Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MWUW01000015 Staphylococcus delphini strain 214092504301-1 NODE_15_length_41013_cov_105.598_ID_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000004 Staphylococcus delphini strain 214092504301-1 NODE_4_length_232048_cov_90.8293_ID_7, whole genome shotgun sequence 0 crisprs cas3,DEDDh,csa3 0 0 1 0
NZ_MWUW01000040 Staphylococcus delphini strain 214092504301-1 NODE_212_length_348_cov_80.8914_ID_423, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000010 Staphylococcus delphini strain 214092504301-1 NODE_10_length_110105_cov_103.717_ID_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000008 Staphylococcus delphini strain 214092504301-1 NODE_8_length_153907_cov_97.2157_ID_15, whole genome shotgun sequence 1 crisprs cas2,cas9,WYL 0 8 0 0
NZ_MWUW01000007 Staphylococcus delphini strain 214092504301-1 NODE_7_length_215749_cov_105.287_ID_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000036 Staphylococcus delphini strain 214092504301-1 NODE_208_length_396_cov_100.32_ID_415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000033 Staphylococcus delphini strain 214092504301-1 NODE_47_length_571_cov_201.786_ID_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000006 Staphylococcus delphini strain 214092504301-1 NODE_6_length_229728_cov_85.8656_ID_11, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MWUW01000043 Staphylococcus delphini strain 214092504301-1 NODE_215_length_224_cov_200.371_ID_429, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000003 Staphylococcus delphini strain 214092504301-1 NODE_3_length_236951_cov_101.282_ID_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000032 Staphylococcus delphini strain 214092504301-1 NODE_45_length_584_cov_169.969_ID_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000021 Staphylococcus delphini strain 214092504301-1 NODE_21_length_8803_cov_134.004_ID_41, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MWUW01000014 Staphylococcus delphini strain 214092504301-1 NODE_14_length_44146_cov_103.235_ID_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000028 Staphylococcus delphini strain 214092504301-1 NODE_29_length_1626_cov_95.0634_ID_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000025 Staphylococcus delphini strain 214092504301-1 NODE_26_length_2952_cov_486.327_ID_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000037 Staphylococcus delphini strain 214092504301-1 NODE_209_length_374_cov_680.854_ID_417, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000009 Staphylococcus delphini strain 214092504301-1 NODE_9_length_118492_cov_94.8603_ID_17, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MWUW01000005 Staphylococcus delphini strain 214092504301-1 NODE_5_length_229939_cov_98.2809_ID_9, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_MWUW01000013 Staphylococcus delphini strain 214092504301-1 NODE_13_length_48571_cov_102.604_ID_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000039 Staphylococcus delphini strain 214092504301-1 NODE_211_length_366_cov_85.4393_ID_421, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000034 Staphylococcus delphini strain 214092504301-1 NODE_153_length_454_cov_71.5872_ID_305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000044 Staphylococcus delphini strain 214092504301-1 NODE_216_length_217_cov_97.4444_ID_431, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000031 Staphylococcus delphini strain 214092504301-1 NODE_37_length_717_cov_209.414_ID_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000042 Staphylococcus delphini strain 214092504301-1 NODE_214_length_224_cov_78.732_ID_427, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000038 Staphylococcus delphini strain 214092504301-1 NODE_210_length_366_cov_69.2636_ID_419, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000002 Staphylococcus delphini strain 214092504301-1 NODE_2_length_274319_cov_103.811_ID_3, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_MWUW01000045 Staphylococcus delphini strain 214092504301-1 NODE_217_length_206_cov_177.646_ID_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000029 Staphylococcus delphini strain 214092504301-1 NODE_30_length_1290_cov_546.854_ID_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000024 Staphylococcus delphini strain 214092504301-1 NODE_24_length_6624_cov_58.7791_ID_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000001 Staphylococcus delphini strain 214092504301-1 NODE_1_length_303951_cov_90.7534_ID_1, whole genome shotgun sequence 0 crisprs cas3 0 0 3 0
NZ_MWUW01000019 Staphylococcus delphini strain 214092504301-1 NODE_19_length_21297_cov_94.1899_ID_37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000020 Staphylococcus delphini strain 214092504301-1 NODE_20_length_13675_cov_117.309_ID_39, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MWUW01000030 Staphylococcus delphini strain 214092504301-1 NODE_32_length_997_cov_275.409_ID_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000041 Staphylococcus delphini strain 214092504301-1 NODE_213_length_241_cov_204.868_ID_425, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000035 Staphylococcus delphini strain 214092504301-1 NODE_207_length_399_cov_119.235_ID_413, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000012 Staphylococcus delphini strain 214092504301-1 NODE_12_length_49095_cov_100.014_ID_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000017 Staphylococcus delphini strain 214092504301-1 NODE_17_length_40317_cov_99.8221_ID_33, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MWUW01000026 Staphylococcus delphini strain 214092504301-1 NODE_27_length_1946_cov_844.179_ID_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000018 Staphylococcus delphini strain 214092504301-1 NODE_18_length_30468_cov_109.523_ID_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000011 Staphylococcus delphini strain 214092504301-1 NODE_11_length_97191_cov_96.0004_ID_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000023 Staphylococcus delphini strain 214092504301-1 NODE_23_length_7459_cov_94.6605_ID_45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000016 Staphylococcus delphini strain 214092504301-1 NODE_16_length_40917_cov_101.664_ID_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000027 Staphylococcus delphini strain 214092504301-1 NODE_28_length_1649_cov_469.9_ID_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MWUW01000022 Staphylococcus delphini strain 214092504301-1 NODE_22_length_8086_cov_106.613_ID_43, whole genome shotgun sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_MWUW01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 52746 57 Staphylococcus_virus(53.12%) tRNA,capsid,head,plate,terminase,integrase,holin,tail,portal attL 24109:24123|attR 55298:55312
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MWUW01000002.1|WP_096588840.1|25844_26192_-|hypothetical-protein 25844_26192_- 115 aa aa AcrIIA19 NA NA 0-52746 NA
NZ_MWUW01000002.1|WP_142302263.1|26548_27061_+|hypothetical-protein 26548_27061_+ 170 aa aa AcrIIA15 NA NA 0-52746 NA
2. NZ_MWUW01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MWUW01000008_1 25538-26022 orTypeII NA
7 spacers
cas2,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MWUW01000008_1 1.12|25890|30|NZ_MWUW01000008|CRISPRCasFinder 25890-25919 30 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 29584-29613 0 1.0
NZ_MWUW01000008_1 1.17|25891|30|NZ_MWUW01000008|PILER-CR 25891-25920 30 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 29584-29613 0 1.0
NZ_MWUW01000008_1 1.9|25695|29|NZ_MWUW01000008|CRISPRCasFinder 25695-25723 29 MK075005 Staphylococcus phage phiSP119-2, partial genome 5963-5991 2 0.931
NZ_MWUW01000008_1 1.14|25696|29|NZ_MWUW01000008|PILER-CR 25696-25724 29 MK075005 Staphylococcus phage phiSP119-2, partial genome 5963-5991 2 0.931
NZ_MWUW01000008_1 1.13|25956|31|NZ_MWUW01000008|CRISPRCasFinder 25956-25986 31 MF417888 Uncultured Caudovirales phage clone 9S_3, partial genome 44874-44904 6 0.806
NZ_MWUW01000008_1 1.18|25957|31|NZ_MWUW01000008|PILER-CR 25957-25987 31 MF417888 Uncultured Caudovirales phage clone 9S_3, partial genome 44874-44904 6 0.806
NZ_MWUW01000008_1 1.3|25695|40|NZ_MWUW01000008|CRT 25695-25734 40 MK075005 Staphylococcus phage phiSP119-2, partial genome 5952-5991 7 0.825
NZ_MWUW01000008_1 1.6|25890|41|NZ_MWUW01000008|CRT 25890-25930 41 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 29584-29624 8 0.805

1. spacer 1.12|25890|30|NZ_MWUW01000008|CRISPRCasFinder matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

actatgtcagacctcaaaggaaagattctt	CRISPR spacer
actatgtcagacctcaaaggaaagattctt	Protospacer
******************************

2. spacer 1.17|25891|30|NZ_MWUW01000008|PILER-CR matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

actatgtcagacctcaaaggaaagattctt	CRISPR spacer
actatgtcagacctcaaaggaaagattctt	Protospacer
******************************

3. spacer 1.9|25695|29|NZ_MWUW01000008|CRISPRCasFinder matches to MK075005 (Staphylococcus phage phiSP119-2, partial genome) position: , mismatch: 2, identity: 0.931

gttacttaataaaatgtgccacgatttta	CRISPR spacer
attgcttaataaaatgtgccacgatttta	Protospacer
.**.*************************

4. spacer 1.14|25696|29|NZ_MWUW01000008|PILER-CR matches to MK075005 (Staphylococcus phage phiSP119-2, partial genome) position: , mismatch: 2, identity: 0.931

gttacttaataaaatgtgccacgatttta	CRISPR spacer
attgcttaataaaatgtgccacgatttta	Protospacer
.**.*************************

5. spacer 1.13|25956|31|NZ_MWUW01000008|CRISPRCasFinder matches to MF417888 (Uncultured Caudovirales phage clone 9S_3, partial genome) position: , mismatch: 6, identity: 0.806

tccgcttggtacttaaagcgaatccaccaca	CRISPR spacer
ggcgcttgatatttaaagcgaatccaccaat	Protospacer
  ******.**.*****************  

6. spacer 1.18|25957|31|NZ_MWUW01000008|PILER-CR matches to MF417888 (Uncultured Caudovirales phage clone 9S_3, partial genome) position: , mismatch: 6, identity: 0.806

tccgcttggtacttaaagcgaatccaccaca	CRISPR spacer
ggcgcttgatatttaaagcgaatccaccaat	Protospacer
  ******.**.*****************  

7. spacer 1.3|25695|40|NZ_MWUW01000008|CRT matches to MK075005 (Staphylococcus phage phiSP119-2, partial genome) position: , mismatch: 7, identity: 0.825

gttacttaataaaatgtgccacgattttagttttacttca--	CRISPR spacer
attgcttaataaaatgtgccacgatttta--tcaagttcatc	Protospacer
.**.*************************  *. * ****  

8. spacer 1.6|25890|41|NZ_MWUW01000008|CRT matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 8, identity: 0.805

actatgtcagacctcaaaggaaagattcttgttttacttca	CRISPR spacer
actatgtcagacctcaaaggaaagattcttgaagaagatac	Protospacer
*******************************    *  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MWUW01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7008 : 13675 12 Staphylococcus_phage(75.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MWUW01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 249 : 8803 25 Staphylococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_MWUW01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 53179 54 Staphylococcus_phage(45.83%) portal,tail,capsid,head,tRNA,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MWUW01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 59364 : 82927 25 Staphylococcus_phage(95.0%) NA NA
DBSCAN-SWA_2 87049 : 94876 6 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_3 129112 : 138500 11 Staphylococcus_phage(75.0%) capsid,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MWUW01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 131733 : 140153 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 221497 : 229939 18 Staphylococcus_phage(62.5%) integrase attL 218953:218967|attR 228603:228617
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MWUW01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 270 : 8086 20 Staphylococcus_phage(94.12%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage