Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_PZGO01000037 Staphylococcus simulans strain SNUC 1332 contig037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000052 Staphylococcus simulans strain SNUC 1332 contig052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000035 Staphylococcus simulans strain SNUC 1332 contig035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000003 Staphylococcus simulans strain SNUC 1332 contig003, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PZGO01000039 Staphylococcus simulans strain SNUC 1332 contig039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000023 Staphylococcus simulans strain SNUC 1332 contig023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000055 Staphylococcus simulans strain SNUC 1332 contig055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000029 Staphylococcus simulans strain SNUC 1332 contig029, whole genome shotgun sequence 1 crisprs NA 0 18 0 0
NZ_PZGO01000057 Staphylococcus simulans strain SNUC 1332 contig057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000018 Staphylococcus simulans strain SNUC 1332 contig018, whole genome shotgun sequence 0 crisprs cas14j 0 0 0 1
NZ_PZGO01000008 Staphylococcus simulans strain SNUC 1332 contig008, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PZGO01000061 Staphylococcus simulans strain SNUC 1332 contig061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000044 Staphylococcus simulans strain SNUC 1332 contig044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000041 Staphylococcus simulans strain SNUC 1332 contig041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000028 Staphylococcus simulans strain SNUC 1332 contig028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000007 Staphylococcus simulans strain SNUC 1332 contig007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000024 Staphylococcus simulans strain SNUC 1332 contig024, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_PZGO01000025 Staphylococcus simulans strain SNUC 1332 contig025, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PZGO01000022 Staphylococcus simulans strain SNUC 1332 contig022, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_PZGO01000020 Staphylococcus simulans strain SNUC 1332 contig020, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2 0 5 0 0
NZ_PZGO01000034 Staphylococcus simulans strain SNUC 1332 contig034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000038 Staphylococcus simulans strain SNUC 1332 contig038, whole genome shotgun sequence 0 crisprs cas2,cas1,cas9 0 0 0 0
NZ_PZGO01000047 Staphylococcus simulans strain SNUC 1332 contig047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000062 Staphylococcus simulans strain SNUC 1332 contig062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000066 Staphylococcus simulans strain SNUC 1332 contig066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000002 Staphylococcus simulans strain SNUC 1332 contig002, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_PZGO01000042 Staphylococcus simulans strain SNUC 1332 contig042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000026 Staphylococcus simulans strain SNUC 1332 contig026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000063 Staphylococcus simulans strain SNUC 1332 contig063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000060 Staphylococcus simulans strain SNUC 1332 contig060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000051 Staphylococcus simulans strain SNUC 1332 contig051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000054 Staphylococcus simulans strain SNUC 1332 contig054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000046 Staphylococcus simulans strain SNUC 1332 contig046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000012 Staphylococcus simulans strain SNUC 1332 contig012, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_PZGO01000027 Staphylococcus simulans strain SNUC 1332 contig027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000069 Staphylococcus simulans strain SNUC 1332 contig069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000067 Staphylococcus simulans strain SNUC 1332 contig067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000006 Staphylococcus simulans strain SNUC 1332 contig006, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PZGO01000065 Staphylococcus simulans strain SNUC 1332 contig065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000030 Staphylococcus simulans strain SNUC 1332 contig030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000010 Staphylococcus simulans strain SNUC 1332 contig010, whole genome shotgun sequence 0 crisprs cas3 0 0 2 0
NZ_PZGO01000005 Staphylococcus simulans strain SNUC 1332 contig005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000017 Staphylococcus simulans strain SNUC 1332 contig017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000050 Staphylococcus simulans strain SNUC 1332 contig050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000009 Staphylococcus simulans strain SNUC 1332 contig009, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_PZGO01000056 Staphylococcus simulans strain SNUC 1332 contig056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000013 Staphylococcus simulans strain SNUC 1332 contig013, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_PZGO01000016 Staphylococcus simulans strain SNUC 1332 contig016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000068 Staphylococcus simulans strain SNUC 1332 contig068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000064 Staphylococcus simulans strain SNUC 1332 contig064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000001 Staphylococcus simulans strain SNUC 1332 contig001, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_PZGO01000040 Staphylococcus simulans strain SNUC 1332 contig040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000049 Staphylococcus simulans strain SNUC 1332 contig049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000014 Staphylococcus simulans strain SNUC 1332 contig014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000059 Staphylococcus simulans strain SNUC 1332 contig059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000015 Staphylococcus simulans strain SNUC 1332 contig015, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_PZGO01000019 Staphylococcus simulans strain SNUC 1332 contig019, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PZGO01000021 Staphylococcus simulans strain SNUC 1332 contig021, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_PZGO01000004 Staphylococcus simulans strain SNUC 1332 contig004, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_PZGO01000053 Staphylococcus simulans strain SNUC 1332 contig053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000058 Staphylococcus simulans strain SNUC 1332 contig058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000036 Staphylococcus simulans strain SNUC 1332 contig036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000070 Staphylococcus simulans strain SNUC 1332 contig070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000011 Staphylococcus simulans strain SNUC 1332 contig011, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_PZGO01000048 Staphylococcus simulans strain SNUC 1332 contig048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000045 Staphylococcus simulans strain SNUC 1332 contig045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000031 Staphylococcus simulans strain SNUC 1332 contig031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000043 Staphylococcus simulans strain SNUC 1332 contig043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000033 Staphylococcus simulans strain SNUC 1332 contig033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PZGO01000032 Staphylococcus simulans strain SNUC 1332 contig032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_PZGO01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13362 19 Staphylococcus_phage(35.71%) head,capsid,protease,tail,terminase,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_PZGO01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 70427 : 100894 28 Bacillus_virus(25.0%) holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_PZGO01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_PZGO01000020_1 16567-17261 TypeII NA
10 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 MN693595 Marine virus AFVG_25M384, complete genome 22984-23013 6 0.8
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP045855 Agrobacterium sp. MA01 plasmid punnamed1, complete sequence 63502-63531 6 0.8
NZ_PZGO01000020_1 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16603-16633 31 NC_017021 Rickettsia amblyommatis str. GAT-30V plasmid pMCE_3, complete sequence 12016-12046 7 0.774
NZ_PZGO01000020_1 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16603-16633 31 NZ_CP012422 Rickettsia amblyommatis strain Ac37 plasmid pRAMAC23, complete sequence 5321-5351 7 0.774
NZ_PZGO01000020_1 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16603-16633 31 NC_013937 Candidatus Rickettsia amblyommii AaR/SC plasmid pRAM23, complete sequence 5321-5351 7 0.774
NZ_PZGO01000020_1 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16603-16633 31 NZ_CP015015 Rickettsia amblyommatis isolate An13 plasmid unnamed_1, complete sequence 10944-10974 7 0.774
NZ_PZGO01000020_1 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16603-16633 31 MN434092 Klebsiella phage AmPh_EK29, complete genome 117436-117466 7 0.774
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 MK359332 Streptomyces phage Genie2, complete genome 53466-53495 7 0.767
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 MK359351 Streptomyces phage BoomerJR, complete genome 53352-53381 7 0.767
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 MH727564 Streptomyces phage Yaboi, complete genome 53443-53472 7 0.767
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 AP013388 Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-C54-MedDCM-OCT-S36-C37 36698-36727 7 0.767
NZ_PZGO01000020_1 1.3|16736|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16736-16765 30 NZ_CP023734 Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence 36534-36563 8 0.733
NZ_PZGO01000020_1 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16999-17028 30 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 231242-231271 8 0.733
NZ_PZGO01000020_1 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16999-17028 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1391044-1391073 8 0.733
NZ_PZGO01000020_1 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16999-17028 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1201794-1201823 8 0.733
NZ_PZGO01000020_1 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16999-17028 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 885542-885571 8 0.733
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 299736-299765 8 0.733
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 547084-547113 8 0.733
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 MN693083 Marine virus AFVG_25M55, complete genome 22884-22913 8 0.733
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 MN698240 Pelagibacter phage HTVC026P, complete genome 19229-19258 9 0.7
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 AP014442 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S26-C72, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces 27848-27877 9 0.7
NZ_PZGO01000020_1 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT 16802-16831 30 AP013761 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S46-C247, *** SEQUENCING IN PROGRESS *** 764-793 9 0.7
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP017764 Bacillus subtilis strain 29R7-12 plasmid unnamed1, complete sequence 3392-3421 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP032868 Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence 63468-63497 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP032864 Bacillus subtilis subsp. subtilis strain N2-2 plasmid unnamed1, complete sequence 12857-12886 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP032866 Bacillus subtilis subsp. subtilis strain N3-1 plasmid unnamed1, complete sequence 61706-61735 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP021893 Bacillus subtilis subsp. subtilis strain SRCM100333 plasmid pBS333 sequence 36543-36572 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP041370 Bacillus sp. M4U3P1 plasmid unnamed1, complete sequence 23094-23123 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP020024 Bacillus subtilis strain ATCC 21228 plasmid pLDW-15, complete sequence 50305-50334 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP032862 Bacillus subtilis subsp. subtilis strain N1-1 plasmid unnamed1, complete sequence 31925-31954 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP018185 Bacillus subtilis strain KH2 plasmid, complete sequence 30729-30758 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NC_015148 Bacillus subtilis subsp. natto plasmid pLS20 DNA, complete sequence, strain: IFO 3335 24963-24992 10 0.667
NZ_PZGO01000020_1 1.10|17196|30|NZ_PZGO01000020|CRT 17196-17225 30 NZ_CP014473 Bacillus subtilis subsp. natto strain CGMCC 2108 plasmid unnamed2, complete sequence 24963-24992 10 0.667

1. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MN693595 (Marine virus AFVG_25M384, complete genome) position: , mismatch: 6, identity: 0.8

aaacctaattcttttctgtactcatcagct	CRISPR spacer
gaacctaattcttttcttaactcattaatt	Protospacer
.****************  ******.*..*

2. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP045855 (Agrobacterium sp. MA01 plasmid punnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
gttggcccaaacggaactggaactgcacct	Protospacer
..*..****** ****** ***********

3. spacer 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NC_017021 (Rickettsia amblyommatis str. GAT-30V plasmid pMCE_3, complete sequence) position: , mismatch: 7, identity: 0.774

ggtgatcatgctgaatatgtaaaacaatata	CRISPR spacer
gatcctgatgctgaatatataaaaaaatatt	Protospacer
*.*  * ***********.***** ***** 

4. spacer 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012422 (Rickettsia amblyommatis strain Ac37 plasmid pRAMAC23, complete sequence) position: , mismatch: 7, identity: 0.774

ggtgatcatgctgaatatgtaaaacaatata	CRISPR spacer
gatcctgatgctgaatatataaaaaaatatt	Protospacer
*.*  * ***********.***** ***** 

5. spacer 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NC_013937 (Candidatus Rickettsia amblyommii AaR/SC plasmid pRAM23, complete sequence) position: , mismatch: 7, identity: 0.774

ggtgatcatgctgaatatgtaaaacaatata	CRISPR spacer
gatcctgatgctgaatatataaaaaaatatt	Protospacer
*.*  * ***********.***** ***** 

6. spacer 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015015 (Rickettsia amblyommatis isolate An13 plasmid unnamed_1, complete sequence) position: , mismatch: 7, identity: 0.774

ggtgatcatgctgaatatgtaaaacaatata	CRISPR spacer
gatcctgatgctgaatatataaaaaaatatt	Protospacer
*.*  * ***********.***** ***** 

7. spacer 1.1|16603|31|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MN434092 (Klebsiella phage AmPh_EK29, complete genome) position: , mismatch: 7, identity: 0.774

ggtgatcatgctgaatatgtaaaacaatata-	CRISPR spacer
attgatgatgctgaatatgaaaaac-gtatga	Protospacer
. **** ************ ***** .***. 

8. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MK359332 (Streptomyces phage Genie2, complete genome) position: , mismatch: 7, identity: 0.767

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tagaataattcttttctctactgatcagcc	Protospacer
 *.  ************ **** ******.

9. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MK359351 (Streptomyces phage BoomerJR, complete genome) position: , mismatch: 7, identity: 0.767

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tagaataattcttttctctactgatcagcc	Protospacer
 *.  ************ **** ******.

10. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MH727564 (Streptomyces phage Yaboi, complete genome) position: , mismatch: 7, identity: 0.767

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tagaataattcttttctctactgatcagcc	Protospacer
 *.  ************ **** ******.

11. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to AP013388 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-C54-MedDCM-OCT-S36-C37) position: , mismatch: 7, identity: 0.767

aaacctaattcttttctgtactcatcagct	CRISPR spacer
aaacctaattcttttctatacggctgtact	Protospacer
*****************.***   *  .**

12. spacer 1.3|16736|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023734 (Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence) position: , mismatch: 8, identity: 0.733

ttatggcgttttgtgaaacagtgccgaatg	CRISPR spacer
tattattaatttgtgatacagtgccgaatg	Protospacer
*  *. .. ******* *************

13. spacer 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 8, identity: 0.733

ttttctatttgccgctgcccttttcttatc	CRISPR spacer
acgactatttgccgcggcccttttccgttc	Protospacer
 .  *********** *********.  **

14. spacer 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.733

ttttctatttgccgctgcccttttcttatc	CRISPR spacer
gcactttttttcctctgcccttttcttatc	Protospacer
 . ..* *** ** ****************

15. spacer 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

ttttctatttgccgctgcccttttcttatc	CRISPR spacer
tccctctttttcctctgcccttttcttatc	Protospacer
*..... *** ** ****************

16. spacer 1.7|16999|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

ttttctatttgccgctgcccttttcttatc	CRISPR spacer
tccctctttttcctctgcccttttcttatc	Protospacer
*..... *** ** ****************

17. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
cggaacccaaaagcaacttgaattgctgtt	Protospacer
   ********** ********.***  .*

18. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
cggaacccaaaagcaacttgaattgctgtt	Protospacer
   ********** ********.***  .*

19. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to MN693083 (Marine virus AFVG_25M55, complete genome) position: , mismatch: 8, identity: 0.733

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
actaacccaaaagcaccttgaacaaagttt	Protospacer
************* * ******* . ...*

20. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to MN698240 (Pelagibacter phage HTVC026P, complete genome) position: , mismatch: 9, identity: 0.7

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tcttctaattcttttctatactcatttatt	Protospacer
   .*************.*******. ..*

21. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to AP014442 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S26-C72, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 9, identity: 0.7

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tcttctaattcttttctatactcatttatt	Protospacer
   .*************.*******. ..*

22. spacer 1.4|16802|30|NZ_PZGO01000020|PILER-CR,CRISPRCasFinder,CRT matches to AP013761 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S46-C247, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7

aaacctaattcttttctgtactcatcagct	CRISPR spacer
tcttctaattcttttctatactcatttatt	Protospacer
   .*************.*******. ..*

23. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP017764 (Bacillus subtilis strain 29R7-12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

24. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP032868 (Bacillus subtilis subsp. subtilis strain N4-2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

25. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP032864 (Bacillus subtilis subsp. subtilis strain N2-2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

26. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP032866 (Bacillus subtilis subsp. subtilis strain N3-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

27. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP021893 (Bacillus subtilis subsp. subtilis strain SRCM100333 plasmid pBS333 sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

28. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP041370 (Bacillus sp. M4U3P1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

29. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP020024 (Bacillus subtilis strain ATCC 21228 plasmid pLDW-15, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

30. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP032862 (Bacillus subtilis subsp. subtilis strain N1-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

31. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP018185 (Bacillus subtilis strain KH2 plasmid, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

32. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NC_015148 (Bacillus subtilis subsp. natto plasmid pLS20 DNA, complete sequence, strain: IFO 3335) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

33. spacer 1.10|17196|30|NZ_PZGO01000020|CRT matches to NZ_CP014473 (Bacillus subtilis subsp. natto strain CGMCC 2108 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

actaacccaaaaggaacttgaactgcacct	CRISPR spacer
ggctacccaagaggaacttgaactgtttga	Protospacer
. . ******.**************. .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_PZGO01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42162 : 76531 35 Staphylococcus_phage(89.66%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_PZGO01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34445 : 42867 9 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_PZGO01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29353 : 42787 20 Staphylococcus_phage(58.82%) terminase,head,integrase attL 31279:31296|attR 43566:43583
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_PZGO01000029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_PZGO01000029_1 15737-16752 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_PZGO01000029_1 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 15903-15931 29 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 206055-206083 3 0.897
NZ_PZGO01000029_1 1.18|15905|29|NZ_PZGO01000029|PILER-CR 15905-15933 29 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 206055-206083 3 0.897
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_KM348008 Bacillus pumilus strain 15.1 plasmid pBp15.1S, complete sequence 2599-2627 4 0.862
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_KM348008 Bacillus pumilus strain 15.1 plasmid pBp15.1S, complete sequence 2599-2627 4 0.862
NZ_PZGO01000029_1 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 15903-15931 29 AP014215 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C87-MedDCM-OCT-S44-C129, *** SEQUENCING IN PROGRESS *** 13156-13184 5 0.828
NZ_PZGO01000029_1 1.6|16098|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16098-16126 29 NZ_CP009121 Staphylococcus pseudintermedius strain 5912 plasmid pSP5912, complete sequence 2201-2229 5 0.828
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KF669663 Bacillus phage Staley, complete genome 9557-9586 5 0.833
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_022774 Bacillus phage Slash, complete genome 9748-9777 5 0.833
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KP696447 Bacillus phage Stahl, complete genome 9236-9265 5 0.833
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP013709 Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence 46331-46359 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NC_021496 Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence 14780-14808 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 92416-92444 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 79715-79743 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP047288 Proteus cibarius strain G11 plasmid p152, complete sequence 69127-69155 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053372 Proteus cibarius strain G32 plasmid pG32-177, complete sequence 64382-64410 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053043 Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence 102225-102253 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 MG516911 Proteus mirabilis plasmid pPm60, complete sequence 50065-50093 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP047114 Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence 39404-39432 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 82946-82974 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 109636-109664 5 0.828
NZ_PZGO01000029_1 1.18|15905|29|NZ_PZGO01000029|PILER-CR 15905-15933 29 AP014215 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C87-MedDCM-OCT-S44-C129, *** SEQUENCING IN PROGRESS *** 13156-13184 5 0.828
NZ_PZGO01000029_1 1.21|16100|29|NZ_PZGO01000029|PILER-CR 16100-16128 29 NZ_CP009121 Staphylococcus pseudintermedius strain 5912 plasmid pSP5912, complete sequence 2201-2229 5 0.828
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KF669663 Bacillus phage Staley, complete genome 9557-9586 5 0.833
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_022774 Bacillus phage Slash, complete genome 9748-9777 5 0.833
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KP696447 Bacillus phage Stahl, complete genome 9236-9265 5 0.833
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP013709 Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence 46331-46359 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NC_021496 Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence 14780-14808 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 92416-92444 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 79715-79743 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP047288 Proteus cibarius strain G11 plasmid p152, complete sequence 69127-69155 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053372 Proteus cibarius strain G32 plasmid pG32-177, complete sequence 64382-64410 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053043 Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence 102225-102253 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 MG516911 Proteus mirabilis plasmid pPm60, complete sequence 50065-50093 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP047114 Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence 39404-39432 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 82946-82974 5 0.828
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 109636-109664 5 0.828
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 CP016281 Clostridium tyrobutyricum strain W428 plasmid pW428, complete sequence 15738-15766 6 0.793
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP014171 Clostridium tyrobutyricum strain KCTC 5387 plasmid pCTK01, complete sequence 21003-21031 6 0.793
NZ_PZGO01000029_1 1.14|16622|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16622-16651 30 MN694177 Marine virus AFVG_250M361, complete genome 37138-37167 6 0.8
NZ_PZGO01000029_1 1.14|16622|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16622-16651 30 MN694376 Marine virus AFVG_250M360, complete genome 1914-1943 6 0.8
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 CP016281 Clostridium tyrobutyricum strain W428 plasmid pW428, complete sequence 15738-15766 6 0.793
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP014171 Clostridium tyrobutyricum strain KCTC 5387 plasmid pCTK01, complete sequence 21003-21031 6 0.793
NZ_PZGO01000029_1 1.29|16624|30|NZ_PZGO01000029|PILER-CR 16624-16653 30 MN694177 Marine virus AFVG_250M361, complete genome 37138-37167 6 0.8
NZ_PZGO01000029_1 1.29|16624|30|NZ_PZGO01000029|PILER-CR 16624-16653 30 MN694376 Marine virus AFVG_250M360, complete genome 1914-1943 6 0.8
NZ_PZGO01000029_1 1.1|15773|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 15773-15801 29 NZ_LN774770 Lactococcus piscium MKFS47 plasmid II, complete sequence 47770-47798 7 0.759
NZ_PZGO01000029_1 1.7|16163|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16163-16191 29 NZ_AP017915 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1 13818-13846 7 0.759
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554775 Lactococcus phage AM11, complete genome 108801-108830 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554773 Lactococcus phage AM8, complete genome 108816-108845 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554768 Lactococcus phage AM1, complete genome 108297-108326 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554769 Lactococcus phage AM2, complete genome 108294-108323 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554772 Lactococcus phage AM5, complete genome 110748-110777 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_021795 Cellulophaga phage phi17:1, complete genome 15205-15234 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554770 Lactococcus phage AM3, complete genome 108671-108700 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 HM029250 Lactococcus phage 949, complete genome 97401-97430 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554777 Lactococcus phage LW81, complete genome 110853-110882 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_049856 Lactococcus phage AM4, complete genome 92793-92822 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554776 Lactococcus phage AM12, complete genome 108051-108080 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KX119192 Helicobacter phage Pt1918U, complete genome 13647-13676 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_027341 Lactococcus phage WRP3, complete genome 112688-112717 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KF926093 Lactococcus phage phiL47, complete genome 111264-111293 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 KY554774 Lactococcus phage AM9, complete genome 107932-107961 7 0.767
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_049857 Lactococcus phage P1048, complete genome 105626-105655 7 0.767
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP053309 Spiroplasma citri strain C5 plasmid pScpC5-5, complete sequence 251-279 7 0.759
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NC_021795 Cellulophaga phage phi17:1, complete genome 3978-4006 7 0.759
NZ_PZGO01000029_1 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16688-16716 29 NC_014841 Pantoea sp. At-9b plasmid pPAT9B04, complete sequence 35538-35566 7 0.759
NZ_PZGO01000029_1 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16688-16716 29 AP014117 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S25-C108, *** SEQUENCING IN PROGRESS *** 2493-2521 7 0.759
NZ_PZGO01000029_1 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16688-16716 29 MK250016 Prevotella phage Lak-A1, complete genome 257107-257135 7 0.759
NZ_PZGO01000029_1 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16688-16716 29 MK250019 Prevotella phage Lak-A2, complete genome 178241-178269 7 0.759
NZ_PZGO01000029_1 1.16|15775|29|NZ_PZGO01000029|PILER-CR 15775-15803 29 NZ_LN774770 Lactococcus piscium MKFS47 plasmid II, complete sequence 47770-47798 7 0.759
NZ_PZGO01000029_1 1.22|16165|29|NZ_PZGO01000029|PILER-CR 16165-16193 29 NZ_AP017915 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1 13818-13846 7 0.759
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554775 Lactococcus phage AM11, complete genome 108801-108830 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554773 Lactococcus phage AM8, complete genome 108816-108845 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554768 Lactococcus phage AM1, complete genome 108297-108326 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554769 Lactococcus phage AM2, complete genome 108294-108323 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554772 Lactococcus phage AM5, complete genome 110748-110777 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_021795 Cellulophaga phage phi17:1, complete genome 15205-15234 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554770 Lactococcus phage AM3, complete genome 108671-108700 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 HM029250 Lactococcus phage 949, complete genome 97401-97430 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554777 Lactococcus phage LW81, complete genome 110853-110882 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_049856 Lactococcus phage AM4, complete genome 92793-92822 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554776 Lactococcus phage AM12, complete genome 108051-108080 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KX119192 Helicobacter phage Pt1918U, complete genome 13647-13676 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_027341 Lactococcus phage WRP3, complete genome 112688-112717 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KF926093 Lactococcus phage phiL47, complete genome 111264-111293 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 KY554774 Lactococcus phage AM9, complete genome 107932-107961 7 0.767
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_049857 Lactococcus phage P1048, complete genome 105626-105655 7 0.767
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP053309 Spiroplasma citri strain C5 plasmid pScpC5-5, complete sequence 251-279 7 0.759
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NC_021795 Cellulophaga phage phi17:1, complete genome 3978-4006 7 0.759
NZ_PZGO01000029_1 1.30|16690|29|NZ_PZGO01000029|PILER-CR 16690-16718 29 NC_014841 Pantoea sp. At-9b plasmid pPAT9B04, complete sequence 35538-35566 7 0.759
NZ_PZGO01000029_1 1.30|16690|29|NZ_PZGO01000029|PILER-CR 16690-16718 29 AP014117 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S25-C108, *** SEQUENCING IN PROGRESS *** 2493-2521 7 0.759
NZ_PZGO01000029_1 1.30|16690|29|NZ_PZGO01000029|PILER-CR 16690-16718 29 MK250016 Prevotella phage Lak-A1, complete genome 257107-257135 7 0.759
NZ_PZGO01000029_1 1.30|16690|29|NZ_PZGO01000029|PILER-CR 16690-16718 29 MK250019 Prevotella phage Lak-A2, complete genome 178241-178269 7 0.759
NZ_PZGO01000029_1 1.2|15838|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 15838-15866 29 NC_019555 Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence 14385-14413 8 0.724
NZ_PZGO01000029_1 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 15903-15931 29 MN693107 Marine virus AFVG_25M445, complete genome 18067-18095 8 0.724
NZ_PZGO01000029_1 1.6|16098|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16098-16126 29 NZ_CP041427 Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence 66920-66948 8 0.724
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP018901 Campylobacter coli strain YH502 plasmid pCOS502, complete sequence 87573-87602 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP015328 Bacillus filamentosus strain Hbe603 plasmid pBEH6, complete sequence 949-978 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 75198-75227 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 77815-77844 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 83129-83158 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 85750-85779 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP044176 Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence 56277-56306 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP025282 Campylobacter coli strain YH503 plasmid pCOS503, complete sequence 73017-73046 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 MN694186 Marine virus AFVG_250M615, complete genome 7673-7702 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NC_003276 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence 218660-218689 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 NZ_CP015251 Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence 143266-143295 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 MT375524 Pelagibacter phage Gjalp EXVC02, partial genome 18288-18317 8 0.733
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 MT375523 Pelagibacter phage Eyrgjafa EXV, complete genome 8473-8502 8 0.733
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NC_019736 Crinalium epipsammum PCC 9333 plasmid pCRI9333.05, complete sequence 21549-21577 8 0.724
NZ_PZGO01000029_1 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT 16557-16585 29 NZ_CP044980 Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence 186874-186902 8 0.724
NZ_PZGO01000029_1 1.17|15840|29|NZ_PZGO01000029|PILER-CR 15840-15868 29 NC_019555 Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence 14385-14413 8 0.724
NZ_PZGO01000029_1 1.18|15905|29|NZ_PZGO01000029|PILER-CR 15905-15933 29 MN693107 Marine virus AFVG_25M445, complete genome 18067-18095 8 0.724
NZ_PZGO01000029_1 1.21|16100|29|NZ_PZGO01000029|PILER-CR 16100-16128 29 NZ_CP041427 Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence 66920-66948 8 0.724
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP018901 Campylobacter coli strain YH502 plasmid pCOS502, complete sequence 87573-87602 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP015328 Bacillus filamentosus strain Hbe603 plasmid pBEH6, complete sequence 949-978 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 75198-75227 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 77815-77844 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 83129-83158 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 85750-85779 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP044176 Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence 56277-56306 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP025282 Campylobacter coli strain YH503 plasmid pCOS503, complete sequence 73017-73046 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 MN694186 Marine virus AFVG_250M615, complete genome 7673-7702 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NC_003276 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence 218660-218689 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 NZ_CP015251 Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence 143266-143295 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 MT375524 Pelagibacter phage Gjalp EXVC02, partial genome 18288-18317 8 0.733
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 MT375523 Pelagibacter phage Eyrgjafa EXV, complete genome 8473-8502 8 0.733
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NC_019736 Crinalium epipsammum PCC 9333 plasmid pCRI9333.05, complete sequence 21549-21577 8 0.724
NZ_PZGO01000029_1 1.28|16559|29|NZ_PZGO01000029|PILER-CR 16559-16587 29 NZ_CP044980 Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence 186874-186902 8 0.724
NZ_PZGO01000029_1 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT 16425-16454 30 MW042802 Klebsiella phage 066039, complete genome 27192-27221 9 0.7
NZ_PZGO01000029_1 1.26|16427|30|NZ_PZGO01000029|PILER-CR 16427-16456 30 MW042802 Klebsiella phage 066039, complete genome 27192-27221 9 0.7

1. spacer 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.897

--ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
gtttaat--accaccaaagattgctaatgca	Protospacer
  *****  ********* ************

2. spacer 1.18|15905|29|NZ_PZGO01000029|PILER-CR matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.897

--ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
gtttaat--accaccaaagattgctaatgca	Protospacer
  *****  ********* ************

3. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_KM348008 (Bacillus pumilus strain 15.1 plasmid pBp15.1S, complete sequence) position: , mismatch: 4, identity: 0.862

tttttctgcccttttttataatttaattg	CRISPR spacer
gttttctgcccttttttatagttttatta	Protospacer
 *******************.*** ***.

4. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_KM348008 (Bacillus pumilus strain 15.1 plasmid pBp15.1S, complete sequence) position: , mismatch: 4, identity: 0.862

tttttctgcccttttttataatttaattg	CRISPR spacer
gttttctgcccttttttatagttttatta	Protospacer
 *******************.*** ***.

5. spacer 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to AP014215 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C87-MedDCM-OCT-S44-C129, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.828

ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
ataatgaaccaccaaacattcctaaaata	Protospacer
 ******************* **** ..*

6. spacer 1.6|16098|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP009121 (Staphylococcus pseudintermedius strain 5912 plasmid pSP5912, complete sequence) position: , mismatch: 5, identity: 0.828

gatgtgtgcgtggagaaaagcacgtaaag	CRISPR spacer
tgtttgtgcgtggcgtaaagcacgtaaag	Protospacer
 .* ********* * *************

7. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KF669663 (Bacillus phage Staley, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

8. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_022774 (Bacillus phage Slash, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

9. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KP696447 (Bacillus phage Stahl, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

10. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP013709 (Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
attttctgctcttttttattatttaaatc	Protospacer
 ********.********* ****** * 

11. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_021496 (Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
cttttgtgcccctttttataatttaacgg	Protospacer
.**** *****.**************. *

12. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
attttctgctcttttttattatttaaatc	Protospacer
 ********.********* ****** * 

13. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

14. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP047288 (Proteus cibarius strain G11 plasmid p152, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

15. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053372 (Proteus cibarius strain G32 plasmid pG32-177, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

16. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053043 (Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

17. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

18. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP047114 (Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

19. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

20. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

21. spacer 1.18|15905|29|NZ_PZGO01000029|PILER-CR matches to AP014215 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C87-MedDCM-OCT-S44-C129, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.828

ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
ataatgaaccaccaaacattcctaaaata	Protospacer
 ******************* **** ..*

22. spacer 1.21|16100|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP009121 (Staphylococcus pseudintermedius strain 5912 plasmid pSP5912, complete sequence) position: , mismatch: 5, identity: 0.828

gatgtgtgcgtggagaaaagcacgtaaag	CRISPR spacer
tgtttgtgcgtggcgtaaagcacgtaaag	Protospacer
 .* ********* * *************

23. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KF669663 (Bacillus phage Staley, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

24. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_022774 (Bacillus phage Slash, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

25. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KP696447 (Bacillus phage Stahl, complete genome) position: , mismatch: 5, identity: 0.833

--tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cttaatg--tttcacctttaattcttgctttt	Protospacer
  *.***  **** ***************** 

26. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP013709 (Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
attttctgctcttttttattatttaaatc	Protospacer
 ********.********* ****** * 

27. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NC_021496 (Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
cttttgtgcccctttttataatttaacgg	Protospacer
.**** *****.**************. *

28. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
attttctgctcttttttattatttaaatc	Protospacer
 ********.********* ****** * 

29. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

30. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP047288 (Proteus cibarius strain G11 plasmid p152, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

31. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053372 (Proteus cibarius strain G32 plasmid pG32-177, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

32. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053043 (Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

33. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

34. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP047114 (Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

35. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

36. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 5, identity: 0.828

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctttccttttttataattttcttc	Protospacer
******* .***************  ** 

37. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to CP016281 (Clostridium tyrobutyricum strain W428 plasmid pW428, complete sequence) position: , mismatch: 6, identity: 0.793

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctgccctttttaataaccatatag	Protospacer
**************** ****..  ** *

38. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP014171 (Clostridium tyrobutyricum strain KCTC 5387 plasmid pCTK01, complete sequence) position: , mismatch: 6, identity: 0.793

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctgccctttttaataaccatatag	Protospacer
**************** ****..  ** *

39. spacer 1.14|16622|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MN694177 (Marine virus AFVG_250M361, complete genome) position: , mismatch: 6, identity: 0.8

ctgatgtttcgtcattgcttgtcttgctgc	CRISPR spacer
ataatttttcgtcatggcttgtcttgtttc	Protospacer
 *.** ********* **********.* *

40. spacer 1.14|16622|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MN694376 (Marine virus AFVG_250M360, complete genome) position: , mismatch: 6, identity: 0.8

ctgatgtttcgtcattgcttgtcttgctgc	CRISPR spacer
ataatttttcgtcatggcttgtcttgtttc	Protospacer
 *.** ********* **********.* *

41. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to CP016281 (Clostridium tyrobutyricum strain W428 plasmid pW428, complete sequence) position: , mismatch: 6, identity: 0.793

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctgccctttttaataaccatatag	Protospacer
**************** ****..  ** *

42. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP014171 (Clostridium tyrobutyricum strain KCTC 5387 plasmid pCTK01, complete sequence) position: , mismatch: 6, identity: 0.793

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttctgccctttttaataaccatatag	Protospacer
**************** ****..  ** *

43. spacer 1.29|16624|30|NZ_PZGO01000029|PILER-CR matches to MN694177 (Marine virus AFVG_250M361, complete genome) position: , mismatch: 6, identity: 0.8

ctgatgtttcgtcattgcttgtcttgctgc	CRISPR spacer
ataatttttcgtcatggcttgtcttgtttc	Protospacer
 *.** ********* **********.* *

44. spacer 1.29|16624|30|NZ_PZGO01000029|PILER-CR matches to MN694376 (Marine virus AFVG_250M360, complete genome) position: , mismatch: 6, identity: 0.8

ctgatgtttcgtcattgcttgtcttgctgc	CRISPR spacer
ataatttttcgtcatggcttgtcttgtttc	Protospacer
 *.** ********* **********.* *

45. spacer 1.1|15773|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_LN774770 (Lactococcus piscium MKFS47 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.759

tttaagagcatgtagctatgatttggata	CRISPR spacer
tttaagagcatgttgttatgattgccttg	Protospacer
************* *.*******    *.

46. spacer 1.7|16163|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_AP017915 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 7, identity: 0.759

acgatagttattaaacgatagttattaaa	CRISPR spacer
agattagttattaaatgatatttattatt	Protospacer
* . ***********.**** ******  

47. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554775 (Lactococcus phage AM11, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

48. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554773 (Lactococcus phage AM8, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

49. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554768 (Lactococcus phage AM1, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

50. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554769 (Lactococcus phage AM2, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

51. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554772 (Lactococcus phage AM5, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

52. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 7, identity: 0.767

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ttaggtttttttcttttaattcttgctgct	Protospacer
* * ******.**.************* . 

53. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554770 (Lactococcus phage AM3, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

54. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to HM029250 (Lactococcus phage 949, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

55. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554777 (Lactococcus phage LW81, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

56. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_049856 (Lactococcus phage AM4, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

57. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554776 (Lactococcus phage AM12, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

58. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KX119192 (Helicobacter phage Pt1918U, complete genome) position: , mismatch: 7, identity: 0.767

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cgttaattttatcctttagttcttgctttt	Protospacer
.* *. **** *******.********** 

59. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_027341 (Lactococcus phage WRP3, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

60. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KF926093 (Lactococcus phage phiL47, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttaa	Protospacer
    ***    ***************** *** .

61. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to KY554774 (Lactococcus phage AM9, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

62. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_049857 (Lactococcus phage P1048, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

63. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP053309 (Spiroplasma citri strain C5 plasmid pScpC5-5, complete sequence) position: , mismatch: 7, identity: 0.759

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttatgccgttttttataattttcaaa	Protospacer
***** **** *************    .

64. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 7, identity: 0.759

tttttctgcccttttttataatttaattg	CRISPR spacer
cttttttgcccttttttataatagtacgg	Protospacer
.****.****************   *. *

65. spacer 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_014841 (Pantoea sp. At-9b plasmid pPAT9B04, complete sequence) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
gtaatcgtcgttttatgatttttttattg	Protospacer
 *************** **** ** * ..

66. spacer 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to AP014117 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S25-C108, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
ataataatcgttttattatttattttgaa	Protospacer
 **** .*****************  . *

67. spacer 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
atcaaattcgtttcattatttattaaact	Protospacer
 * *   ******.************** 

68. spacer 1.15|16688|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
atcaaattcgtttcattatttattaaact	Protospacer
 * *   ******.************** 

69. spacer 1.16|15775|29|NZ_PZGO01000029|PILER-CR matches to NZ_LN774770 (Lactococcus piscium MKFS47 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.759

tttaagagcatgtagctatgatttggata	CRISPR spacer
tttaagagcatgttgttatgattgccttg	Protospacer
************* *.*******    *.

70. spacer 1.22|16165|29|NZ_PZGO01000029|PILER-CR matches to NZ_AP017915 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ1 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 7, identity: 0.759

acgatagttattaaacgatagttattaaa	CRISPR spacer
agattagttattaaatgatatttattatt	Protospacer
* . ***********.**** ******  

71. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554775 (Lactococcus phage AM11, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

72. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554773 (Lactococcus phage AM8, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

73. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554768 (Lactococcus phage AM1, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

74. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554769 (Lactococcus phage AM2, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

75. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554772 (Lactococcus phage AM5, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

76. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 7, identity: 0.767

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ttaggtttttttcttttaattcttgctgct	Protospacer
* * ******.**.************* . 

77. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554770 (Lactococcus phage AM3, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

78. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to HM029250 (Lactococcus phage 949, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

79. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554777 (Lactococcus phage LW81, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

80. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_049856 (Lactococcus phage AM4, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

81. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554776 (Lactococcus phage AM12, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

82. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KX119192 (Helicobacter phage Pt1918U, complete genome) position: , mismatch: 7, identity: 0.767

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cgttaattttatcctttagttcttgctttt	Protospacer
.* *. **** *******.********** 

83. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_027341 (Lactococcus phage WRP3, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

84. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KF926093 (Lactococcus phage phiL47, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttaa	Protospacer
    ***    ***************** *** .

85. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to KY554774 (Lactococcus phage AM9, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

86. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_049857 (Lactococcus phage P1048, complete genome) position: , mismatch: 7, identity: 0.767

----tgatgtttttctcctttaattcttgctttg	CRISPR spacer
aaagtga----tttctcctttaattctttcttat	Protospacer
    ***    ***************** ***  

87. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP053309 (Spiroplasma citri strain C5 plasmid pScpC5-5, complete sequence) position: , mismatch: 7, identity: 0.759

tttttctgcccttttttataatttaattg	CRISPR spacer
tttttatgccgttttttataattttcaaa	Protospacer
***** **** *************    .

88. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 7, identity: 0.759

tttttctgcccttttttataatttaattg	CRISPR spacer
cttttttgcccttttttataatagtacgg	Protospacer
.****.****************   *. *

89. spacer 1.30|16690|29|NZ_PZGO01000029|PILER-CR matches to NC_014841 (Pantoea sp. At-9b plasmid pPAT9B04, complete sequence) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
gtaatcgtcgttttatgatttttttattg	Protospacer
 *************** **** ** * ..

90. spacer 1.30|16690|29|NZ_PZGO01000029|PILER-CR matches to AP014117 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C36-MedDCM-OCT-S25-C108, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
ataataatcgttttattatttattttgaa	Protospacer
 **** .*****************  . *

91. spacer 1.30|16690|29|NZ_PZGO01000029|PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
atcaaattcgtttcattatttattaaact	Protospacer
 * *   ******.************** 

92. spacer 1.30|16690|29|NZ_PZGO01000029|PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.759

ttaatcgtcgttttattatttattaaaca	CRISPR spacer
atcaaattcgtttcattatttattaaact	Protospacer
 * *   ******.************** 

93. spacer 1.2|15838|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_019555 (Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence) position: , mismatch: 8, identity: 0.724

tgcggtcgtcaacgcatggtttttttgcg	CRISPR spacer
cttccacgtcaacgcatggattttttgct	Protospacer
. .   ************* ******** 

94. spacer 1.3|15903|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MN693107 (Marine virus AFVG_25M445, complete genome) position: , mismatch: 8, identity: 0.724

ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
cttgaacgccaccaaaaattgctaatgca	Protospacer
.* . . .******** ************

95. spacer 1.6|16098|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP041427 (Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence) position: , mismatch: 8, identity: 0.724

gatgtgtgcgtggagaaaagcacgtaaag	CRISPR spacer
accgtctgcgtggagaaaaccacgtatta	Protospacer
. .** ************* ******  .

96. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

97. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP015328 (Bacillus filamentosus strain Hbe603 plasmid pBEH6, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ttcccgattgctcctttaattcttgcttta	Protospacer
*  .   ** *******************.

98. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

99. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

100. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

101. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

102. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cacttattttcttctttaattcttgcttat	Protospacer
.. *  ******.***************  

103. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

104. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MN694186 (Marine virus AFVG_250M615, complete genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
gttaattttactactttaattcttgctttt	Protospacer
    .**** ** **************** 

105. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ctggatatttctcttttaagtcttgctttg	Protospacer
. . .* ******.***** **********

106. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
acttgtttttttcctttaattctttccatt	Protospacer
   *******.************* *. * 

107. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MT375524 (Pelagibacter phage Gjalp EXVC02, partial genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
agatgtttttctcttttagttctttttcaa	Protospacer
 ************.****.***** .*. .

108. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MT375523 (Pelagibacter phage Eyrgjafa EXV, complete genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
agatgtttttctcttttagttctttttcaa	Protospacer
 ************.****.***** .*. .

109. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NC_019736 (Crinalium epipsammum PCC 9333 plasmid pCRI9333.05, complete sequence) position: , mismatch: 8, identity: 0.724

tttttctgcccttttttataatttaattg	CRISPR spacer
agattttgccctattttataatttaaagt	Protospacer
   **.****** *************   

110. spacer 1.13|16557|29|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to NZ_CP044980 (Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence) position: , mismatch: 8, identity: 0.724

tttttctgcccttttttataatttaattg	CRISPR spacer
aacatctgcccctttttataatttacata	Protospacer
  . *******.*************  *.

111. spacer 1.17|15840|29|NZ_PZGO01000029|PILER-CR matches to NC_019555 (Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence) position: , mismatch: 8, identity: 0.724

tgcggtcgtcaacgcatggtttttttgcg	CRISPR spacer
cttccacgtcaacgcatggattttttgct	Protospacer
. .   ************* ******** 

112. spacer 1.18|15905|29|NZ_PZGO01000029|PILER-CR matches to MN693107 (Marine virus AFVG_25M445, complete genome) position: , mismatch: 8, identity: 0.724

ttaatgaaccaccaaacattgctaatgca	CRISPR spacer
cttgaacgccaccaaaaattgctaatgca	Protospacer
.* . . .******** ************

113. spacer 1.21|16100|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP041427 (Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence) position: , mismatch: 8, identity: 0.724

gatgtgtgcgtggagaaaagcacgtaaag	CRISPR spacer
accgtctgcgtggagaaaaccacgtatta	Protospacer
. .** ************* ******  .

114. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

115. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP015328 (Bacillus filamentosus strain Hbe603 plasmid pBEH6, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ttcccgattgctcctttaattcttgcttta	Protospacer
*  .   ** *******************.

116. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

117. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

118. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

119. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

120. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cacttattttcttctttaattcttgcttat	Protospacer
.. *  ******.***************  

121. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
tacctattttcttctttaattcttgcttat	Protospacer
*. .  ******.***************  

122. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to MN694186 (Marine virus AFVG_250M615, complete genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
gttaattttactactttaattcttgctttt	Protospacer
    .**** ** **************** 

123. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
ctggatatttctcttttaagtcttgctttg	Protospacer
. . .* ******.***** **********

124. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
acttgtttttttcctttaattctttccatt	Protospacer
   *******.************* *. * 

125. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to MT375524 (Pelagibacter phage Gjalp EXVC02, partial genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
agatgtttttctcttttagttctttttcaa	Protospacer
 ************.****.***** .*. .

126. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to MT375523 (Pelagibacter phage Eyrgjafa EXV, complete genome) position: , mismatch: 8, identity: 0.733

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
agatgtttttctcttttagttctttttcaa	Protospacer
 ************.****.***** .*. .

127. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NC_019736 (Crinalium epipsammum PCC 9333 plasmid pCRI9333.05, complete sequence) position: , mismatch: 8, identity: 0.724

tttttctgcccttttttataatttaattg	CRISPR spacer
agattttgccctattttataatttaaagt	Protospacer
   **.****** *************   

128. spacer 1.28|16559|29|NZ_PZGO01000029|PILER-CR matches to NZ_CP044980 (Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence) position: , mismatch: 8, identity: 0.724

tttttctgcccttttttataatttaattg	CRISPR spacer
aacatctgcccctttttataatttacata	Protospacer
  . *******.*************  *.

129. spacer 1.11|16425|30|NZ_PZGO01000029|CRISPRCasFinder,CRT matches to MW042802 (Klebsiella phage 066039, complete genome) position: , mismatch: 9, identity: 0.7

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cataccttttcccctttaattctggctttc	Protospacer
..   .*****.*********** ***** 

130. spacer 1.26|16427|30|NZ_PZGO01000029|PILER-CR matches to MW042802 (Klebsiella phage 066039, complete genome) position: , mismatch: 9, identity: 0.7

tgatgtttttctcctttaattcttgctttg	CRISPR spacer
cataccttttcccctttaattctggctttc	Protospacer
..   .*****.*********** ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_PZGO01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10164 : 54128 70 Staphylococcus_phage(38.98%) tRNA,holin,head,terminase,capsid,integrase,portal,tail attL 10975:10997|attR 52077:52099
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_PZGO01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_PZGO01000018.1|WP_107591702.1|50790_51165_+|hypothetical-protein 50790_51165_+ 124 aa aa AcrIIA19 NA NA No NA
10. NZ_PZGO01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62475 : 79460 13 uncultured_Caudovirales_phage(36.36%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_PZGO01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22528 : 32602 7 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_2 83159 : 91178 7 Klosneuvirus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage