Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_PEPN01000013 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_48_length_369_cov_106.812_ID_95, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000069 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_3_length_292777_cov_81.008_ID_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000050 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_35_length_1290_cov_162.697_ID_69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000032 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_45_length_478_cov_91.1395_ID_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000034 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_49_length_365_cov_45.9677_ID_97, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000037 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_29_length_2595_cov_96.3004_ID_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000030 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_69_length_228_cov_224.861_ID_137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000038 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_51_length_358_cov_124.462_ID_101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000058 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_27_length_2902_cov_54.1528_ID_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000054 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_24_length_7418_cov_84.6875_ID_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000063 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_9_length_104226_cov_75.1018_ID_17, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PEPN01000027 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_8_length_105182_cov_86.8541_ID_15, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_PEPN01000062 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_32_length_1695_cov_442.408_ID_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000025 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_76_length_215_cov_249.025_ID_151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000024 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_47_length_378_cov_280.693_ID_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000046 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_6_length_163911_cov_76.1438_ID_11, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_PEPN01000020 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_46_length_402_cov_255.579_ID_91, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000018 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_72_length_220_cov_535.552_ID_143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000048 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_40_length_657_cov_199.542_ID_79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000006 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_61_length_279_cov_179.732_ID_121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000015 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_33_length_1435_cov_218.464_ID_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000019 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_21_length_14008_cov_108.671_ID_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000049 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_65_length_244_cov_128.397_ID_129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000016 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_13_length_71144_cov_85.0901_ID_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000060 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_7_length_125415_cov_70.5697_ID_13, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_PEPN01000004 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_43_length_557_cov_75.4821_ID_85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000068 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_31_length_2163_cov_7085.01_ID_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000071 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_20_length_16907_cov_51.1436_ID_39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000064 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_64_length_255_cov_309.29_ID_127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000044 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_37_length_814_cov_36.0119_ID_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000047 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_42_length_564_cov_140.151_ID_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000042 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_25_length_3396_cov_436.74_ID_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000057 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_12_length_84477_cov_72.144_ID_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000010 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_53_length_349_cov_236.724_ID_105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000023 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_2_length_304544_cov_75.7265_ID_3, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_PEPN01000055 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_17_length_40131_cov_82.2252_ID_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000045 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_54_length_325_cov_8290.41_ID_107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000012 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_18_length_38423_cov_78.3835_ID_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000070 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_19_length_17578_cov_76.7817_ID_37, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PEPN01000036 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_38_length_794_cov_69.9811_ID_75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000007 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_4_length_192499_cov_78.2941_ID_7, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_PEPN01000035 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_23_length_7990_cov_70.4772_ID_45, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_PEPN01000061 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_71_length_220_cov_46.7939_ID_141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000008 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_62_length_274_cov_303.155_ID_123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000021 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_26_length_2926_cov_229.879_ID_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000011 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_58_length_295_cov_755.479_ID_115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000053 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_5_length_169506_cov_85.467_ID_9, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_PEPN01000051 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_68_length_234_cov_274.425_ID_135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000017 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_50_length_364_cov_218.013_ID_99, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000040 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_30_length_2543_cov_68.1234_ID_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000005 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_15_length_61154_cov_84.436_ID_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000033 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_52_length_352_cov_78.0875_ID_103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000028 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_28_length_2776_cov_4202.4_ID_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000065 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_60_length_292_cov_226.654_ID_119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000026 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_14_length_63887_cov_73.9175_ID_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000001 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_66_length_244_cov_247.693_ID_131, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_PEPN01000066 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_57_length_303_cov_176.952_ID_113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000052 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_44_length_528_cov_167.304_ID_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000022 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_41_length_604_cov_701.82_ID_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000067 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_22_length_9613_cov_73.2993_ID_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000041 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_63_length_274_cov_320.215_ID_125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000059 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_10_length_94108_cov_80.1758_ID_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000039 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_34_length_1405_cov_62.1193_ID_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000031 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_55_length_314_cov_214.687_ID_109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000014 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_36_length_824_cov_400.43_ID_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000056 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_56_length_304_cov_6045.83_ID_111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000003 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_16_length_46232_cov_67.3039_ID_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000029 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_67_length_241_cov_439.14_ID_133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000002 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_39_length_723_cov_165.434_ID_77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_PEPN01000043 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_11_length_86733_cov_73.8899_ID_21, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_PEPN01000009 Staphylococcus pseudintermedius strain 2120306040011 212030604001-1_1_length_483052_cov_73.2381_ID_1, whole genome shotgun sequence 0 crisprs cas3,DEDDh,csa3,DinG 0 0 1 1

Results visualization

1. NZ_PEPN01000050
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_PEPN01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 147486 : 159919 7 Liberibacter_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_PEPN01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_PEPN01000001_1 91-203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_PEPN01000001_1 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder 120-174 55 NZ_PEPN01000050.1 1119-1173 0 1.0
NZ_PEPN01000001_1 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder 120-174 55 NZ_PEPN01000020.1 231-285 0 1.0
NZ_PEPN01000001_1 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder 120-174 55 NZ_PEPN01000031.1 190-244 0 1.0

1. spacer 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder matches to position: 1119-1173, mismatch: 0, identity: 1.0

cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	CRISPR spacer
cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	Protospacer
*******************************************************

2. spacer 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder matches to position: 231-285, mismatch: 0, identity: 1.0

cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	CRISPR spacer
cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	Protospacer
*******************************************************

3. spacer 1.1|120|55|NZ_PEPN01000001|CRISPRCasFinder matches to position: 190-244, mismatch: 0, identity: 1.0

cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	CRISPR spacer
cagcacatcagtttcattaagcaaatcgacaagcacgtcaacaagtgactcagac	Protospacer
*******************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_PEPN01000070
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71 : 17035 20 Staphylococcus_phage(100.0%) tail,holin,head,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_PEPN01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1100 : 25579 47 Staphylococcus_phage(95.45%) integrase,portal,terminase attL 15419:15433|attR 23397:23411
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_PEPN01000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 382 : 6332 8 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_PEPN01000063
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51955 : 60375 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_PEPN01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15014 : 32537 20 Streptococcus_phage(100.0%) integrase attL 13975:14003|attR 39004:39032
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_PEPN01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 427110 : 469009 57 Staphylococcus_phage(71.74%) protease,tail,terminase,plate,integrase,portal,capsid,holin attL 458744:458760|attR 468374:468390
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_PEPN01000009.1|WP_100006909.1|427781_428129_+|hypothetical-protein 427781_428129_+ 115 aa aa AcrIIA19 NA NA 427110-469009 NA
10. NZ_PEPN01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_PEPN01000046
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 78739 : 92794 10 uncultured_Mediterranean_phage(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_PEPN01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11228 : 32625 24 Staphylococcus_phage(95.0%) NA NA
DBSCAN-SWA_2 36743 : 44535 6 Staphylococcus_phage(100.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_PEPN01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage