Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015883 Enterococcus faecalis strain sorialis chromosome, complete genome 3 crisprs csa3,cas3,cas14j,DinG,csn2,cas2,cas9,DEDDh,RT 0 8 6 0
NZ_CP015884 Enterococcus faecalis strain sorialis plasmid Efsorialis-p1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 2 crisprs NA 0 6 0 2

Results visualization

1. NZ_CP015883
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015883_1 1619153-1619716 TypeII NA
8 spacers
csn2,cas2,cas9,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015883_2 1877088-1877372 Orphan NA:II-A,II-B
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015883_3 2697138-2697211 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MH375074 Enterococcus phage LY0323, complete genome 14191-14220 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MH355583 Enterococcus phage vB_EfaS_LM99, complete genome 25256-25285 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721199 Enterococcus phage vB_EfaS_Ef5.1, complete genome 25294-25323 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK360024 Enterococcus phage vB_EfaS_Max, complete genome 26997-27026 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 CAJDJX010000002 Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence 28839-28868 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MT857001 Enterococcus phage EFA1, complete genome 26140-26169 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 KT932701 Enterococcus phage vB_EfaS_IME196, complete genome 25559-25588 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042023 Enterococcus phage phiSHEF5, complete genome 15973-16002 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042101 Enterococcus phage PMBT2, complete genome 26219-26248 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MH203383 Ecterococcus phage vB_EfaS_AL3, complete genome 27301-27330 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721200 Enterococcus phage vB_EfaS_Ef5.3, complete genome 25586-25615 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042022 Enterococcus phage phiSHEF4, complete genome 19571-19600 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MT520979 Enterococcus phage vB_EfaS-271, complete genome 27170-27199 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MH193369 Enterococcus phage LY0322, complete genome 13774-13803 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_031260 Enterococcus phage Ec-ZZ2, complete genome 4183-4212 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721186 Enterococcus phage vB_EfaS_Ef5.2, complete genome 25777-25806 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042021 Enterococcus phage phiSHEF2, complete genome 26175-26204 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 JX193904 Enterococcus phage EfaCPT1, complete genome 24158-24187 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042126 Enterococcus phage vB_EfaS_AL3, complete genome 27301-27330 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 KX284704 Enterococcus phage SANTOR1, complete genome 23374-23403 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 KJ127304 Enterococcus phage AUEF3, partial genome 16779-16808 0 1.0
NZ_CP015883_2 2.1|1877108|46|NZ_CP015883|CRT 1877108-1877153 46 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 288-333 0 1.0
NZ_CP015883_2 2.2|1877174|46|NZ_CP015883|CRT 1877174-1877219 46 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 222-267 0 1.0
NZ_CP015883_2 2.5|1877175|27|NZ_CP015883|CRISPRCasFinder 1877175-1877201 27 MF157411 Escherichia coli strain EC1000 plasmid pCR2, complete sequence 240-266 0 1.0
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 KF728385 Enterococcus phage IME_EF3, complete genome 27212-27241 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 25243-25272 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 NC_042127 Enterococcus phage vB_EfaS_AL2, complete genome 14027-14056 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MG264739 UNVERIFIED: Enterococcus phage phiNASRA1, complete genome 2703-2732 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 CAJDKF010000002 Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence 28650-28679 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 KF733017 Enterococcus phage IME-EF4, complete genome 14831-14860 1 0.967
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721191 Enterococcus phage vB_EfaS_Ef5.4, complete genome 25476-25505 2 0.933
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK721187 Enterococcus phage vB_EfaS_Ef6.1, complete genome 25547-25576 2 0.933
NZ_CP015883_1 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619651-1619680 30 MK982307 Enterococcus phage MSF2, complete genome 32076-32105 3 0.9
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 LT615366 Enterococcus phage VPE25 genome assembly, chromosome: VPE25 28752-28781 6 0.8
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 LT546029 Enterococcus phage VFW genome assembly, chromosome: VFW 28684-28713 6 0.8
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 LT546030 Enterococcus phage VPE25 genome assembly, chromosome: I 28752-28781 6 0.8
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 MT119361 Enterococus phage vipetofem, complete genome 56526-56555 6 0.8
NZ_CP015883_1 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619585-1619614 30 MG592415 Vibrio phage 1.031.O._10N.261.46.F8, partial genome 10873-10902 6 0.8
NZ_CP015883_1 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619585-1619614 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1590971-1591000 6 0.8
NZ_CP015883_2 2.5|1877175|27|NZ_CP015883|CRISPRCasFinder 1877175-1877201 27 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 111387-111413 6 0.778
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP041427 Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence 56283-56312 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP011362 Salimicrobium jeotgali strain MJ3 plasmid pSJ52, complete sequence 1949-1978 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 CP006767 Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed1, complete sequence 408-437 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 481058-481087 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NC_004922 Lactococcus lactis lactis BGMN1-5 plasmid pMN5, complete sequence 763-792 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP038659 Citrobacter freundii strain 680 plasmid p680_1, complete sequence 363776-363805 7 0.767
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 106851-106880 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 MN794232 Vibrio phage VH1_2019, complete genome 117004-117033 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 NC_005083 Vibrio phage KVP40, complete genome 116465-116494 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 JN849462 Vibriophage phi-pp2, complete genome 116408-116437 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 MT135024 Vibrio phage V05, complete genome 59483-59512 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 AY283928 Bacteriophage KVP40, complete genome 116465-116494 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 MT135026 Vibrio phage V09, complete genome 227856-227885 7 0.767
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 MT135025 Vibrio phage V07, complete genome 164567-164596 7 0.767
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MN176217 Escherichia phage vB_Eco4M-7, complete genome 54013-54042 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MH051335 Escherichia phage vB_EcoM-Ro157lw, complete genome 47776-47805 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 JX128258 Escherichia phage ECML-117, complete genome 52688-52717 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 NC_048194 Escherichia phage vB_EcoM_WFH, complete genome 47826-47855 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MT446405 UNVERIFIED: Escherichia virus TH32, complete genome 47325-47354 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MT446408 UNVERIFIED: Escherichia virus TH35, complete genome 8122-8151 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 NC_048195 Escherichia phage vB_EcoM_WFC, complete genome 47764-47793 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 NC_048073 Escherichia phage FEC19, complete genome 22675-22704 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MT684590 Streptomyces phage LilMartin, complete genome 63102-63131 8 0.733
NZ_CP015883_1 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619387-1619416 30 MT897905 Streptomyces phage MulchMansion, complete genome 63102-63131 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 MN693967 Marine virus AFVG_250M992, complete genome 40288-40317 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 100498-100527 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 303135-303164 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 476724-476753 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 CP046512 Bacillus cereus strain JHU plasmid p1, complete sequence 475721-475750 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 336359-336388 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 210527-210556 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 508466-508495 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 294951-294980 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1124729-1124758 8 0.733
NZ_CP015883_1 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619519-1619548 30 KP671755 Vibrio phage ValKK3, complete genome 10086-10115 8 0.733
NZ_CP015883_1 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619585-1619614 30 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 280146-280175 8 0.733
NZ_CP015883_1 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder 1619453-1619482 30 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 530179-530208 9 0.7

1. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MH375074 (Enterococcus phage LY0323, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

2. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MH355583 (Enterococcus phage vB_EfaS_LM99, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

3. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721199 (Enterococcus phage vB_EfaS_Ef5.1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

4. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK360024 (Enterococcus phage vB_EfaS_Max, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

5. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to CAJDJX010000002 (Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

6. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT857001 (Enterococcus phage EFA1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

7. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KT932701 (Enterococcus phage vB_EfaS_IME196, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

8. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042023 (Enterococcus phage phiSHEF5, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

9. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042101 (Enterococcus phage PMBT2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

10. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MH203383 (Ecterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

11. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721200 (Enterococcus phage vB_EfaS_Ef5.3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

12. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042022 (Enterococcus phage phiSHEF4, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

13. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT520979 (Enterococcus phage vB_EfaS-271, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

14. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MH193369 (Enterococcus phage LY0322, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

15. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_031260 (Enterococcus phage Ec-ZZ2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

16. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721186 (Enterococcus phage vB_EfaS_Ef5.2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

17. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042021 (Enterococcus phage phiSHEF2, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

18. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to JX193904 (Enterococcus phage EfaCPT1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

19. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042126 (Enterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

20. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KX284704 (Enterococcus phage SANTOR1, complete genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

21. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KJ127304 (Enterococcus phage AUEF3, partial genome) position: , mismatch: 0, identity: 1.0

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaactttt	Protospacer
******************************

22. spacer 2.1|1877108|46|NZ_CP015883|CRT matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

aggggagaaaaagccaaatcaaaaaagtttgttttggtaccattcc	CRISPR spacer
aggggagaaaaagccaaatcaaaaaagtttgttttggtaccattcc	Protospacer
**********************************************

23. spacer 2.2|1877174|46|NZ_CP015883|CRT matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

tatagtcattatgctgaacaagggtttgttgttttggtaccattct	CRISPR spacer
tatagtcattatgctgaacaagggtttgttgttttggtaccattct	Protospacer
**********************************************

24. spacer 2.5|1877175|27|NZ_CP015883|CRISPRCasFinder matches to MF157411 (Escherichia coli strain EC1000 plasmid pCR2, complete sequence) position: , mismatch: 0, identity: 1.0

atagtcattatgctgaacaagggtttg	CRISPR spacer
atagtcattatgctgaacaagggtttg	Protospacer
***************************

25. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KF728385 (Enterococcus phage IME_EF3, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ctacaccaaagcgaaacatattcaactttt	Protospacer
.*****************************

26. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

27. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_042127 (Enterococcus phage vB_EfaS_AL2, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

28. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MG264739 (UNVERIFIED: Enterococcus phage phiNASRA1, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacgtattcaactttt	Protospacer
*****************.************

29. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to CAJDKF010000002 (Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

30. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KF733017 (Enterococcus phage IME-EF4, complete genome) position: , mismatch: 1, identity: 0.967

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcaccaaagcgaaacatattcaactttt	Protospacer
**.***************************

31. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721191 (Enterococcus phage vB_EfaS_Ef5.4, complete genome) position: , mismatch: 2, identity: 0.933

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacaccaaagcgaaacatattcaagcttt	Protospacer
************************* .***

32. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK721187 (Enterococcus phage vB_EfaS_Ef6.1, complete genome) position: , mismatch: 2, identity: 0.933

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttacatcagagcgaaacatattcaactttt	Protospacer
*****.**.*********************

33. spacer 1.8|1619651|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 3, identity: 0.9

ttacaccaaagcgaaacatattcaactttt	CRISPR spacer
ttgcatcaaagcgaaacatattcaactttc	Protospacer
**.**.***********************.

34. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to LT615366 (Enterococcus phage VPE25 genome assembly, chromosome: VPE25) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

35. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to LT546029 (Enterococcus phage VFW genome assembly, chromosome: VFW) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

36. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to LT546030 (Enterococcus phage VPE25 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

37. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT119361 (Enterococus phage vipetofem, complete genome) position: , mismatch: 6, identity: 0.8

ctttcaaa----agaaaataattgattcaattga	CRISPR spacer
----taaagtggagaaaataattgatttaattga	Protospacer
    .***    ***************.******

38. spacer 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MG592415 (Vibrio phage 1.031.O._10N.261.46.F8, partial genome) position: , mismatch: 6, identity: 0.8

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
taatttttagggtgacgagcgtgacgagca	Protospacer
.* * ***.*** **************** 

39. spacer 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
catcagctggggagacaagcgtgccgagcc	Protospacer
**..* .*********.****** ******

40. spacer 2.5|1877175|27|NZ_CP015883|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 6, identity: 0.778

atagtcattatgctgaacaagggtttg	CRISPR spacer
gaggtcatgatgccgaacaagggtttc	Protospacer
. .***** ****.************ 

41. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041427 (Escherichia coli strain STEC388 plasmid pSTEC388_2, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
tccacaaaagaaaataatttatttaattca	Protospacer
... *************** ***.**** *

42. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011362 (Salimicrobium jeotgali strain MJ3 plasmid pSJ52, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ggctgaaaagaaaatatttaattcaattgg	Protospacer
  .* *********** **.*********.

43. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to CP006767 (Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

---ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aaatttt---aagaaaattattgattcaattag	Protospacer
   .***   ******** ************..

44. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaacacgt	Protospacer
************** ****.*** *  .* 

45. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_004922 (Lactococcus lactis lactis BGMN1-5 plasmid pMN5, complete sequence) position: , mismatch: 7, identity: 0.767

---ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aaatttt---aagaaaattattgattcaattag	Protospacer
   .***   ******** ************..

46. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
atttcaaaagaaattaattgatgctgatta	Protospacer
 ************ ******** * . * *

47. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 7, identity: 0.767

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaacacgt	Protospacer
************** ****.*** *  .* 

48. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MN794232 (Vibrio phage VH1_2019, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

49. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_005083 (Vibrio phage KVP40, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

50. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to JN849462 (Vibriophage phi-pp2, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

51. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT135024 (Vibrio phage V05, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

52. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to AY283928 (Bacteriophage KVP40, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

53. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT135026 (Vibrio phage V09, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgaccggtgcgccgactagataaacaggta	Protospacer
* ..* ********* ******** ****.

54. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT135025 (Vibrio phage V07, complete genome) position: , mismatch: 7, identity: 0.767

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgcacggtgcgccgactagataaacaggta	Protospacer
*   * ********* ******** ****.

55. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MN176217 (Escherichia phage vB_Eco4M-7, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

56. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MH051335 (Escherichia phage vB_EcoM-Ro157lw, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

57. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to JX128258 (Escherichia phage ECML-117, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

58. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_048194 (Escherichia phage vB_EcoM_WFH, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

59. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT446405 (UNVERIFIED: Escherichia virus TH32, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

60. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT446408 (UNVERIFIED: Escherichia virus TH35, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

61. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_048195 (Escherichia phage vB_EcoM_WFC, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

62. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_048073 (Escherichia phage FEC19, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
ttaagcttcaagagctgtatgaattatatt	Protospacer
. .**.***********.********* . 

63. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT684590 (Streptomyces phage LilMartin, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
gggagtttcaagagcttcatgatttcatga	Protospacer
 .************** ***** **  * .

64. spacer 1.4|1619387|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MT897905 (Streptomyces phage MulchMansion, complete genome) position: , mismatch: 8, identity: 0.733

cagagtttcaagagctgcatgaattattcg	CRISPR spacer
gggagtttcaagagcttcatgatttcatga	Protospacer
 .************** ***** **  * .

65. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to MN693967 (Marine virus AFVG_250M992, complete genome) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
tttttaaaagaaaataatggattcacagct	Protospacer
.***.************* ******     

66. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

67. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

68. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

69. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

70. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

71. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

72. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccacgt	Protospacer
************** ****.***    .* 

73. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
ctttcaaaagaaaaaaattaattaccgcgt	Protospacer
************** ****.***    .* 

74. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.733

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
aacgaaaaagaaaataattgatttagttaa	Protospacer
  .  ******************.*.**.*

75. spacer 1.6|1619519|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to KP671755 (Vibrio phage ValKK3, complete genome) position: , mismatch: 8, identity: 0.733

tcgtctgtgcgccgaatagataaagaggtg	CRISPR spacer
tgacaggtgcgccgactagataaacaggta	Protospacer
* ..  ********* ******** ****.

76. spacer 1.7|1619585|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cactatttggggagacgagcgtgacgagcc	CRISPR spacer
ccgactttggggcgacgagcctgacgagag	Protospacer
*    ******* ******* *******  

77. spacer 1.5|1619453|30|NZ_CP015883|CRT,PILER-CR,CRISPRCasFinder matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ctttcaaaagaaaataattgattcaattga	CRISPR spacer
taaagataagaaaataattgatttaattcc	Protospacer
.    * ****************.****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 130439 : 201676 41 Streptococcus_phage(50.0%) integrase,transposase attL 124260:124276|attR 169127:169143
DBSCAN-SWA_2 837735 : 845655 11 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_3 1202842 : 1218944 17 Enterococcus_phage(36.36%) tail NA
DBSCAN-SWA_4 1641961 : 1650606 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 1800474 : 1855383 59 Enterococcus_phage(51.72%) tRNA,portal,integrase,capsid,tail,transposase,terminase attL 1834830:1834844|attR 1856082:1856096
DBSCAN-SWA_6 2385950 : 2393475 10 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015884
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 49598 : 86137 32 Planktothrix_phage(33.33%) bacteriocin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015885
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015885_1 438-569 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015885_2 16123-16291 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 548-578 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 461-491 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33655-33685 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 449-479 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5472-5502 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43942-43972 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83451-83481 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4997-5027 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 773-803 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5073-5103 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 602-632 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 515-545 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33709-33739 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7642-7672 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66170-66200 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12175-12205 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 503-533 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60905-60935 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92753-92783 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 503-533 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5526-5556 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43888-43918 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83505-83535 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9536-9566 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4943-4973 0 1.0
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 827-857 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 549-575 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 462-488 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33656-33682 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 450-476 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5473-5499 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43945-43971 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83452-83478 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 5000-5026 0 1.0
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 774-800 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5074-5100 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NC_004671 Enterococcus faecalis V583 plasmid pTEF2, complete sequence 603-629 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 516-542 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP040897 Enterococcus faecalis strain HA-1 plasmid punnamed 33710-33736 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7645-7671 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66173-66199 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12178-12204 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP046109 Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence 504-530 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60908-60934 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92756-92782 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 504-530 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP028837 Enterococcus faecalis strain FC plasmid unnamed2, complete sequence 5527-5553 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP030046 Enterococcus faecalis strain C54 plasmid pC54, complete sequence 43891-43917 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NC_011642 Enterococcus faecalis plasmid pMG2200, complete sequence 83506-83532 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9537-9563 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP028284 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence 4946-4972 0 1.0
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NZ_CP030043 Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence 828-854 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NC_004669 Enterococcus faecalis V583 plasmid pTEF1, complete sequence 32712-32753 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 16146-16187 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 46754-46795 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NC_014726 Enterococcus faecalis plasmid pTW9, complete sequence 22840-22881 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP031029 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-2, complete sequence 38618-38659 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP019513 Enterococcus faecalis strain CLB21560 plasmid pA, complete sequence 4929-4970 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 76508-76549 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP028838 Enterococcus faecalis strain FC plasmid unnamed3, complete sequence 13636-13677 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP028721 Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence 9193-9234 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP028722 Enterococcus faecalis strain CVM N48037F plasmid pN48037F-2, complete sequence 38731-38772 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 46839-46880 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_CP042217 Enterococcus faecalis strain L8 plasmid pL8, complete sequence 66833-66874 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_AP018539 Enterococcus faecalis strain KUB3006 plasmid pKUB3006-1, complete sequence 21807-21848 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NC_002630 Enterococcus faecalis plasmid pAM373, complete sequence 29083-29124 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_MK140641 Enterococcus faecalis strain E035 plasmid pE035, complete sequence 78155-78196 0 1.0
NZ_CP015885_2 2.1|16157|42|NZ_CP015885|PILER-CR 16157-16198 42 NZ_MK993385 Enterococcus faecalis strain P010748 plasmid pEF10748, complete sequence 21806-21847 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NC_004669 Enterococcus faecalis V583 plasmid pTEF1, complete sequence 32641-32679 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP015885 Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence 16220-16258 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 46683-46721 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NC_014726 Enterococcus faecalis plasmid pTW9, complete sequence 22914-22952 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP031029 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-2, complete sequence 38692-38730 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP019513 Enterococcus faecalis strain CLB21560 plasmid pA, complete sequence 4858-4896 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP028838 Enterococcus faecalis strain FC plasmid unnamed3, complete sequence 13710-13748 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP028721 Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence 9122-9160 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP028722 Enterococcus faecalis strain CVM N48037F plasmid pN48037F-2, complete sequence 38805-38843 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP028286 Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence 46768-46806 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_CP042217 Enterococcus faecalis strain L8 plasmid pL8, complete sequence 66762-66800 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_AP018539 Enterococcus faecalis strain KUB3006 plasmid pKUB3006-1, complete sequence 21881-21919 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NC_002630 Enterococcus faecalis plasmid pAM373, complete sequence 29012-29050 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_MK140641 Enterococcus faecalis strain E035 plasmid pE035, complete sequence 78084-78122 0 1.0
NZ_CP015885_2 2.2|16233|39|NZ_CP015885|PILER-CR 16233-16271 39 NZ_MK993385 Enterococcus faecalis strain P010748 plasmid pEF10748, complete sequence 21880-21918 0 1.0
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7696-7726 1 0.968
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12229-12259 1 0.968
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60959-60989 1 0.968
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92807-92837 1 0.968
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 748-778 1 0.968
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 7699-7725 1 0.963
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66227-66253 1 0.963
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP031028 Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence 12232-12258 1 0.963
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP019514 Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence 60962-60988 1 0.963
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP036248 Enterococcus faecalis R712 plasmid pR712_02, complete sequence 92810-92836 1 0.963
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 450-476 1 0.963
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 749-775 1 0.963
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 MH830362 Enterococcus faecalis plasmid p4, complete sequence 66224-66254 2 0.935
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP049777 Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence 449-479 2 0.935
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5019-5049 2 0.935
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 694-724 2 0.935
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9482-9512 2 0.935
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NZ_KY513281 Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence 5020-5046 2 0.926
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 NC_013533 Enterococcus faecalis plasmid pBEE99, complete sequence 695-721 2 0.926
NZ_CP015885_1 1.3|468|27|NZ_CP015885|PILER-CR 468-494 27 LC499744 Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence 9483-9509 2 0.926
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 MT711976 Streptomyces phage Coruscant, complete genome 87403-87429 5 0.815
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 31964-31990 5 0.815
NZ_CP015885_1 1.4|522|27|NZ_CP015885|PILER-CR 522-548 27 JQ660954 Clostridium phage PhiS63, complete genome 22891-22917 6 0.778
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 31963-31993 7 0.774
NZ_CP015885_1 1.1|461|31|NZ_CP015885|CRISPRCasFinder 461-491 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 586541-586571 8 0.742
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 MT711976 Streptomyces phage Coruscant, complete genome 87400-87430 8 0.742
NZ_CP015885_1 1.2|515|31|NZ_CP015885|CRISPRCasFinder 515-545 31 JQ660954 Clostridium phage PhiS63, complete genome 22890-22920 10 0.677

1. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

2. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

3. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

4. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

5. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

6. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

7. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

8. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

9. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcgtttc	Protospacer
*******************************

10. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

11. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

12. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

13. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

14. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

15. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

16. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

17. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

18. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

19. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

20. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

21. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

22. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

23. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

24. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

25. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

26. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccagtacttt	Protospacer
*******************************

27. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

28. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

29. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

30. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

31. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

32. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

33. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

34. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

35. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcgt	Protospacer
***************************

36. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

37. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NC_004671 (Enterococcus faecalis V583 plasmid pTEF2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

38. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

39. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP040897 (Enterococcus faecalis strain HA-1 plasmid punnamed) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

40. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

41. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

42. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

43. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP046109 (Enterococcus faecalis strain 133170041-3 plasmid pAD1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

44. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

45. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

46. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

47. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP028837 (Enterococcus faecalis strain FC plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

48. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

49. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NC_011642 (Enterococcus faecalis plasmid pMG2200, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

50. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

51. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP028284 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

52. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NZ_CP030043 (Enterococcus faecalis strain C25 plasmid pC25-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccagtac	Protospacer
***************************

53. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NC_004669 (Enterococcus faecalis V583 plasmid pTEF1, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

54. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

55. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

56. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NC_014726 (Enterococcus faecalis plasmid pTW9, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

57. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP031029 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

58. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP019513 (Enterococcus faecalis strain CLB21560 plasmid pA, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

59. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

60. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP028838 (Enterococcus faecalis strain FC plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

61. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

62. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP028722 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

63. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

64. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

65. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_AP018539 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

66. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NC_002630 (Enterococcus faecalis plasmid pAM373, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

67. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

68. spacer 2.1|16157|42|NZ_CP015885|PILER-CR matches to NZ_MK993385 (Enterococcus faecalis strain P010748 plasmid pEF10748, complete sequence) position: , mismatch: 0, identity: 1.0

acaactcctacagagccaagtgaaccagaacaaccaacggag	CRISPR spacer
acaactcctacagagccaagtgaaccagaacaaccaacggag	Protospacer
******************************************

69. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NC_004669 (Enterococcus faecalis V583 plasmid pTEF1, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

70. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP015885 (Enterococcus faecalis strain sorialis plasmid Efsorialis-p2, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

71. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

72. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NC_014726 (Enterococcus faecalis plasmid pTW9, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

73. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP031029 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-2, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

74. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP019513 (Enterococcus faecalis strain CLB21560 plasmid pA, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

75. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP028838 (Enterococcus faecalis strain FC plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

76. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

77. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP028722 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-2, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

78. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

79. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

80. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_AP018539 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

81. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NC_002630 (Enterococcus faecalis plasmid pAM373, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

82. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

83. spacer 2.2|16233|39|NZ_CP015885|PILER-CR matches to NZ_MK993385 (Enterococcus faecalis strain P010748 plasmid pEF10748, complete sequence) position: , mismatch: 0, identity: 1.0

tacaccaagcaaaccagcagaacccgaaaaacctgtgac	CRISPR spacer
tacaccaagcaaaccagcagaacccgaaaaacctgtgac	Protospacer
***************************************

84. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

85. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

86. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

87. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.968

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcggcatttc	Protospacer
**************************.****

88. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.968

gtccagaagaatccaataataccagtacttt	CRISPR spacer
gtccagaagaatccaataataccaggacttt	Protospacer
************************* *****

89. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

90. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcagcgt	Protospacer
**********************.****

91. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP031028 (Enterococcus faecalis strain TY1 isolate flatfish plasmid pDEF-1, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

92. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP019514 (Enterococcus faecalis strain CLB21560 plasmid pB, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

93. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcggcat	Protospacer
*************************.*

94. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcagcgt	Protospacer
**********************.****

95. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 1, identity: 0.963

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaatccaataataccaggac	Protospacer
************************ **

96. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcagcgttta	Protospacer
***********************.****** 

97. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP049777 (Enterococcus faecalis strain ES-1 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcagcgttta	Protospacer
***********************.****** 

98. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

99. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

100. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 2, identity: 0.935

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
cttcggataaacatgataaaatcaacgtttc	Protospacer
***********************..******

101. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NZ_KY513281 (Enterococcus faecalis strain 6742 plasmid p6742_2, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

102. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to NC_013533 (Enterococcus faecalis plasmid pBEE99, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

103. spacer 1.3|468|27|NZ_CP015885|PILER-CR matches to LC499744 (Enterococcus faecalis S7316 plasmid pS7316optrA DNA, complete sequence) position: , mismatch: 2, identity: 0.926

ttcggataaacatgataaaatcggcgt	CRISPR spacer
ttcggataaacatgataaaatcaacgt	Protospacer
**********************..***

104. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to MT711976 (Streptomyces phage Coruscant, complete genome) position: , mismatch: 5, identity: 0.815

tccagaagaatccaataataccagtac	CRISPR spacer
tccagaagaagccaataaaaccactct	Protospacer
********** ******* **** * .

105. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 5, identity: 0.815

tccagaagaatccaataataccagtac	CRISPR spacer
ttttgaagaatcctttaataccagtac	Protospacer
*.. *********  ************

106. spacer 1.4|522|27|NZ_CP015885|PILER-CR matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 6, identity: 0.778

tccagaagaatccaataataccagtac	CRISPR spacer
aaacgaagaaaccaataatatcagtac	Protospacer
    ****** *********.******

107. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 7, identity: 0.774

gtccagaagaatccaataataccagtacttt	CRISPR spacer
attttgaagaatcctttaataccagtactta	Protospacer
.*.. *********  ************** 

108. spacer 1.1|461|31|NZ_CP015885|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.742

cttcggataaacatgataaaatcggcgtttc	CRISPR spacer
ccaccattaaaaatgataaaaacggcgtttt	Protospacer
*. * . **** ********* ********.

109. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to MT711976 (Streptomyces phage Coruscant, complete genome) position: , mismatch: 8, identity: 0.742

gtccagaagaatccaataataccagtacttt	CRISPR spacer
atccagaagaagccaataaaaccactctgtg	Protospacer
.********** ******* **** * . * 

110. spacer 1.2|515|31|NZ_CP015885|CRISPRCasFinder matches to JQ660954 (Clostridium phage PhiS63, complete genome) position: , mismatch: 10, identity: 0.677

gtccagaagaatccaataataccagtacttt	CRISPR spacer
aaaacgaagaaaccaataatatcagtacaag	Protospacer
.    ****** *********.******   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP015885.1|WP_025188019.1|47105_47720_+|hypothetical-protein 47105_47720_+ 204 aa aa AcrIIA16 HTH_49 NA No NA
NZ_CP015885.1|WP_002401839.1|47733_48063_+|hypothetical-protein 47733_48063_+ 109 aa aa AcrIIA17 HTH_49 NA No NA