vibrio phage 1.189.O._10N.286.51.B5, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

50. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592543 (Vibrio phage 1.176.O._10N.261.55.F5, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

51. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592490 (Vibrio phage 1.116.O._10N.222.52.C10, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

52. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592558 (Vibrio phage 1.189.C._10N.286.51.B5, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

53. spacer 1.4|264|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to MG592539 (Vibrio phage 1.172.O._10N.261.52.F5, partial genome) position: , mismatch: 9, identity: 0.7

agtcaatgaatcactaaaagccaagtcaga	CRISPR spacer
cgtcattgaatcactaaatgccaatctttg	Protospacer
 **** ************ ***** ..  .

54. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013935 (Weissella cibaria strain CMS3 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

tttttcgattttttatattgagcgtttttg	CRISPR spacer
tcagggtgttttttagattgagcgtttttt	Protospacer
*.     .******* ************* 

55. spacer 1.5|330|30|NZ_NVYQ01000093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013937 (Weissella cibaria strain CMU plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

tttttcgattttttatattgagcgtttttg	CRISPR spacer
tcagggtgttttttagattgagcgtttttt	Protospacer
*.     .******* ************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_NVYQ01000284
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_NVYQ01000065
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000065_1 6565-6669 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000065_1 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder 6598-6636 39 NZ_NVYQ01000019.1 332-370 0 1.0
NZ_NVYQ01000065_1 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder 6598-6636 39 NZ_NVYQ01000176.1 2204-2242 1 0.974
NZ_NVYQ01000065_1 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder 6598-6636 39 NZ_NVYQ01000267.1 34-72 0 1.0
NZ_NVYQ01000065_1 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder 6598-6636 39 NZ_NVYQ01000282.1 17-55 0 1.0

1. spacer 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder matches to position: 332-370, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

2. spacer 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder matches to position: 2204-2242, mismatch: 1, identity: 0.974

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcacttgttttaagtttcgggtaacttccacttc	Protospacer
*******.*******************************

3. spacer 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder matches to position: 34-72, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

4. spacer 1.1|6598|39|NZ_NVYQ01000065|CRISPRCasFinder matches to position: 17-55, mismatch: 0, identity: 1.0

cggtttcgcttgttttaagtttcgggtaacttccacttc	CRISPR spacer
cggtttcgcttgttttaagtttcgggtaacttccacttc	Protospacer
***************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_NVYQ01000224
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_NVYQ01000053
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000053_1 3578-3684 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_NVYQ01000254
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_NVYQ01000149
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 114 : 7579 11 Mannheimia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_NVYQ01000148
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000148_1 12362-12516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_NVYQ01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_NVYQ01000193
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_NVYQ01000282
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_NVYQ01000131
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000131_1 11256-11365 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000131_2 26485-26620 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
27. NZ_NVYQ01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29329 : 39513 18 Vibrio_phage(25.0%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_NVYQ01000028.1|WP_042743676.1|271_622_+|anti-CRISPR-protein-AcrIIC3 271_622_+ 116 aa aa AcrIIC3 NA NZ_NVYQ01000028.1_1031_1241_+ No NA
NZ_NVYQ01000028.1|WP_042743678.1|667_1039_+|anti-CRISPR-protein-AcrIIC2 667_1039_+ 123 aa aa NA NA NZ_NVYQ01000028.1_1031_1241_+ No NA
NZ_NVYQ01000028.1|WP_117375320.1|37709_37985_+|hypothetical-protein 37709_37985_+ 91 aa aa NA NA NA 29329-39513 yes
28. NZ_NVYQ01000210
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
29. NZ_NVYQ01000176
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
30. NZ_NVYQ01000042
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
31. NZ_NVYQ01000139
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
32. NZ_NVYQ01000245
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000245_1 268-388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_NVYQ01000139.1 560-588 0 1.0
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_NVYQ01000139.1 48-76 1 0.966
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_NVYQ01000139.1 636-664 1 0.966
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_NVYQ01000245.1 238-266 1 0.966

1. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to position: 560-588, mismatch: 0, identity: 1.0

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggtcgagggtttctg	Protospacer
*****************************

2. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to position: 48-76, mismatch: 1, identity: 0.966

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggtcgggggtttctg	Protospacer
*******************.*********

3. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to position: 636-664, mismatch: 1, identity: 0.966

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggtcgggggtttctg	Protospacer
*******************.*********

4. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to position: 238-266, mismatch: 1, identity: 0.966

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggtcgggggtttctg	Protospacer
*******************.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 337785-337813 6 0.793
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 347817-347845 6 0.793
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 624567-624595 6 0.793
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 297490-297518 6 0.793
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 305649-305677 7 0.759
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 624483-624511 7 0.759
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 861527-861555 8 0.724
NZ_NVYQ01000245_1 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder 314-342 29 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1822831-1822859 8 0.724

1. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.793

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggctgagggtgttct	Protospacer
****************..****** *.. 

2. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.793

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggccgaggaaacccg	Protospacer
****************.*****.  .*.*

3. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.793

ttcgcgggaatgacggtcgagggtttctg-----	CRISPR spacer
ttcgcgggaatgacggccgagg-----tgagtac	Protospacer
****************.*****     **     

4. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.793

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgcgaatgacggtcgaaggctgcga	Protospacer
****** *************.**.* * .

5. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.759

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
cagacgggaatgacggtcgaggctttcaa	Protospacer
.  .****************** **** .

6. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.759

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacgggcgaaggaattct	Protospacer
**************** ***.**  *.. 

7. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.724

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
ttcgcgggaatgacggccgagagaagtgc	Protospacer
****************.****.*   .  

8. spacer 1.1|314|29|NZ_NVYQ01000245|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.724

ttcgcgggaatgacggtcgagggtttctg	CRISPR spacer
gcggcgggaatgccggtcgaggatttggc	Protospacer
 . ********* *********.***   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
33. NZ_NVYQ01000134
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NVYQ01000134_1 6977-7095 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000131.1 11833-11865 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000147.1 924-956 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000165.1 831-863 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000193.1 5918-5950 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000209.1 1554-1586 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000209.1 2437-2469 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000224.1 677-709 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000240.1 165-197 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000280.1 18-50 2 0.939
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NZ_NVYQ01000284.1 80-112 2 0.939

1. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 11833-11865, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

2. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 924-956, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

3. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 831-863, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

4. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 5918-5950, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

5. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 1554-1586, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

6. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 2437-2469, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

7. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 677-709, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

8. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 165-197, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

9. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 18-50, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

10. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to position: 80-112, mismatch: 2, identity: 0.939

cgcctgcgcgggaatgacggcggtggggtttct	CRISPR spacer
cgcctgcgcgggaatgacggcggagcggtttct	Protospacer
*********************** * *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NVYQ01000134_1 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder 7020-7052 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 178343-178375 6 0.818

1. spacer 1.1|7020|33|NZ_NVYQ01000134|CRISPRCasFinder matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 6, identity: 0.818

cgcctgcgcgggaatgacggcggtggggtttct----	CRISPR spacer
cgcctgcgcgggcatgacggcggt----tttcggcac	Protospacer
************ ***********    ****     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage