| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000013 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00013, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000088 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00088, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000275 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00278, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000201 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00201, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000206 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00206, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000052 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00052, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000006 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00006, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000218 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00218, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000119 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00119, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000242 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00242, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000054 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00054, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000019 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00019, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000182 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00182, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000177 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00177, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000216 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00216, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000103 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00103, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000276 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00279, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000020 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00020, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000283 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00286, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000196 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00196, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000248 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00248, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000212 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00212, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000139 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00139, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000284 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00288, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000005 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00005, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000043 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00043, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000098 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00098, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000099 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00099, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000208 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00208, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000138 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00138, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_NVYQ01000017 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00017, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000256 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00256, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000128 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000032 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00032, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000028 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00028, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 3 | |
| NZ_NVYQ01000246 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00246, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000268 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00270, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000285 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00290, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000279 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00282, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000082 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00082, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000271 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00273, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000193 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00193, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000100 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000190 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00190, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000181 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00181, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000086 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00086, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000090 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00090, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000109 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00109, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000145 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00145, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000014 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00014, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000233 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00233, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000064 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00064, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000123 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00123, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000127 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00127, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000004 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00004, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000221 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00221, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000106 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000131 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00131, whole genome shotgun sequence | 2 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000225 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00225, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000122 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00122, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000224 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00224, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000022 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00022, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000091 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00091, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000184 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00184, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000259 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00259, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000067 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00067, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000011 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00011, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000015 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00015, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000081 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00081, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000113 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00113, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000037 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00037, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000143 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00143, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000200 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00200, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000226 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00226, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000149 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00149, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NVYQ01000161 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00161, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000146 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00146, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000060 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00060, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000240 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00240, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000191 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00191, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000121 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00121, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000170 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00170, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000111 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00111, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000278 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00281, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000231 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00231, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000041 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00041, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000102 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00102, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000262 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00262, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000024 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00024, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000112 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00112, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000129 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000046 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00046, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000199 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00199, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000179 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00179, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000150 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00150, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000117 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00117, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000026 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00026, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000204 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00204, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000130 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00130, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000153 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00153, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000050 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00050, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000148 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00148, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000241 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00241, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000101 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00101, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000211 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00211, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000072 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00072, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000047 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00047, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000070 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00070, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000155 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00155, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000210 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00210, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000272 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00274, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000207 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00207, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000012 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00012, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000076 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00076, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000092 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00092, whole genome shotgun sequence | 1 crisprs | 3 | 9 | 0 | 0 | |
| NZ_NVYQ01000074 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00074, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000273 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00276, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000118 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00118, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000053 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00053, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000031 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00031, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000158 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00158, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000238 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00238, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000089 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00089, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000209 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00209, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000140 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00140, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000097 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00097, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000065 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00065, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_NVYQ01000034 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00034, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000159 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00159, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000152 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00152, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000063 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00063, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000166 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00166, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000029 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00029, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000137 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00137, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000038 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00038, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000183 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00183, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000197 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00197, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000033 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00033, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000203 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00203, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000263 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00264, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000205 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00205, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000009 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00009, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000042 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00042, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000220 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00220, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000175 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00175, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000008 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00008, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000045 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00045, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000261 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00261, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000115 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00115, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000069 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00069, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000162 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00162, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000132 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00132, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000002 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00002, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000244 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00244, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000110 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00110, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000048 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00048, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000093 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00093, whole genome shotgun sequence | 2 crisprs | 3 | 6 | 0 | 0 | |
| NZ_NVYQ01000007 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00007, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000105 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00105, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000250 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00250, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000267 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00269, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000073 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00073, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000154 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00154, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000176 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00176, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000281 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00284, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000213 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00213, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000258 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00258, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000171 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00171, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000185 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00185, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000104 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00104, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000280 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00283, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000030 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00030, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000025 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00025, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000057 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00057, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000056 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00056, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000255 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00255, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000164 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00164, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000059 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00059, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000187 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00187, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000178 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00178, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000217 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00217, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000282 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00285, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000228 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00228, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000188 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00188, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000214 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00214, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000142 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00142, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000071 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00071, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000156 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00156, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000151 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00151, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000235 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00235, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000264 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00265, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000107 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00107, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000124 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00124, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000274 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00277, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000094 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00094, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000174 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00174, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000165 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00165, whole genome shotgun sequence | 2 crisprs | 2 | 0 | 0 | 0 | |
| NZ_NVYQ01000055 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00055, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000085 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00085, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000266 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00267, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000186 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00186, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000003 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00003, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000087 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00087, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000023 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00023, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000134 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00134, whole genome shotgun sequence | 1 crisprs | 1 | 1 | 0 | 0 | |
| NZ_NVYQ01000083 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00083, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000016 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00016, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000147 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00147, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000136 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00136, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000202 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00202, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000253 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00253, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000116 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00116, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000249 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00249, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000120 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00120, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000195 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00195, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000269 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00271, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000021 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00021, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000049 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00049, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000144 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00144, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000078 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00078, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000001 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00001, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000036 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00036, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000040 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00040, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000160 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00160, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000237 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00237, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000169 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00169, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000096 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00096, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000227 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00227, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000080 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00080, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000051 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00051, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000163 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00163, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000108 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00108, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000058 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00058, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000135 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00135, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000230 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00230, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000265 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00266, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000229 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00229, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000068 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00068, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000215 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00215, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000189 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00189, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000114 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00114, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000223 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00223, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000133 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00133, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000222 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00222, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000247 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00247, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000039 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00039, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000219 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00219, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000079 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00079, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000027 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00027, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000018 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00018, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000277 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00280, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000245 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00245, whole genome shotgun sequence | 1 crisprs | 1 | 1 | 0 | 0 | |
| NZ_NVYQ01000234 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00234, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000180 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00180, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000173 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00173, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000232 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00232, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000066 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00066, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000062 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00062, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000141 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00141, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000252 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00252, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000077 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00077, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000254 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00254, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000172 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00172, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000157 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00157, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000061 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00061, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000095 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00095, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000075 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00075, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000236 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00236, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000168 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00168, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000035 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000251 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00251, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000192 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00192, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000270 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00272, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000125 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00125, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000198 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00198, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000243 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00243, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000260 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00260, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000126 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00126, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000239 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00239, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000194 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00194, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000084 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00084, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000044 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00044, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000167 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00167, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000010 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00010, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NVYQ01000257 | Neisseria meningitidis strain MRSN431200 MRSN431200_contig00257, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000131.1 | 11833-11865 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000147.1 | 924-956 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000165.1 | 831-863 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000193.1 | 5918-5950 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000209.1 | 1554-1586 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000209.1 | 2437-2469 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000224.1 | 677-709 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000240.1 | 165-197 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000280.1 | 18-50 | 2 | 0.939 | |
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NZ_NVYQ01000284.1 | 80-112 | 2 | 0.939 |
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
cgcctgcgcgggaatgacggcggtggggtttct CRISPR spacer cgcctgcgcgggaatgacggcggagcggtttct Protospacer *********************** * *******
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000134_1 | 7020-7052 | 33 | NC_009468 | Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence | 178343-178375 | 6 | 0.818 |
cgcctgcgcgggaatgacggcggtggggtttct---- CRISPR spacer cgcctgcgcgggcatgacggcggt----tttcggcac Protospacer ************ *********** ****
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000209.1 | 1678-1722 | 0 | 1.0 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000209.1 | 2284-2328 | 1 | 0.978 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000210.1 | 278-322 | 0 | 1.0 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000210.1 | 352-396 | 0 | 1.0 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000210.1 | 976-1020 | 1 | 0.978 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000224.1 | 525-569 | 1 | 0.978 | |
| NZ_NVYQ01000138_1 | 26140-26184 | 45 | NZ_NVYQ01000240.1 | 12-56 | 1 | 0.978 |
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gatttaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer *********************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gattaaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer **** ****************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gatttaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer *********************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gatttaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer *********************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gattaaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer **** ****************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gattaaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer **** ****************************************
gatttaagtttcaaaatttattctaaataactgaaactcaacgaa CRISPR spacer gattaaagtttcaaaatttattctaaataactgaaactcaacgaa Protospacer **** ****************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000092_1 | 381-1406 | Orphan |
NA
|
15 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000092_1 | 1011-1040 | 30 | NZ_NVYQ01000028.1 | 42064-42093 | 1 | 0.967 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | NZ_NVYQ01000028.1 | 7225-7254 | 0 | 1.0 | |
| NZ_NVYQ01000092_1 | 1341-1370 | 30 | NZ_NVYQ01000028.1 | 38794-38823 | 0 | 1.0 |
cggcgcatcccctttaatttaatatcactt CRISPR spacer cgccgcatcccctttaatttaatatcactt Protospacer ** ***************************
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagttttgttatgagtgagggca Protospacer ******************************
ggaagagcggcatctgaatgcggaagaaga CRISPR spacer ggaagagcggcatctgaatgcggaagaaga Protospacer ******************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000092_1 | 1011-1040 | 30 | NZ_CP024184 | Moraxella osloensis strain KSH plasmid p4, complete sequence | 53638-53667 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1011-1040 | 30 | NZ_CP024186 | Moraxella osloensis strain TT16 plasmid p1, complete sequence | 99596-99625 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1011-1040 | 30 | NZ_CP024177 | Moraxella osloensis strain YHS plasmid pYHS1, complete sequence | 99564-99593 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MN393473 | Shigella phage Sfin-6, complete genome | 18847-18876 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MF468274 | Shigella phage Sfin-1, complete genome | 48894-48923 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MN337573 | Shigella phage Sfin-4, complete genome | 21562-21591 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MK972831 | Shigella phage Sfin-2, partial genome | 12351-12380 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MN342247 | Shigella phage Sfin-5, complete genome | 12612-12641 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | NC_049831 | Shigella virus Sfin-3, complete genome | 13604-13633 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MH917278 | Shigella phage phi2457T, complete genome | 17595-17624 | 6 | 0.8 | |
| NZ_NVYQ01000092_1 | 549-578 | 30 | NZ_CP004877 | Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence | 110726-110755 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 549-578 | 30 | NZ_CP011350 | Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence | 145342-145371 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 549-578 | 30 | NZ_CP007616 | Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence | 247905-247934 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 549-578 | 30 | NZ_CP004860 | Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence | 130520-130549 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 615-644 | 30 | NC_009620 | Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence | 757899-757928 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | NZ_CP029209 | Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence | 592017-592046 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | MK494098 | Gordonia phage Tredge, complete genome | 20497-20526 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | NC_041950 | Gordonia phage Katyusha, complete genome | 20595-20624 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | KU963262 | Gordonia phage Benczkowski14, complete genome | 20595-20624 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | KU998243 | Gordonia phage Kvothe, complete genome | 20515-20544 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 681-710 | 30 | MH576976 | Gordonia phage Teatealatte, complete genome | 20497-20526 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | MG945497 | UNVERIFIED: Microviridae sp. isolate 1636-1702, complete genome | 3689-3718 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 1275-1304 | 30 | AP018321 | Nostoc sp. HK-01 plasmid plasmid3 DNA, complete genome | 81252-81281 | 7 | 0.767 | |
| NZ_NVYQ01000092_1 | 483-512 | 30 | MN694055 | Marine virus AFVG_250M1074, complete genome | 23801-23830 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 483-512 | 30 | MN693799 | Marine virus AFVG_250M1075, complete genome | 23964-23993 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 483-512 | 30 | MN693650 | Marine virus AFVG_250M1058, complete genome | 23539-23568 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 615-644 | 30 | NZ_LN907828 | Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence | 78900-78929 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 615-644 | 30 | MN693688 | Marine virus AFVG_250M167, complete genome | 27817-27846 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 945-974 | 30 | MN693063 | Marine virus AFVG_25M261, complete genome | 6946-6975 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 1011-1040 | 30 | NZ_CP022984 | Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence | 96015-96044 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 1143-1172 | 30 | NZ_CP024200 | Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence | 742108-742137 | 8 | 0.733 | |
| NZ_NVYQ01000092_1 | 615-644 | 30 | MK929790 | Caulobacter phage RW, complete genome | 35547-35576 | 9 | 0.7 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | NZ_CP021643 | Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence | 34138-34167 | 9 | 0.7 | |
| NZ_NVYQ01000092_1 | 1077-1106 | 30 | NC_009795 | Campylobacter concisus 13826 plasmid pCCON31, complete sequence | 25612-25641 | 9 | 0.7 |
cggcgcatcccctttaatttaatatcactt CRISPR spacer tagagcatcccctttaatttaatattacgg Protospacer ..* *********************.**
cggcgcatcccctttaatttaatatcactt CRISPR spacer tagagcatcccctttaatttaatattacgg Protospacer ..* *********************.**
cggcgcatcccctttaatttaatatcactt CRISPR spacer tagagcatcccctttaatttaatattacgg Protospacer ..* *********************.**
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttgtggagtttggttatgaatcaagaaa Protospacer ************* *******.* *.*. *
gagcattgacactatttgtatggcgttaag CRISPR spacer catagttgacactatttgtatagtgttaat Protospacer * .****************.*.*****
gagcattgacactatttgtatggcgttaag CRISPR spacer catagttgacactatttgtatagtgttaat Protospacer * .****************.*.*****
gagcattgacactatttgtatggcgttaag CRISPR spacer catagttgacactatttgtatagtgttaat Protospacer * .****************.*.*****
gagcattgacactatttgtatggcgttaag CRISPR spacer catagttgacactatttgtatagtgttaat Protospacer * .****************.*.*****
agcatttgggcggcacgggcaaagccgtca CRISPR spacer agatgctgggcggcaagggcaaagccgtgg Protospacer ** .********* ************ .
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gccatgtgaacacgatggcgcgttccgtct Protospacer ********** ** ********** .*
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gcttgttgaactcgtcggcgcgctcgatga Protospacer *. *********.******.*******
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gcttgttgaactcgtcggcgcgctcgatga Protospacer *. *********.******.*******
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gcttgttgaactcgtcggcgcgctcgatga Protospacer *. *********.******.*******
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gcttgttgaactcgtcggcgcgctcgatga Protospacer *. *********.******.*******
tccatgtgaactcgttggcgcgttcgatga CRISPR spacer gcttgttgaactcgtcggcgcgctcgatga Protospacer *. *********.******.*******
ttttgtggagttttgttatgagtgagggca CRISPR spacer ttttatggagtttttttatgagtgtttcta Protospacer ****.********* ********* .*
ctgcaagcattttcatcatcggctgtcgta CRISPR spacer attcaagcattttcatcatctgttgtaaga Protospacer * ***************** *.*** . *
tcagggctatcggggctgaccggtttattg CRISPR spacer acagggctatcgggactggccggtcgagaa Protospacer *************.***.*****. * .
tcagggctatcggggctgaccggtttattg CRISPR spacer acagggctatcgggactggccggtcgagaa Protospacer *************.***.*****. * .
tcagggctatcggggctgaccggtttattg CRISPR spacer acagggctatcgggactggccggtcgagaa Protospacer *************.***.*****. * .
agcatttgggcggcacgggcaaagccgtca CRISPR spacer agcatttcggcggcacgggtaaaattttgc Protospacer ******* ***********.***... *
agcatttgggcggcacgggcaaagccgtca CRISPR spacer aggagttgggcggcacgggcaaaaaaccaa Protospacer ** * ******************. . *
aaactaaaactttggaaagttggaaagttg CRISPR spacer gctttaaaactttagaacgttggaaaggag Protospacer . .*********.*** ********* *
cggcgcatcccctttaatttaatatcactt CRISPR spacer cgataatcgccctttaattgaatatcactt Protospacer **... . ********** **********
aagcattgacgatatttgtgtggcgttgca CRISPR spacer cagcattgacgatatttgtcaggccggggc Protospacer ****************** *** *
agcatttgggcggcacgggcaaagccgtca CRISPR spacer aaggcatgggcggcacgggcaacgccgcgc Protospacer *. .. **************** ****.
ttttgtggagttttgttatgagtgagggca CRISPR spacer ctttgtagagttttgttatgagaataatga Protospacer .*****.*************** . .. *
ttttgtggagttttgttatgagtgagggca CRISPR spacer ctttgtagagttttgttatgagaataatga Protospacer .*****.*************** . .. *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 114 : 7579 | 11 | Mannheimia_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000131_1 | 11256-11365 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000131_2 | 26485-26620 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000093_1 | 30-593 | orTypeII |
NA
|
8 spacers
|
cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000093_2 | 25196-25420 | Orphan |
I-E
|
3 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_NVYQ01000032.1 | 17299-17328 | 0 | 1.0 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_NVYQ01000042.1 | 988-1017 | 0 | 1.0 | |
| NZ_NVYQ01000093_2 | 25345-25394 | 50 | NZ_NVYQ01000214.1 | 2121-2170 | 1 | 0.98 | |
| NZ_NVYQ01000093_2 | 25345-25394 | 50 | NZ_NVYQ01000246.1 | 234-283 | 0 | 1.0 | |
| NZ_NVYQ01000093_2 | 25345-25394 | 50 | NZ_NVYQ01000254.1 | 8-57 | 0 | 1.0 |
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer tgaatcgatatcgagcctgccggcgggggc Protospacer ******************************
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer aaaccgagttcaaccgccacgtcgaagaca Protospacer ******************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatacctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer ************.*************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tggaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000093_1 | 66-95 | 30 | NZ_CP022992 | Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence | 409560-409589 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013461 | Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S24-C21 | 26858-26887 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013749 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S45-C34, *** SEQUENCING IN PROGRESS *** | 18574-18603 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013462 | Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S33-C24 | 35796-35825 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013743 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S34-C32, *** SEQUENCING IN PROGRESS *** | 21220-21249 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP014436 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S31-C13, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces | 16839-16868 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013742 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S30-C25, *** SEQUENCING IN PROGRESS *** | 18964-18993 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013463 | Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C29A-MedDCM-OCT-S42-C45 | 3343-3372 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013747 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S43-C36, *** SEQUENCING IN PROGRESS *** | 18562-18591 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013746 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S40-C25, *** SEQUENCING IN PROGRESS *** | 22138-22167 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013745 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S39-C31, *** SEQUENCING IN PROGRESS *** | 18838-18867 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | AP013748 | Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C29A-MedDCM-OCT-S44-C33, *** SEQUENCING IN PROGRESS *** | 17245-17274 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP043499 | Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence | 674133-674162 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021355 | Rhodococcus sp. S2-17 plasmid pRB98, complete sequence | 551584-551613 | 6 | 0.8 | |
| NZ_NVYQ01000093_1 | 132-161 | 30 | NZ_CP022523 | Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence | 1228533-1228562 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP015739 | Shinella sp. HZN7 plasmid pShin-03, complete sequence | 211977-212006 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP012944 | Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence | 1001751-1001780 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP009145 | Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence | 556502-556531 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021827 | Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence | 1110670-1110699 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021830 | Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence | 1477709-1477738 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021824 | Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence | 434475-434504 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021805 | Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence | 1349246-1349275 | 7 | 0.767 | |
| NZ_NVYQ01000093_1 | 132-161 | 30 | NZ_CP053709 | Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence | 341870-341899 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | NZ_CP053818 | Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence | 26216-26245 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP024310 | Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence | 605159-605188 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP023064 | Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence | 425712-425741 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP009294 | Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence | 32083-32112 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 462-491 | 30 | NZ_CP011771 | Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence | 110603-110632 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_019848 | Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence | 381316-381345 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_003037 | Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence | 1048697-1048726 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP019585 | Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence | 1071135-1071164 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_017327 | Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence | 537429-537458 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021798 | Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence | 1033988-1034017 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_017324 | Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence | 11163-11192 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021801 | Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence | 478552-478581 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021819 | Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence | 333614-333643 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021813 | Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence | 38633-38662 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_018683 | Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence | 1251017-1251046 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021794 | Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence | 968770-968799 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021809 | Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence | 936161-936190 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP021217 | Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence | 122346-122375 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP026526 | Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence | 1336744-1336773 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP054032 | Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence | 582171-582200 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP019483 | Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence | 903141-903170 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NZ_CP019486 | Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence | 865890-865919 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 528-557 | 30 | NC_020527 | Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence | 1047036-1047065 | 8 | 0.733 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592606 | Vibrio phage 1.240.O._10N.261.52.F8, partial genome | 9805-9834 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592557 | Vibrio phage 1.189.B._10N.286.51.B5, partial genome | 9330-9359 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592559 | Vibrio phage 1.189.O._10N.286.51.B5, partial genome | 9329-9358 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592543 | Vibrio phage 1.176.O._10N.261.55.F5, partial genome | 9516-9545 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592490 | Vibrio phage 1.116.O._10N.222.52.C10, partial genome | 9333-9362 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592558 | Vibrio phage 1.189.C._10N.286.51.B5, partial genome | 9330-9359 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 264-293 | 30 | MG592539 | Vibrio phage 1.172.O._10N.261.52.F5, partial genome | 9334-9363 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | NZ_CP013935 | Weissella cibaria strain CMS3 plasmid unnamed, complete sequence | 17677-17706 | 9 | 0.7 | |
| NZ_NVYQ01000093_1 | 330-359 | 30 | NZ_CP013937 | Weissella cibaria strain CMU plasmid unnamed1, complete sequence | 15787-15816 | 9 | 0.7 |
tgcggaa-agcctccatgctttgcagcactg CRISPR spacer -gcgggacagcctccatgctttgcaggtcga Protospacer ****.* ****************** * .
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tttttcgattttttatattgagcgtttttg CRISPR spacer atggttgatttattatatttagcgtttttg Protospacer * *.***** ******* **********
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer tgaatcgatatcgagcctgacgccgaaacc Protospacer ******************* ** **... *
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer cagcggtgttcatccgccacgtcgacgaca Protospacer *.* * ***** ************ ****
aatttgcgccttgctgcattgtgtagtttg CRISPR spacer aatttacgccttgctgaattgtgatatcta Protospacer *****.********** ****** .*.*.
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer gaaatcgatatcgagcgtgccggcggccag Protospacer .************** ********* .
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer gagatcgatatcgattctgccggcggggtt Protospacer ..*********** .************ .
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcaaccgccacgtcgaagacg Protospacer . *.** ********************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcaaccgccacgtcgaagacg Protospacer . *.** ********************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcaaccgccacgtcgaagacg Protospacer . *.** ********************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcaaccgccacgtcgaagacg Protospacer . *.** ********************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcaaccgccacgtcgaagacg Protospacer . *.** ********************.
aatttgcgccttgctgcattgtgtagtttg CRISPR spacer catttgcgccttgctgcttggtgtggaaca Protospacer **************** * ****.* ..
tttttcgattttttatattgagcgtttttg CRISPR spacer
aaagtagattttttaaatttagcgtttttc Protospacer
* ********* *** *********
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer gaccatgatatcgagcgtgccggcggcggc Protospacer . .********** ********* ***
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer gaccatgatatcgagcgtgccggcggcggc Protospacer . .********** ********* ***
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer ttctatgatctcgagcctgccggcgggagt Protospacer * .*** *****************.*.
tgaatcgatatcgagcctgccggcgggggc CRISPR spacer ttctatgatctcgagcctgccggcgggagt Protospacer * .*** *****************.*.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tgaccgcgttcaacggccacgtcgatctcg Protospacer .**** ******* ********** *.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
aaaccgagttcaaccgccacgtcgaagaca CRISPR spacer tcgacaagatcgaccgccacgtcgaagacg Protospacer . *.** **.*****************.
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
agtcaatgaatcactaaaagccaagtcaga CRISPR spacer cgtcattgaatcactaaatgccaatctttg Protospacer **** ************ ***** .. .
tttttcgattttttatattgagcgtttttg CRISPR spacer tcagggtgttttttagattgagcgtttttt Protospacer *. .******* *************
tttttcgattttttatattgagcgtttttg CRISPR spacer tcagggtgttttttagattgagcgtttttt Protospacer *. .******* *************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000065_1 | 6598-6636 | 39 | NZ_NVYQ01000019.1 | 332-370 | 0 | 1.0 | |
| NZ_NVYQ01000065_1 | 6598-6636 | 39 | NZ_NVYQ01000176.1 | 2204-2242 | 1 | 0.974 | |
| NZ_NVYQ01000065_1 | 6598-6636 | 39 | NZ_NVYQ01000267.1 | 34-72 | 0 | 1.0 | |
| NZ_NVYQ01000065_1 | 6598-6636 | 39 | NZ_NVYQ01000282.1 | 17-55 | 0 | 1.0 |
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcacttgttttaagtttcgggtaacttccacttc Protospacer *******.*******************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
cggtttcgcttgttttaagtttcgggtaacttccacttc CRISPR spacer cggtttcgcttgttttaagtttcgggtaacttccacttc Protospacer ***************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000165_1 | 341-447 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NVYQ01000165_2 | 683-850 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000165_2 | 709-750 | 42 | NZ_NVYQ01000145.1 | 1907-1948 | 0 | 1.0 | |
| NZ_NVYQ01000165_2 | 777-824 | 48 | NZ_NVYQ01000049.1 | 451-498 | 1 | 0.979 |
gtcttttataatctttgaatattgctgttgttctaaggtcta CRISPR spacer gtcttttataatctttgaatattgctgttgttctaaggtcta Protospacer ******************************************
tttagaagttgcccgaaacctcaaaaaaaaccgaaaccgaacaagccg CRISPR spacer tttagaagttgcccgaaacctcaaaaaaaactgaaaccgaacaagccg Protospacer *******************************.****************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_NVYQ01000139.1 | 560-588 | 0 | 1.0 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_NVYQ01000139.1 | 48-76 | 1 | 0.966 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_NVYQ01000139.1 | 636-664 | 1 | 0.966 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_NVYQ01000245.1 | 238-266 | 1 | 0.966 |
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggtcgagggtttctg Protospacer *****************************
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggtcgggggtttctg Protospacer *******************.*********
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggtcgggggtttctg Protospacer *******************.*********
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggtcgggggtttctg Protospacer *******************.*********
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NVYQ01000245_1 | 314-342 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 337785-337813 | 6 | 0.793 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 347817-347845 | 6 | 0.793 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 624567-624595 | 6 | 0.793 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_CP032695 | Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence | 297490-297518 | 6 | 0.793 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_CP009292 | Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence | 305649-305677 | 7 | 0.759 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 624483-624511 | 7 | 0.759 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 861527-861555 | 8 | 0.724 | |
| NZ_NVYQ01000245_1 | 314-342 | 29 | NZ_CP017105 | Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence | 1822831-1822859 | 8 | 0.724 |
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggctgagggtgttct Protospacer ****************..****** *..
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggccgaggaaacccg Protospacer ****************.*****. .*.*
ttcgcgggaatgacggtcgagggtttctg----- CRISPR spacer ttcgcgggaatgacggccgagg-----tgagtac Protospacer ****************.***** **
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgcgaatgacggtcgaaggctgcga Protospacer ****** *************.**.* * .
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer cagacgggaatgacggtcgaggctttcaa Protospacer . .****************** **** .
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacgggcgaaggaattct Protospacer **************** ***.** *..
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer ttcgcgggaatgacggccgagagaagtgc Protospacer ****************.****.* .
ttcgcgggaatgacggtcgagggtttctg CRISPR spacer gcggcgggaatgccggtcgaggatttggc Protospacer . ********* *********.***
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 29329 : 39513 | 18 | Vibrio_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_NVYQ01000028.1_1031_1241_+ | No | NA |
| 123 aa aa | NA | NA | NZ_NVYQ01000028.1_1031_1241_+ | No | NA |
| 91 aa aa | NA | NA | NA | 29329-39513 | yes |