Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_QEJI01000085 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000111 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000153 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000046 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000054 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000128 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000102 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000156 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000171 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000151 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000008 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000201 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000092 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000003 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000179 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000121 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000055 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000015 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QEJI01000142 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000108 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000063 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000048 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000204 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000170 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000122 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000031 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000064 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000194 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000090 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_91, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_QEJI01000018 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000052 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000200 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000185 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000039 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000195 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000065 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000158 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000007 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_8, whole genome shotgun sequence 0 crisprs DinG 0 0 1 2
NZ_QEJI01000155 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000059 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000042 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000095 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000172 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000019 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_20, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_QEJI01000174 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000043 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000203 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000157 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000119 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000175 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000012 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000067 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000011 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_12, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_QEJI01000086 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000146 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000097 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000075 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000062 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000096 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_97, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000020 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_21, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QEJI01000120 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000178 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000045 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000032 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_33, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_QEJI01000161 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000183 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000010 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000060 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000127 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000100 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000134 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000186 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000114 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000036 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000189 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000030 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000071 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000035 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000037 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000006 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000187 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000147 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000002 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_3, whole genome shotgun sequence 1 crisprs WYL,PrimPol,cas9,cas1,cas2 1 8 0 0
NZ_QEJI01000192 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000124 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000057 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000001 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000083 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000115 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000098 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_99, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000061 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000181 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000148 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000129 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000049 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000073 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000159 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000130 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000132 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000005 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_6, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QEJI01000028 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000093 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000074 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000087 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000160 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000081 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000077 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000116 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000072 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000103 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000202 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000024 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000066 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000076 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000080 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000145 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000106 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000026 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000022 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000105 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000017 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000143 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000165 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000196 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000014 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_15, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QEJI01000034 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000139 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000190 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000041 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000118 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000184 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000101 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000016 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_17, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_QEJI01000173 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000021 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_22, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_QEJI01000068 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000091 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000117 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000126 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000198 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000123 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000056 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000135 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000070 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000138 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000089 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000004 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_5, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_QEJI01000112 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000009 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000110 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000177 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000038 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000069 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000107 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000051 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000167 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000027 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000162 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000191 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000154 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000166 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000197 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000136 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000029 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000104 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000180 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000176 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000141 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000047 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000168 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000163 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000099 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000137 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000058 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000188 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000149 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000193 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000140 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000079 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000084 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000169 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000023 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_QEJI01000094 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_95, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000040 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000164 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000082 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000131 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000088 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000044 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000125 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000025 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000133 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000199 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000033 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000144 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000109 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000078 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000182 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000053 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000113 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000013 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000050 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000152 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_QEJI01000150 Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_QEJI01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10688 : 32071 24 Staphylococcus_phage(95.0%) NA NA
DBSCAN-SWA_2 36189 : 43980 6 Staphylococcus_phage(100.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_QEJI01000002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QEJI01000002_1 157989-158748 NA
11 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_QEJI01000002_1 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158287-158316 30 NZ_QEJI01000007.1 157960-157989 0 1.0

1. spacer 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to position: 157960-157989, mismatch: 0, identity: 1.0

ggaaaatgtggtaatgaaggaggattttga	CRISPR spacer
ggaaaatgtggtaatgaaggaggattttga	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_QEJI01000002_1 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158287-158316 30 MK075005 Staphylococcus phage phiSP119-2, partial genome 22211-22240 0 1.0
NZ_QEJI01000002_1 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158419-158449 31 AP019561 Staphylococcus phage SP197 DNA, complete genome 4387-4417 2 0.935
NZ_QEJI01000002_1 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158419-158449 31 MK075006 Staphylococcus phage phiSP119-3, complete genome 16262-16292 2 0.935
NZ_QEJI01000002_1 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158419-158449 31 MK075004 Staphylococcus phage phiSP119-1, complete genome 16026-16056 2 0.935
NZ_QEJI01000002_1 1.11|158683|30|NZ_QEJI01000002|CRISPRCasFinder,CRT 158683-158712 30 NZ_CP031260 Klebsiella quasipneumoniae strain L22 plasmid pL22-3, complete sequence 48568-48597 3 0.9
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 KX827371 Staphylococcus phage SpT99F3, complete genome 14235-14264 4 0.867
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MT423824 Staphylococcus virus pSp_SNUABM-S, complete genome 21270-21299 4 0.867
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MT423823 Staphylococcus virus pSp_SNUABM-J, complete genome 22012-22041 4 0.867
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 KX827369 Staphylococcus phage SpT152, complete genome 14568-14597 4 0.867
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP053959 Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed2, complete sequence 674-703 5 0.833
NZ_QEJI01000002_1 1.1|158025|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158025-158053 29 MN693449 Marine virus AFVG_25M25, complete genome 24654-24682 6 0.793
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP015175 Staphylococcus aureus strain RIVM6519 plasmid pRIVM6519-2, complete sequence 1335-1364 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP033113 Staphylococcus aureus strain ST20130944 plasmid pST20130944, complete sequence 166-195 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 19260-19289 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_015173 Staphylococcus simulans bv. staphylolyticus strain NRRL B-2628 plasmid pACK2, complete sequence 28186-28215 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_005208 Staphylococcus warneri plasmid pPI-2 DNA, complete sequence 1593-1622 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 6622-6651 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP033115 Staphylococcus aureus strain ST20130945 plasmid pST20130945, complete sequence 165-194 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 38327-38356 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 38327-38356 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 43204-43233 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 43754-43783 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_025022 Staphylococcus aureus subsp. aureus strain SM52 plasmid pSM52, complete sequence 383-412 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP047823 Staphylococcus aureus strain UP_1278 plasmid unnamed1, complete sequence 2819-2848 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_007165 Staphylococcus warneri plasmid pSW174, complete sequence 1400-1429 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_007166 Staphylococcus warneri plasmid pSW49, complete sequence 1400-1429 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 53366-53395 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 35001-35030 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 41659-41688 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NC_013372 Staphylococcus epidermidis plasmid SAP016A, complete sequence 41178-41207 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP029170 Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence 178-207 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP029171 Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2d, complete sequence 178-207 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 6985-7014 6 0.8
NZ_QEJI01000002_1 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158090-158119 30 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 21771-21800 6 0.8
NZ_QEJI01000002_1 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158222-158250 29 KY744231 Sulfolobus islandicus rod-shaped virus 4, partial genome 4219-4247 6 0.793
NZ_QEJI01000002_1 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158287-158316 30 MG592459 Vibrio phage 1.084.O._10N.261.49.F5, partial genome 73193-73222 6 0.8
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MF288922 Bacillus phage Janet, complete genome 141749-141778 6 0.8
NZ_QEJI01000002_1 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158222-158250 29 MK448891 Streptococcus phage Javan266, complete genome 33103-33131 7 0.759
NZ_QEJI01000002_1 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158419-158449 31 AB797215 Klebsiella phage 0507-KN2-1 DNA, complete genome 97134-97164 7 0.774
NZ_QEJI01000002_1 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158419-158449 31 MG428990 Klebsiella phage Menlow, complete genome 31711-31741 7 0.774
NZ_QEJI01000002_1 1.9|158551|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158551-158580 30 NZ_CP026317 Vibrio campbellii strain BoB-90 plasmid unnamed 1, complete sequence 38085-38114 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN693991 Marine virus AFVG_250M861, complete genome 31401-31430 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN692996 Marine virus AFVG_117M70, complete genome 31389-31418 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN694291 Marine virus AFVG_250M864, complete genome 6916-6945 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN694613 Marine virus AFVG_250M1003, complete genome 33736-33765 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN694083 Marine virus AFVG_250M863, complete genome 6920-6949 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN693818 Marine virus AFVG_250M1205, complete genome 32048-32077 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN694793 Marine virus AFVG_250M862, complete genome 31400-31429 7 0.767
NZ_QEJI01000002_1 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR 158617-158646 30 MN693817 Marine virus AFVG_250M336, complete genome 32026-32055 7 0.767
NZ_QEJI01000002_1 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158222-158250 29 NC_008376 Geobacillus phage GBSV1, complete genome 6649-6677 8 0.724
NZ_QEJI01000002_1 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT 158222-158250 29 NC_009737 Bacillus virus 1, complete genome 6646-6674 8 0.724

1. spacer 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to MK075005 (Staphylococcus phage phiSP119-2, partial genome) position: , mismatch: 0, identity: 1.0

ggaaaatgtggtaatgaaggaggattttga	CRISPR spacer
ggaaaatgtggtaatgaaggaggattttga	Protospacer
******************************

2. spacer 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to AP019561 (Staphylococcus phage SP197 DNA, complete genome) position: , mismatch: 2, identity: 0.935

cgtcgatttcgacataatcaatcgccttatg	CRISPR spacer
cgtcgatttcgacataatcaatcgctttgtg	Protospacer
*************************.**.**

3. spacer 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MK075006 (Staphylococcus phage phiSP119-3, complete genome) position: , mismatch: 2, identity: 0.935

cgtcgatttcgacataatcaatcgccttatg	CRISPR spacer
cgtcgatttcgacataatcaatcgctttgtg	Protospacer
*************************.**.**

4. spacer 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MK075004 (Staphylococcus phage phiSP119-1, complete genome) position: , mismatch: 2, identity: 0.935

cgtcgatttcgacataatcaatcgccttatg	CRISPR spacer
cgtcgatttcgacataatcaatcgctttgtg	Protospacer
*************************.**.**

5. spacer 1.11|158683|30|NZ_QEJI01000002|CRISPRCasFinder,CRT matches to NZ_CP031260 (Klebsiella quasipneumoniae strain L22 plasmid pL22-3, complete sequence) position: , mismatch: 3, identity: 0.9

cgaaagtaaagatagtatgcaaggtgcaag	CRISPR spacer
tgaaagtaaagatagtatgaaaggcgcaag	Protospacer
.****************** ****.*****

6. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to KX827371 (Staphylococcus phage SpT99F3, complete genome) position: , mismatch: 4, identity: 0.867

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
ttctctccgtgatttcttcttctgcttcga	Protospacer
**..**.****************.******

7. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MT423824 (Staphylococcus virus pSp_SNUABM-S, complete genome) position: , mismatch: 4, identity: 0.867

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
ttctctccgtgatttcttcttctgcttcga	Protospacer
**..**.****************.******

8. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MT423823 (Staphylococcus virus pSp_SNUABM-J, complete genome) position: , mismatch: 4, identity: 0.867

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
ttctctccgtgatttcttcttctgcttcga	Protospacer
**..**.****************.******

9. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to KX827369 (Staphylococcus phage SpT152, complete genome) position: , mismatch: 4, identity: 0.867

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
ttctctccgtgatttcttcttctgcttcga	Protospacer
**..**.****************.******

10. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053959 (Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgcg	Protospacer
**.*..*****.**************.***

11. spacer 1.1|158025|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to MN693449 (Marine virus AFVG_25M25, complete genome) position: , mismatch: 6, identity: 0.793

attagaaatgttagtccctaagttacaga	CRISPR spacer
attagtaatgttagttcctaagtaatgta	Protospacer
***** *********.******* *.. *

12. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015175 (Staphylococcus aureus strain RIVM6519 plasmid pRIVM6519-2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

13. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033113 (Staphylococcus aureus strain ST20130944 plasmid pST20130944, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

14. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

15. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_015173 (Staphylococcus simulans bv. staphylolyticus strain NRRL B-2628 plasmid pACK2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgtttttgtcctgtatgtgct	Protospacer
**.*..***** **************.** 

16. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_005208 (Staphylococcus warneri plasmid pPI-2 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

17. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

18. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033115 (Staphylococcus aureus strain ST20130945 plasmid pST20130945, complete sequence) position: , mismatch: 6, identity: 0.8

-tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
atgta-aaatcgattttgtcctgtatgtgca	Protospacer
 **.* .*****.**************.**.

19. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

20. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

21. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

22. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

23. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_025022 (Staphylococcus aureus subsp. aureus strain SM52 plasmid pSM52, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtctgcgct	Protospacer
**.*..*****.*********** ***** 

24. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047823 (Staphylococcus aureus strain UP_1278 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

25. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_007165 (Staphylococcus warneri plasmid pSW174, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

26. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_007166 (Staphylococcus warneri plasmid pSW49, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

27. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

28. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

29. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

30. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_013372 (Staphylococcus epidermidis plasmid SAP016A, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

31. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029170 (Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtctgcgct	Protospacer
**.*..*****.*********** ***** 

32. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029171 (Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2d, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtctgcgct	Protospacer
**.*..*****.*********** ***** 

33. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtctgcgct	Protospacer
**.*..*****.*********** ***** 

34. spacer 1.2|158090|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 6, identity: 0.8

tgcaggaatcggttttgtcctgtatgcgcg	CRISPR spacer
tgtaaaaatcgattttgtcctgtatgtgca	Protospacer
**.*..*****.**************.**.

35. spacer 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to KY744231 (Sulfolobus islandicus rod-shaped virus 4, partial genome) position: , mismatch: 6, identity: 0.793

cattaactgctttgtcaaactcactaatt	CRISPR spacer
catttactgctttctcaaactcaaatttt	Protospacer
**** ******** *********    **

36. spacer 1.5|158287|30|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to MG592459 (Vibrio phage 1.084.O._10N.261.49.F5, partial genome) position: , mismatch: 6, identity: 0.8

ggaaaatgtggtaatgaaggaggattttga	CRISPR spacer
ggttcaggtggtgatggaggaggattttga	Protospacer
**   * *****.***.*************

37. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MF288922 (Bacillus phage Janet, complete genome) position: , mismatch: 6, identity: 0.8

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
ttatcttagtgatttcttcttctagttcac	Protospacer
** .*** **************** ***. 

38. spacer 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to MK448891 (Streptococcus phage Javan266, complete genome) position: , mismatch: 7, identity: 0.759

cattaactgctttgtcaaactcactaatt	CRISPR spacer
gtttaactgccttgtcaatctcactgaca	Protospacer
  ********.******* ******.*. 

39. spacer 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to AB797215 (Klebsiella phage 0507-KN2-1 DNA, complete genome) position: , mismatch: 7, identity: 0.774

cgtcgatttcgacataatcaatcgccttatg	CRISPR spacer
cgtcgatttcgaaattatcaatcggaacctg	Protospacer
************ ** ********   . **

40. spacer 1.7|158419|31|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MG428990 (Klebsiella phage Menlow, complete genome) position: , mismatch: 7, identity: 0.774

cgtcgatttcgacataatcaatcgccttatg	CRISPR spacer
cgtcgatttcgaaattatcaatcggaacctg	Protospacer
************ ** ********   . **

41. spacer 1.9|158551|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026317 (Vibrio campbellii strain BoB-90 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgagcctttatcatttagaacagctagagt	CRISPR spacer
tttaactttatcatttataacagcttgagc	Protospacer
*  . ************ ******* ***.

42. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN693991 (Marine virus AFVG_250M861, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

43. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN692996 (Marine virus AFVG_117M70, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

44. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN694291 (Marine virus AFVG_250M864, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

45. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN694613 (Marine virus AFVG_250M1003, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
attttttcttgatttcttcttcttcttctt	Protospacer
 **..*** ************** ****  

46. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN694083 (Marine virus AFVG_250M863, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

47. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN693818 (Marine virus AFVG_250M1205, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

48. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN694793 (Marine virus AFVG_250M862, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

49. spacer 1.10|158617|30|NZ_QEJI01000002|CRISPRCasFinder,CRT,PILER-CR matches to MN693817 (Marine virus AFVG_250M336, complete genome) position: , mismatch: 7, identity: 0.767

tttccttcgtgatttcttcttctacttcga	CRISPR spacer
cctcttcagtgatttcttcttcgacttcgg	Protospacer
..**.*. ************** ******.

50. spacer 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_008376 (Geobacillus phage GBSV1, complete genome) position: , mismatch: 8, identity: 0.724

cattaactgctttgtcaaactcactaatt	CRISPR spacer
gattaactgctttttcaaattcacaggag	Protospacer
 ************ *****.**** ..  

51. spacer 1.4|158222|29|NZ_QEJI01000002|PILER-CR,CRISPRCasFinder,CRT matches to NC_009737 (Bacillus virus 1, complete genome) position: , mismatch: 8, identity: 0.724

cattaactgctttgtcaaactcactaatt	CRISPR spacer
gattaactgctttttcaaattcacaggag	Protospacer
 ************ *****.**** ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_QEJI01000090
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_QEJI01000090_1 1-85 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_QEJI01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62570 : 70990 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_QEJI01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 139056 : 178618 57 Staphylococcus_phage(73.33%) holin,protease,portal,terminase,plate,capsid,tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_QEJI01000007.1|WP_100006909.1|139728_140076_+|hypothetical-protein 139728_140076_+ 115 aa aa AcrIIA19 NA NA 139056-178618 yes
NZ_QEJI01000007.1|WP_103866770.1|167591_167843_-|hypothetical-protein 167591_167843_- 83 aa aa NA NA NA 139056-178618 yes
6. NZ_QEJI01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 78234 : 92289 10 uncultured_Mediterranean_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage