| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000352 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_352_length_502, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000038 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_38_length_54152, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000449 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_449_length_440, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000093 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_93_length_1457, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000043 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_43_length_39801, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000381 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_381b_length_305, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000094 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_94a_length_1355, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000235 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_235_length_709, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000327 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_327_length_524, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000105 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_105_length_1316, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000208 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_208_length_811, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000048 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_48_length_34175, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000403 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_403_length_463, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000451 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_451_length_437, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000092 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_92_length_1469, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000423 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_423_length_450, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000315 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_315_length_546, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000042 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_42_length_41647, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000318 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_318_length_538, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000432 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_432_length_445, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000365 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_365_length_487, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000216 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_216_length_754, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000131 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_131_length_1144, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000253 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_253_length_660, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000359 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_359_length_493, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000252 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_252_length_660, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000317 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_317_length_541, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000407 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_407_length_459, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000455 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_455_length_436, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000187 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_187_length_905, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000361 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_361a_length_394, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000137 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_137_length_1110, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000147 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_147_length_1068, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000155 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_155_length_1020, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000409 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_409_length_458, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000062 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_62_length_14675, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000179 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_179_length_927, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000236 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_236_length_702, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000416 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_416b_length_411, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000448 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_448_length_440, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000300 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_300_length_562, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000240 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_240_length_690, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000355 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_355_length_498, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000084 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_84a_length_1952, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000238 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_238_length_693, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000263 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_263_length_637, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000285 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_285_length_589, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000230 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_230_length_720, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000458 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_458_length_434, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000009 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_9_length_223903, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000272 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_272_length_615, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000467 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_467_length_400, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000241 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_241_length_687, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000314 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_314_length_547, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000125 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_125a_length_1129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000148 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_148_length_1053, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000083 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_83_length_2253, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000005 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_5_length_275623, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000452 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_452_length_437, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000298 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_298_length_567, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000341 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_341_length_510, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000374 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_374_length_479, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000286 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_286_length_586, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000067 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_67b_length_7539, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000462 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_462_length_432, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000368 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_368_length_486, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000008 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_8_length_235225, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000229 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_229_length_721, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000126 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_126a_length_942, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000420 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_420_length_452, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000089 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_89_length_1547, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000273 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_273_length_613, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000268 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_268_length_630, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000133 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_133b_length_961, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000188 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_188_length_904, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000091 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_91_length_1492, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000321 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_321_length_533, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000306 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_306_length_558, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000111 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_111_length_1280, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000061 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_61_length_16473, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000121 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_121_length_1227, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000090 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_90_length_1530, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000415 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_415_length_455, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000071 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_71_length_5483, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000370 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_370_length_482, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000256 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_256_length_645, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000294 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_294_length_574, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000078 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_78_length_3002, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000393 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_393_length_466, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000471 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_471_length_336, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000299 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_299_length_565, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000103 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_103_length_1337, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000051 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_51_length_30841, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000382 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_382_length_474, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000058 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_58_length_24392, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000348 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_348_length_504, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000389 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_389_length_468, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000157 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_157_length_1009, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000239 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_239_length_693, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000102 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_102_length_1348, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000171 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_171_length_964, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000189 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_189b_length_847, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000459 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_459_length_434, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000119 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_119_length_1235, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000011 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_11_length_214855, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000226 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_226_length_728, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000088 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_88_length_1689, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000073 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_73_length_5327, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000387 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_387_length_469, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000397 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_397_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000160 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_160_length_1007, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000457 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_457_length_435, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000142 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_142_length_1085, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000030 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_30_length_95397, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000227 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_227_length_727, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000282 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_282_length_593, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000330 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_330_length_522, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000198 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_198b_length_709, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000248 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_248_length_664, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000322 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_322_length_531, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000222 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_222b_length_683, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000025 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_25_length_107511, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000289 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_289_length_583, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000168 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_168_length_969, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000207 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_207b_length_698, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000307 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_307_length_558, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000242 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_242_length_683, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000106 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_106_length_1314, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000342 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_342_length_509, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000053 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_53_length_29406, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000266 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_266_length_634, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000400 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_400_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000446 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_446_length_440, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000412 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_412_length_457, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000158 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_158a_length_784, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000357 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_357_length_496, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000371 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_371_length_482, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000435 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_435_length_444, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000139 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_139_length_1098, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000087 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_87_length_1702, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000039 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_39_length_51894, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000001 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_1_length_486179, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000350 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_350_length_503, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000134 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_134b_length_1106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000098 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_98_length_1389, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000077 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_77_length_3075, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000251 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_251_length_660, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000360 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_360_length_493, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000313 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_313_length_547, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000202 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_202_length_841, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000311 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_311_length_550, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000109 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_109_length_1289, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000166 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_166_length_975, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000026 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_26_length_106862, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000176 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_176_length_939, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000086 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_86_length_1820, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000386 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_386_length_470, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000016 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_16_length_156229, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000231 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_231_length_719, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000118 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_118b_length_1234, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000450 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_450_length_437, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000101 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_101a_length_1274, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000161 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_161_length_1006, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000247 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_247_length_668, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000070 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_70_length_6168, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000082 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_82_length_2322, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000033 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_33_length_68889, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000383 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_383_length_471, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000002 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_2_length_405276, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000364 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_364_length_490, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000196 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_196_length_864, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000224 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_224_length_731, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000044 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_44_length_38106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000447 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_447_length_440, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000036 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_36_length_59111, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000340 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_340_length_510, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000377 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_377_length_477, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000465 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_465_length_432, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000099 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_99_length_1380, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000417 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_417_length_454, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000151 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_151_length_1046, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000369 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_369_length_484, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000399 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_399_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000097 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_97b_length_1254, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000149 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_149_length_1051, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000132 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_132_length_1134, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000096 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_96a_length_1182, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000120 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_120_length_1231, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000366 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_366_length_487, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000135 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_135_length_1123, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000358 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_358_length_494, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000418 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_418_length_453, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000045 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_45_length_37866, whole genome shotgun sequence | 1 crisprs | 0 | 26 | 0 | 0 | |
| NZ_NFFQ01000049 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_49_length_33638, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000401 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_401_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000319 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_319_length_536, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000301 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_301_length_561, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000211 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_211_length_792, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000177 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_177_length_938, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000460 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_460_length_433, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000349 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_349_length_503, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000115 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_115b_length_1180, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000234 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_234_length_710, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000167 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_167_length_969, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000154 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_154b_length_995, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000274 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_274_length_607, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000210 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_210_length_808, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000040 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_40_length_49800, whole genome shotgun sequence | 2 crisprs | 1 | 2 | 0 | 4 | |
| NZ_NFFQ01000262 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_262_length_638, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000204 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_204_length_824, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000218 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_218_length_751, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000469 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_469_length_378, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000345 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_345_length_508, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000431 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_431_length_445, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000150 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_150b_length_944, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000444 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_444_length_441, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000267 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_267_length_630, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000054 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_54_length_28099, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000081 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_81_length_2426, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000034 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_34_length_65202, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000215 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_215_length_759, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000173 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_173_length_949, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000107 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_107a_length_1108, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000191 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_191_length_895, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000006 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_6_length_265646, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000283 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_283_length_592, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000184 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_184_length_912, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000112 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_112a_length_1180, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000297 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_297_length_568, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000438 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_438_length_443, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000303 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_303_length_559, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000037 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_37a_length_55508, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000363 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_363_length_491, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000024 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_24_length_113478, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000074 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_74_length_5262, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000138 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_138b_length_896, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000212 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_212_length_785, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000172 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_172_length_958, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000373 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_373_length_479, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000162 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_162_length_1004, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000331 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_331_length_522, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000430 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_430_length_445, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000128 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_128a_length_1066, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000419 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_419_length_452, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000195 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_195_length_870, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000439 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_439_length_443, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000012 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_12_length_190528, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000437 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_437_length_443, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000217 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_217_length_754, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000153 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_153_length_1040, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000060 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_60_length_16712, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000426 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_426_length_448, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000064 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_64_length_11973, whole genome shotgun sequence | 2 crisprs | 0 | 24 | 0 | 0 | |
| NZ_NFFQ01000069 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_69_length_7015, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000079 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_79_length_2992, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000035 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_35_length_62727, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000309 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_309_length_552, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000453 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_453_length_437, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000255 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_255_length_647, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000020 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_20_length_141227, whole genome shotgun sequence | 1 crisprs | 0 | 3 | 0 | 0 | |
| NZ_NFFQ01000428 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_428_length_447, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000405 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_405_length_461, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000258 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_258_length_641, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000305 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_305_length_559, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000434 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_434_length_445, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000022 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_22_length_123518, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000246 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_246_length_669, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000329 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_329_length_523, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000295 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_295a_length_441, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000047 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_47_length_34712, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000193 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_193_length_876, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000323 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_323_length_529, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000145 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_145_length_1072, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000136 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_136b_length_1067, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000220 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_220_length_745, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000203 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_203_length_831, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000031 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_31_length_93162, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000468 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_468_length_400, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000279 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_279_length_597, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000175 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_175_length_941, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000324 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_324_length_526, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000351 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_351_length_503, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000108 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_108_length_1307, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000116 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_116_length_1267, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000271 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_271_length_617, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000461 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_461_length_433, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000130 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_130_length_1159, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000181 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_181_length_923, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000237 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_237_length_701, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000375 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_375_length_479, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000391 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_391_length_468, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000182 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_182_length_916, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000404 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_404_length_462, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000395 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_395_length_465, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000214 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_214_length_761, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000232 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_232_length_714, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000174 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_174b_length_840, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000127 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_127_length_1164, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000100 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_100_length_1366, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000192 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_192_length_885, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000408 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_408_length_458, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000287 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_287_length_586, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000281 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_281_length_596, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000441 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_441_length_442, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000152 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_152_length_1042, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000122 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_122_length_1218, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000163 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_163_length_992, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000411 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_411_length_457, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000085 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_85_length_2019, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000250 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_250_length_662, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000156 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_156_length_1009, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000200 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_200_length_845, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000201 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_201_length_841, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000442 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_442_length_442, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000292 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_292_length_578, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000165 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_165_length_979, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000378 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_378_length_476, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000308 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_308_length_554, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000464 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_464_length_432, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000021 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_21_length_134100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000304 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_304_length_559, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000052 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_52_length_29446, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000075 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_75_length_4905, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000066 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_66_length_8153, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000068 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_68_length_7209, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000104 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_104a_length_1043, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000190 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_190_length_896, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000362 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_362_length_492, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000270 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_270_length_618, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000029 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_29_length_95900, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000277 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_277_length_604, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000041 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_41_length_47619, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000010 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_10_length_217837, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000197 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_197_length_863, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000367 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_367_length_487, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000170 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_170a_length_702, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000339 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_339_length_510, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000095 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_95b_length_1381, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000223 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_223_length_731, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000243 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_243_length_678, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000028 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_28_length_99138, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000117 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_117b_length_1145, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000310 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_310_length_551, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000004 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_4_length_361198, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_NFFQ01000276 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_276_length_605, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000336 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_336_length_518, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000072 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_72_length_5330, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000385 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_385_length_470, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000335 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_335_length_518, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000076 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_76_length_3141, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000254 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_254_length_657, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000221 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_221b_length_583, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000017 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_17_length_155119, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000269 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_269_length_625, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000055 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_55_length_27704, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000398 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_398_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000019 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_19a_length_149338, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000325 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_325_length_526, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000140 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_140_length_1092, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000114 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_114_length_1277, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000169 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_169_length_967, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000470 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_470_length_367, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000413 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_413_length_456, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000463 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_463_length_432, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000284 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_284_length_592, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000278 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_278_length_601, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000406 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_406_length_461, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000380 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_380_length_475, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000110 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_110_length_1288, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000346 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_346_length_506, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000347 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_347_length_504, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000422 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_422_length_452, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000032 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_32b_length_71450, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000337 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_337_length_514, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000164 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_164_length_984, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000146 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_146_length_1071, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000257 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_257_length_641, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000394 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_394_length_465, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000390 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_390_length_468, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000445 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_445_length_440, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000454 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_454_length_436, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000259 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_259_length_640, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000436 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_436_length_444, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000433 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_433_length_445, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000260 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_260_length_638, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000261 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_261a_length_531, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000194 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_194_length_871, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000059 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_59a_length_20128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000280 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_280b_length_433, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000288 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_288_length_584, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000316 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_316_length_546, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000205 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_205_length_824, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000228 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_228_length_725, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000302 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_302_length_560, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000113 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_113_length_1278, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000384 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_384_length_470, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000050 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_50_length_32985, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000080 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_80_length_2601, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000123 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_123a_length_948, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000354 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_354_length_498, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000265 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_265_length_636, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000379 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_379_length_476, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000338 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_338_length_514, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000183 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_183_length_915, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000027 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_27_length_106451, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000372 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_372_length_480, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000023 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_23_length_115079, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000159 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_159_length_1008, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000007 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_7_length_246973, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000343 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_343_length_508, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000178 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_178_length_931, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000244 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_244_length_675, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000124 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_124_length_1198, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000225 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_225a_length_681, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000013 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_13_length_168743, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000057 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_57_length_25722, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000414 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_414_length_455, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000065 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_65a_length_9935, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000003 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_3_length_404382, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000180 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_180_length_923, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000344 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_344_length_508, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000421 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_421_length_452, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000291 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_291_length_578, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000249 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_249_length_663, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000144 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_144_length_1079, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000185 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_185_length_909, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000245 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_245_length_674, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000388 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_388_length_469, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000046 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_46_length_36379, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000219 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_219_length_750, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000143 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_143_length_1081, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000275 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_275_length_606, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000466 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_466_length_432, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000456 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_456_length_434, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000233 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_233_length_710, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000056 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_56_length_26352, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000396 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_396_length_465, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000410 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_410_length_458, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000015 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_15_length_156727, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000427 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_427_length_447, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000425 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_425_length_448, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000328 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_328_length_523, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000293 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_293_length_577, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000429 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_429_length_446, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000063 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_63_length_11992, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_NFFQ01000129 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_129_length_1160, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000402 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_402_length_464, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000334 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_334_length_519, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000440 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_440_length_442, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000264 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_264_length_636, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000333 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_333_length_520, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000443 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_443_length_442, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000209 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_209_length_811, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000392 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_392_length_468, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000326 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_326_length_525, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000213 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_213_length_780, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000141 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_141_length_1088, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000320 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_320_length_536, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000356 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_356_length_497, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000296 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_296_length_573, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000018 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_18_length_150369, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000424 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_424_length_448, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000206 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_206_length_823, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000014 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_14_length_157157, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000199 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_199_length_849, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000312 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_312_length_548, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000376 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_376_length_477, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000332 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_332_length_521, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000186 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_186_length_908, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000290 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_290_length_579, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_NFFQ01000353 | Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_353_length_501, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 14649 : 24915 | 13 | Pseudomonas_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 54 : 9662 | 14 | Pseudomonas_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NFFQ01000040_1 | 492-598 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NFFQ01000040_2 | 14840-14993 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_NFFQ01000040.1 | 14788-14839 | 0 | 1.0 |
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg Protospacer ****************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000040_1 | 521-569 | 49 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 70-118 | 0 | 1.0 | |
| NZ_NFFQ01000040_1 | 521-569 | 49 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 16822-16870 | 0 | 1.0 | |
| NZ_NFFQ01000040_1 | 521-569 | 49 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47222-47270 | 0 | 1.0 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 14228-14279 | 3 | 0.942 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 2667-2718 | 3 | 0.942 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 62315-62366 | 3 | 0.942 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11666-11717 | 3 | 0.942 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 14332-14383 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 60445-60496 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11354-11405 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11562-11613 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11875-11926 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP025052 | Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence | 31415-31466 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP025052 | Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence | 31519-31570 | 4 | 0.923 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 2460-2511 | 5 | 0.904 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 2564-2615 | 5 | 0.904 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP025052 | Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence | 31623-31674 | 5 | 0.904 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11250-11301 | 6 | 0.885 | |
| NZ_NFFQ01000040_2 | 14891-14942 | 52 | NZ_CP025052 | Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence | 3258-3309 | 8 | 0.846 |
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc Protospacer . *************************************************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc Protospacer . *************************************************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc Protospacer . *************************************************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gcgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggc Protospacer *************************** *******************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc Protospacer . *********************************************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtaccggacggatccaccgcaccaggtgctcggcgccgccggcgccgatggc Protospacer *..************************ ***********************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc Protospacer *.************************* * *********************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggc Protospacer *.************************* *******************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggt Protospacer *.************************* *******************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc Protospacer *.************************* * *********************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc Protospacer *.************************* * *********************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccagacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc Protospacer . ***.*****************************************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccagacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc Protospacer . ***.*****************************************.***
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccacggcaccaggtgctcggcgccgccggcgccgatggc Protospacer . *************** ********* ***********************
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer aggccggacggatccacggcaccaggtgctcggcgccgccggcgccgatgac Protospacer . *************** ********* **********************.
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg CRISPR spacer tcgagtaatggatccaccgcaccaggtcctcggcgccgccggcgccggtggc Protospacer ** .*.**************************************.***
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 57 aa aa | AcrIC4 | NA | NA | No | NA |
| 100 aa aa | AcrIC3 | NA | NA | No | NA |
| 140 aa aa | AcrIF3 | NA | NA | No | NA |
| 100 aa aa | AcrIE1 | NA | NA | No | NA |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NFFQ01000045_1 | 36564-37432 | Orphan |
I-F
|
14 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000045_1 | 36833-36863 | 31 | MK819239 | Pseudomonas phage vB_PaeP_YA3, complete genome | 38679-38709 | 0 | 1.0 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | NC_031091 | Pseudomonas phage MD8, complete genome | 29507-29537 | 0 | 1.0 | |
| NZ_NFFQ01000045_1 | 36832-36863 | 32 | MK819239 | Pseudomonas phage vB_PaeP_YA3, complete genome | 38679-38710 | 0 | 1.0 | |
| NZ_NFFQ01000045_1 | 36952-36983 | 32 | NC_031091 | Pseudomonas phage MD8, complete genome | 29506-29537 | 0 | 1.0 | |
| NZ_NFFQ01000045_1 | 36952-36985 | 34 | NC_031091 | Pseudomonas phage MD8, complete genome | 29506-29539 | 0 | 1.0 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | NC_030931 | Pseudomonas phage phi2, complete genome | 5833-5863 | 1 | 0.968 | |
| NZ_NFFQ01000045_1 | 37073-37103 | 31 | MT613935 | Pseudomonas phage Persinger, complete genome | 10409-10439 | 1 | 0.968 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | MT613935 | Pseudomonas phage Persinger, complete genome | 15440-15470 | 1 | 0.968 | |
| NZ_NFFQ01000045_1 | 36952-36983 | 32 | NC_030931 | Pseudomonas phage phi2, complete genome | 5832-5863 | 1 | 0.969 | |
| NZ_NFFQ01000045_1 | 37072-37103 | 32 | MT613935 | Pseudomonas phage Persinger, complete genome | 10408-10439 | 1 | 0.969 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | MT613935 | Pseudomonas phage Persinger, complete genome | 15440-15471 | 1 | 0.969 | |
| NZ_NFFQ01000045_1 | 36952-36985 | 34 | NC_030931 | Pseudomonas phage phi2, complete genome | 5832-5865 | 1 | 0.971 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | MG707188 | Pseudomonas phage TC7, partial genome | 14901-14931 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 14350-14380 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 37193-37223 | 31 | MG707188 | Pseudomonas phage TC7, partial genome | 10188-10218 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 37193-37223 | 31 | NC_031091 | Pseudomonas phage MD8, complete genome | 25085-25115 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 37373-37403 | 31 | KC900378 | Pseudomonas phage LKA5, complete genome | 62887-62917 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 37373-37403 | 31 | LT603684 | Pseudomonas phage phiC725A genome assembly | 62290-62320 | 2 | 0.935 | |
| NZ_NFFQ01000045_1 | 36952-36983 | 32 | MG707188 | Pseudomonas phage TC7, partial genome | 14900-14931 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 36952-36983 | 32 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 14350-14381 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 37192-37223 | 32 | MG707188 | Pseudomonas phage TC7, partial genome | 10187-10218 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 37192-37223 | 32 | NC_031091 | Pseudomonas phage MD8, complete genome | 25084-25115 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 37372-37403 | 32 | KC900378 | Pseudomonas phage LKA5, complete genome | 62886-62917 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 37372-37403 | 32 | LT603684 | Pseudomonas phage phiC725A genome assembly | 62289-62320 | 2 | 0.938 | |
| NZ_NFFQ01000045_1 | 36832-36865 | 34 | MK819239 | Pseudomonas phage vB_PaeP_YA3, complete genome | 38677-38710 | 2 | 0.941 | |
| NZ_NFFQ01000045_1 | 36952-36985 | 34 | MG707188 | Pseudomonas phage TC7, partial genome | 14900-14933 | 2 | 0.941 | |
| NZ_NFFQ01000045_1 | 36952-36985 | 34 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 14348-14381 | 2 | 0.941 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | MT613935 | Pseudomonas phage Persinger, complete genome | 15438-15471 | 2 | 0.941 | |
| NZ_NFFQ01000045_1 | 37072-37105 | 34 | MT613935 | Pseudomonas phage Persinger, complete genome | 10408-10441 | 3 | 0.912 | |
| NZ_NFFQ01000045_1 | 37192-37225 | 34 | MG707188 | Pseudomonas phage TC7, partial genome | 10187-10220 | 3 | 0.912 | |
| NZ_NFFQ01000045_1 | 37192-37225 | 34 | NC_031091 | Pseudomonas phage MD8, complete genome | 25084-25117 | 3 | 0.912 | |
| NZ_NFFQ01000045_1 | 37372-37405 | 34 | KC900378 | Pseudomonas phage LKA5, complete genome | 62886-62919 | 4 | 0.882 | |
| NZ_NFFQ01000045_1 | 37372-37405 | 34 | LT603684 | Pseudomonas phage phiC725A genome assembly | 62289-62322 | 4 | 0.882 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_LR594668 | Variovorax sp. SRS16 plasmid 3 | 207706-207736 | 6 | 0.806 | |
| NZ_NFFQ01000045_1 | 36893-36923 | 31 | NC_012209 | Yersinia enterocolitica plasmid pYe4449-2, complete sequence | 7985-8015 | 6 | 0.806 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | KC292028 | Halovirus HCTV-2, complete genome | 25345-25375 | 6 | 0.806 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NC_009339 | Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence | 264308-264338 | 6 | 0.806 | |
| NZ_NFFQ01000045_1 | 36892-36923 | 32 | NC_012209 | Yersinia enterocolitica plasmid pYe4449-2, complete sequence | 7985-8016 | 6 | 0.812 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | NZ_CP016820 | Rhodococcus sp. p52 plasmid pDF02, complete sequence | 46452-46482 | 7 | 0.774 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | KC710998 | Shigella phage pSf-1, complete genome | 10831-10861 | 7 | 0.774 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049853 | Escherichia phage Henu8, complete genome | 47079-47109 | 7 | 0.774 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_LR594668 | Variovorax sp. SRS16 plasmid 3 | 207705-207736 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | KC292028 | Halovirus HCTV-2, complete genome | 25345-25376 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP026091 | Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence | 304446-304477 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NC_009339 | Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence | 264307-264338 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP026093 | Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence | 304410-304441 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP012940 | Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence | 1698094-1698125 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP012944 | Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence | 1714799-1714830 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NC_017575 | Ralstonia solanacearum Po82 megaplasmid, complete sequence | 304236-304267 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP026308 | Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence | 304222-304253 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP051295 | Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence | 1679054-1679085 | 7 | 0.781 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NC_020062 | Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence | 1119857-1119887 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | AF165214 | Bacteriophage D3, complete genome | 51521-51551 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 36893-36923 | 31 | NZ_CP022992 | Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence | 424508-424538 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 36953-36983 | 31 | NZ_LR594663 | Variovorax sp. RA8 plasmid 2 | 68369-68399 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37193-37223 | 31 | MT024869 | Arthrobacter phage Lego, complete genome | 1347-1377 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850572 | Escherichia phage aaroes, complete genome | 3969-3999 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065657 | UNVERIFIED: Campylobacter phage C4, complete genome | 24154-24184 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065675 | UNVERIFIED: Campylobacter phage A118, complete genome | 10589-10619 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065687 | UNVERIFIED: Campylobacter phage A136, complete genome | 33677-33707 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065649 | UNVERIFIED: Campylobacter phage A143, complete genome | 32336-32366 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850604 | Escherichia phage tunzivis, complete genome | 3405-3435 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065667 | UNVERIFIED: Campylobacter phage A127, complete genome | 34708-34738 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850582 | Escherichia phage ityhuna, complete genome | 45102-45132 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065671 | UNVERIFIED: Campylobacter phage A120, complete genome | 42692-42722 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049823 | Escherichia phage herni, complete genome | 12097-12127 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850591 | Escherichia phage aalborv, complete genome | 42877-42907 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065679 | UNVERIFIED: Campylobacter phage A13a, complete genome | 18242-18272 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065665 | UNVERIFIED: Campylobacter phage A131, complete genome | 33513-33543 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065685 | UNVERIFIED: Campylobacter phage A112a, complete genome | 13701-13731 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MK373798 | Escherichia phage vB_EcoS_G29-2, complete genome | 46051-46081 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065663 | UNVERIFIED: Campylobacter phage A134, complete genome | 33513-33543 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065670 | UNVERIFIED: Campylobacter phage A121, complete genome | 26940-26970 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065681 | UNVERIFIED: Campylobacter phage A139, complete genome | 34738-34768 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065638 | UNVERIFIED: Campylobacter phage A15a, complete genome | 9897-9927 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049817 | Escherichia phage tonnikala, complete genome | 8832-8862 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | LT841304 | Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I | 42511-42541 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049830 | Escherichia phage PGN590, complete genome | 13686-13716 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850607 | Escherichia phage egaa, complete genome | 6526-6556 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065640 | UNVERIFIED: Campylobacter phage A14b, complete genome | 2380-2410 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850600 | Escherichia phage haarsle, complete genome | 43068-43098 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | LR596614 | Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 | 14157-14187 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_048206 | Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 | 28151-28181 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850586 | Escherichia phage orkinos, complete genome | 38180-38210 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN781674 | Escherichia phage vB_EcoS_XY3, complete genome | 45484-45514 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | LR027385 | Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 | 49392-49422 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MK962751 | Shigella phage JK16, complete genome | 9016-9046 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065673 | UNVERIFIED: Campylobacter phage A119, complete genome | 26430-26460 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049819 | Escherichia phage atuna, complete genome | 49058-49088 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850634 | Escherichia phage tinuso, complete genome | 50705-50735 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065641 | UNVERIFIED: Campylobacter phage A14a, complete genome | 28830-28860 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065680 | UNVERIFIED: Campylobacter phage A113, complete genome | 32884-32914 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_047938 | Escherichia phage SECphi27 genome assembly, complete genome: monopartite | 4973-5003 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065669 | UNVERIFIED: Campylobacter phage A123, complete genome | 10573-10603 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850638 | Escherichia phage tunus, complete genome | 38189-38219 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049825 | Escherichia phage grams, complete genome | 47811-47841 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065643 | UNVERIFIED: Campylobacter phage E6, complete genome | 47557-47587 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049815 | Escherichia phage tonn, complete genome | 19175-19205 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_049827 | Escherichia phage damhaus, complete genome | 29537-29567 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850641 | Escherichia phage tonijn, complete genome | 30004-30034 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MT360681 | Shigella virus 2019SD1, complete genome | 37951-37981 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MG065636 | UNVERIFIED: Campylobacter phage A16a, complete genome | 26399-26429 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_019849 | Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence | 88120-88150 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_003078 | Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence | 1652988-1653018 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP019586 | Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence | 1611013-1611043 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP013110 | Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence | 1389681-1389711 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_017326 | Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence | 87938-87968 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021799 | Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence | 37193-37223 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 1554268-1554298 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_017323 | Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence | 1330349-1330379 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP009146 | Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence | 88231-88261 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_018701 | Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence | 88118-88148 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021828 | Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence | 1216520-1216550 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021802 | Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence | 354208-354238 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP032695 | Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence | 1879922-1879952 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021820 | Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence | 417845-417875 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021831 | Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence | 340223-340253 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP013054 | Sinorhizobium americanum CCGM7 plasmid C, complete sequence | 1021367-1021397 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021823 | Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence | 1337293-1337323 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021814 | Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence | 1654480-1654510 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021795 | Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence | 881850-881880 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021810 | Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence | 876912-876942 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021806 | Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence | 926709-926739 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP021218 | Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence | 241430-241460 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP024314 | Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence | 1073755-1073785 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP026527 | Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence | 90837-90867 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP019484 | Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence | 180126-180156 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_CP019487 | Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence | 1543597-1543627 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NC_020560 | Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence | 1653004-1653034 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP043441 | Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence | 1488014-1488044 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP045549 | Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence | 92256-92286 | 8 | 0.742 | |
| NZ_NFFQ01000045_1 | 36952-36983 | 32 | NZ_LR594663 | Variovorax sp. RA8 plasmid 2 | 68369-68400 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | KC710998 | Shigella phage pSf-1, complete genome | 10830-10861 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049853 | Escherichia phage Henu8, complete genome | 47078-47109 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP043441 | Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence | 1488014-1488045 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP045549 | Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence | 92256-92287 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP054033 | Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence | 418821-418852 | 8 | 0.75 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | KC292028 | Halovirus HCTV-2, complete genome | 25343-25376 | 8 | 0.765 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022775 | Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence | 1489937-1489967 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022762 | Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence | 1410947-1410977 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP029831 | Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence | 95575-95605 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP023017 | Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence | 1482854-1482884 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP014703 | Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence | 1409969-1409999 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022771 | Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence | 1410939-1410969 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022777 | Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence | 1410292-1410322 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022799 | Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence | 1410930-1410960 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022764 | Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence | 1490096-1490126 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022797 | Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence | 1490077-1490107 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | CP011998 | Ralstonia solanacearum strain YC45 plasmid, complete sequence | 1618124-1618154 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NZ_CP022758 | Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence | 1490060-1490090 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36653-36683 | 31 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 702020-702050 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36893-36923 | 31 | NZ_LR134459 | Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence | 87399-87429 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36893-36923 | 31 | NC_022042 | Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence | 83492-83522 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | NZ_LN831184 | Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence | 298272-298302 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850643 | Escherichia phage tiwna, complete genome | 41000-41030 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MF564201 | Escherichia phage vB_EcoS-95, complete genome | 9420-9450 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37253-37283 | 31 | MN850569 | Escherichia phage vojen, complete genome | 46678-46708 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP020970 | Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence | 1090-1120 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP003988 | Streptomyces sp. 769 plasmid pSGZL, complete sequence | 31533-31563 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP011665 | Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence | 390547-390577 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP033582 | Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence | 243597-243627 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP024314 | Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence | 318114-318144 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | NZ_CP054033 | Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence | 418822-418852 | 9 | 0.71 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NC_020062 | Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence | 1119856-1119887 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | AF165214 | Bacteriophage D3, complete genome | 51520-51551 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NC_016585 | Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence | 702019-702050 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 36892-36923 | 32 | NZ_CP022992 | Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence | 424508-424539 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37192-37223 | 32 | MT024869 | Arthrobacter phage Lego, complete genome | 1347-1378 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850572 | Escherichia phage aaroes, complete genome | 3968-3999 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065657 | UNVERIFIED: Campylobacter phage C4, complete genome | 24153-24184 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065675 | UNVERIFIED: Campylobacter phage A118, complete genome | 10588-10619 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065687 | UNVERIFIED: Campylobacter phage A136, complete genome | 33676-33707 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065649 | UNVERIFIED: Campylobacter phage A143, complete genome | 32335-32366 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850604 | Escherichia phage tunzivis, complete genome | 3404-3435 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065667 | UNVERIFIED: Campylobacter phage A127, complete genome | 34708-34739 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850582 | Escherichia phage ityhuna, complete genome | 45101-45132 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065671 | UNVERIFIED: Campylobacter phage A120, complete genome | 42691-42722 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049823 | Escherichia phage herni, complete genome | 12096-12127 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850591 | Escherichia phage aalborv, complete genome | 42877-42908 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065679 | UNVERIFIED: Campylobacter phage A13a, complete genome | 18241-18272 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065665 | UNVERIFIED: Campylobacter phage A131, complete genome | 33512-33543 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065685 | UNVERIFIED: Campylobacter phage A112a, complete genome | 13701-13732 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MK373798 | Escherichia phage vB_EcoS_G29-2, complete genome | 46050-46081 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065663 | UNVERIFIED: Campylobacter phage A134, complete genome | 33512-33543 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065670 | UNVERIFIED: Campylobacter phage A121, complete genome | 26939-26970 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065681 | UNVERIFIED: Campylobacter phage A139, complete genome | 34738-34769 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065638 | UNVERIFIED: Campylobacter phage A15a, complete genome | 9896-9927 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049817 | Escherichia phage tonnikala, complete genome | 8831-8862 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | LT841304 | Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I | 42511-42542 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049830 | Escherichia phage PGN590, complete genome | 13686-13717 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850607 | Escherichia phage egaa, complete genome | 6526-6557 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065640 | UNVERIFIED: Campylobacter phage A14b, complete genome | 2379-2410 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850600 | Escherichia phage haarsle, complete genome | 43067-43098 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | LR596614 | Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 | 14157-14188 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_048206 | Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 | 28151-28182 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850586 | Escherichia phage orkinos, complete genome | 38179-38210 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN781674 | Escherichia phage vB_EcoS_XY3, complete genome | 45483-45514 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | LR027385 | Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 | 49392-49423 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MK962751 | Shigella phage JK16, complete genome | 9015-9046 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065673 | UNVERIFIED: Campylobacter phage A119, complete genome | 26430-26461 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049819 | Escherichia phage atuna, complete genome | 49058-49089 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850634 | Escherichia phage tinuso, complete genome | 50704-50735 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065641 | UNVERIFIED: Campylobacter phage A14a, complete genome | 28829-28860 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065680 | UNVERIFIED: Campylobacter phage A113, complete genome | 32883-32914 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_047938 | Escherichia phage SECphi27 genome assembly, complete genome: monopartite | 4972-5003 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065669 | UNVERIFIED: Campylobacter phage A123, complete genome | 10572-10603 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850638 | Escherichia phage tunus, complete genome | 38189-38220 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049825 | Escherichia phage grams, complete genome | 47810-47841 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065643 | UNVERIFIED: Campylobacter phage E6, complete genome | 47556-47587 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049815 | Escherichia phage tonn, complete genome | 19175-19206 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_049827 | Escherichia phage damhaus, complete genome | 29536-29567 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850641 | Escherichia phage tonijn, complete genome | 30003-30034 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MT360681 | Shigella virus 2019SD1, complete genome | 37951-37982 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MG065636 | UNVERIFIED: Campylobacter phage A16a, complete genome | 26398-26429 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_019849 | Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence | 88119-88150 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_003078 | Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence | 1652988-1653019 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP019586 | Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence | 1611013-1611044 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP013110 | Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence | 1389681-1389712 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_017326 | Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence | 87937-87968 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021799 | Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence | 37193-37224 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 1554268-1554299 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_017323 | Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence | 1330348-1330379 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP009146 | Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence | 88230-88261 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_018701 | Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence | 88117-88148 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021828 | Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence | 1216520-1216551 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021802 | Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence | 354207-354238 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP032695 | Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence | 1879921-1879952 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021820 | Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence | 417844-417875 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021831 | Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence | 340222-340253 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP013054 | Sinorhizobium americanum CCGM7 plasmid C, complete sequence | 1021366-1021397 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021823 | Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence | 1337293-1337324 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021814 | Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence | 1654479-1654510 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021795 | Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence | 881850-881881 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021810 | Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence | 876911-876942 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021806 | Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence | 926709-926740 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP021218 | Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence | 241429-241460 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP024314 | Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence | 1073754-1073785 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP026527 | Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence | 90836-90867 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP019484 | Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence | 180126-180157 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_LN831184 | Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence | 298271-298302 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NZ_CP019487 | Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence | 1543597-1543628 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | NC_020560 | Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence | 1653004-1653035 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP020970 | Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence | 1089-1120 | 9 | 0.719 | |
| NZ_NFFQ01000045_1 | 36652-36685 | 34 | NZ_LR594668 | Variovorax sp. SRS16 plasmid 3 | 207705-207738 | 9 | 0.735 | |
| NZ_NFFQ01000045_1 | 36952-36985 | 34 | NZ_LR594663 | Variovorax sp. RA8 plasmid 2 | 68367-68400 | 9 | 0.735 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | NZ_CP043441 | Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence | 1488012-1488045 | 9 | 0.735 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | NZ_CP045549 | Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence | 92254-92287 | 9 | 0.735 | |
| NZ_NFFQ01000045_1 | 37313-37343 | 31 | MN234185 | Mycobacterium phage Lemuria, complete genome | 25915-25945 | 10 | 0.677 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022775 | Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence | 1489937-1489968 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022762 | Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence | 1410947-1410978 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP029831 | Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence | 95574-95605 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP023017 | Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence | 1482854-1482885 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP014703 | Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence | 1409969-1410000 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022771 | Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence | 1410939-1410970 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022777 | Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence | 1410292-1410323 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022799 | Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence | 1410930-1410961 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022764 | Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence | 1490096-1490127 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022797 | Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence | 1490077-1490108 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | CP011998 | Ralstonia solanacearum strain YC45 plasmid, complete sequence | 1618123-1618154 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36683 | 32 | NZ_CP022758 | Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence | 1490060-1490091 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36892-36923 | 32 | NZ_LR134459 | Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence | 87398-87429 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36892-36923 | 32 | NC_022042 | Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence | 83491-83522 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850643 | Escherichia phage tiwna, complete genome | 40999-41030 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MF564201 | Escherichia phage vB_EcoS-95, complete genome | 9419-9450 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37252-37283 | 32 | MN850569 | Escherichia phage vojen, complete genome | 46677-46708 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP003988 | Streptomyces sp. 769 plasmid pSGZL, complete sequence | 31533-31564 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP011665 | Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence | 390547-390578 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP033582 | Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence | 243596-243627 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | NZ_CP024314 | Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence | 318113-318144 | 10 | 0.688 | |
| NZ_NFFQ01000045_1 | 36652-36685 | 34 | AF165214 | Bacteriophage D3, complete genome | 51520-51553 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 36652-36685 | 34 | NC_020062 | Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence | 1119856-1119889 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | KC710998 | Shigella phage pSf-1, complete genome | 10830-10863 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049853 | Escherichia phage Henu8, complete genome | 47078-47111 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065657 | UNVERIFIED: Campylobacter phage C4, complete genome | 24153-24186 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065675 | UNVERIFIED: Campylobacter phage A118, complete genome | 10588-10621 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065687 | UNVERIFIED: Campylobacter phage A136, complete genome | 33676-33709 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065649 | UNVERIFIED: Campylobacter phage A143, complete genome | 32335-32368 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065667 | UNVERIFIED: Campylobacter phage A127, complete genome | 34706-34739 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065679 | UNVERIFIED: Campylobacter phage A13a, complete genome | 18241-18274 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065665 | UNVERIFIED: Campylobacter phage A131, complete genome | 33512-33545 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065685 | UNVERIFIED: Campylobacter phage A112a, complete genome | 13699-13732 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065663 | UNVERIFIED: Campylobacter phage A134, complete genome | 33512-33545 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065681 | UNVERIFIED: Campylobacter phage A139, complete genome | 34736-34769 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065638 | UNVERIFIED: Campylobacter phage A15a, complete genome | 9896-9929 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065640 | UNVERIFIED: Campylobacter phage A14b, complete genome | 2379-2412 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065673 | UNVERIFIED: Campylobacter phage A119, complete genome | 26428-26461 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065641 | UNVERIFIED: Campylobacter phage A14a, complete genome | 28829-28862 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065680 | UNVERIFIED: Campylobacter phage A113, complete genome | 32883-32916 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065669 | UNVERIFIED: Campylobacter phage A123, complete genome | 10572-10605 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065643 | UNVERIFIED: Campylobacter phage E6, complete genome | 47556-47589 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065636 | UNVERIFIED: Campylobacter phage A16a, complete genome | 26398-26431 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | NZ_CP020970 | Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence | 1089-1122 | 10 | 0.706 | |
| NZ_NFFQ01000045_1 | 37312-37343 | 32 | MN234185 | Mycobacterium phage Lemuria, complete genome | 25915-25946 | 11 | 0.656 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850572 | Escherichia phage aaroes, complete genome | 3968-4001 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850604 | Escherichia phage tunzivis, complete genome | 3404-3437 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850582 | Escherichia phage ityhuna, complete genome | 45101-45134 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065671 | UNVERIFIED: Campylobacter phage A120, complete genome | 42691-42724 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049823 | Escherichia phage herni, complete genome | 12096-12129 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850591 | Escherichia phage aalborv, complete genome | 42875-42908 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MK373798 | Escherichia phage vB_EcoS_G29-2, complete genome | 46050-46083 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MG065670 | UNVERIFIED: Campylobacter phage A121, complete genome | 26939-26972 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049817 | Escherichia phage tonnikala, complete genome | 8831-8864 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | LT841304 | Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I | 42509-42542 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049830 | Escherichia phage PGN590, complete genome | 13684-13717 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850607 | Escherichia phage egaa, complete genome | 6524-6557 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850600 | Escherichia phage haarsle, complete genome | 43067-43100 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | LR596614 | Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 | 14155-14188 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_048206 | Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 | 28149-28182 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850586 | Escherichia phage orkinos, complete genome | 38179-38212 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN781674 | Escherichia phage vB_EcoS_XY3, complete genome | 45483-45516 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | LR027385 | Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 | 49390-49423 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MK962751 | Shigella phage JK16, complete genome | 9015-9048 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049819 | Escherichia phage atuna, complete genome | 49056-49089 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850634 | Escherichia phage tinuso, complete genome | 50704-50737 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_047938 | Escherichia phage SECphi27 genome assembly, complete genome: monopartite | 4972-5005 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850638 | Escherichia phage tunus, complete genome | 38187-38220 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049825 | Escherichia phage grams, complete genome | 47810-47843 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049815 | Escherichia phage tonn, complete genome | 19173-19206 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | NC_049827 | Escherichia phage damhaus, complete genome | 29536-29569 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MN850641 | Escherichia phage tonijn, complete genome | 30003-30036 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37252-37285 | 34 | MT360681 | Shigella virus 2019SD1, complete genome | 37949-37982 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | NZ_CP011665 | Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence | 390545-390578 | 11 | 0.676 | |
| NZ_NFFQ01000045_1 | 37312-37345 | 34 | NZ_CP033582 | Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence | 243596-243629 | 11 | 0.676 |
agggaaggctcgcgtttcgcctccccaccga CRISPR spacer agggaaggctcgcgtttcgcctccccaccga Protospacer *******************************
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer ggatgtcgcagtccatcagccgcttgatccc Protospacer *******************************
aagggaaggctcgcgtttcgcctccccaccga CRISPR spacer aagggaaggctcgcgtttcgcctccccaccga Protospacer ********************************
aggatgtcgcagtccatcagccgcttgatccc CRISPR spacer aggatgtcgcagtccatcagccgcttgatccc Protospacer ********************************
aggatgtcgcagtccatcagccgcttgatcccgt CRISPR spacer aggatgtcgcagtccatcagccgcttgatcccgt Protospacer **********************************
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer gaatgtcgcagtccatcagccgcttgatccc Protospacer *.*****************************
ttgtgggtcgccagctgcagacgttcacgac CRISPR spacer tagtgggtcgccagctgcagacgttcacgac Protospacer * *****************************
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer tcaaagggccgagcgtgccgcgcagcctgct Protospacer ****.**************************
aggatgtcgcagtccatcagccgcttgatccc CRISPR spacer agaatgtcgcagtccatcagccgcttgatccc Protospacer **.*****************************
attgtgggtcgccagctgcagacgttcacgac CRISPR spacer atagtgggtcgccagctgcagacgttcacgac Protospacer ** *****************************
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcaaagggccgagcgtgccgcgcagcctgct Protospacer *****.**************************
aggatgtcgcagtccatcagccgcttgatcccgt CRISPR spacer agaatgtcgcagtccatcagccgcttgatcccgt Protospacer **.*******************************
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer gaatgtcgcagtccatcaaccgcttgatccc Protospacer *.****************.************
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer gaatgtcgcagtccatgagccgcttgatccc Protospacer *.************** **************
atcaggctagccatgacgggctccattacgc CRISPR spacer atcaggctagccattaccggctccattacgc Protospacer ************** ** *************
atcaggctagccatgacgggctccattacgc CRISPR spacer atcaggctagccattaccggctccattacgc Protospacer ************** ** *************
ggagtacatgccgagggcgtctgtgaccata CRISPR spacer tgagtacatgccgagggcgtcggtgaccata Protospacer ******************** *********
ggagtacatgccgagggcgtctgtgaccata CRISPR spacer tgagtacatgccgagggcgtcggtgaccata Protospacer ******************** *********
aggatgtcgcagtccatcagccgcttgatccc CRISPR spacer agaatgtcgcagtccatcaaccgcttgatccc Protospacer **.****************.************
aggatgtcgcagtccatcagccgcttgatccc CRISPR spacer agaatgtcgcagtccatgagccgcttgatccc Protospacer **.************** **************
gatcaggctagccatgacgggctccattacgc CRISPR spacer gatcaggctagccattaccggctccattacgc Protospacer *************** ** *************
gatcaggctagccatgacgggctccattacgc CRISPR spacer gatcaggctagccattaccggctccattacgc Protospacer *************** ** *************
aggagtacatgccgagggcgtctgtgaccata CRISPR spacer atgagtacatgccgagggcgtcggtgaccata Protospacer * ******************** *********
aggagtacatgccgagggcgtctgtgaccata CRISPR spacer atgagtacatgccgagggcgtcggtgaccata Protospacer * ******************** *********
aagggaaggctcgcgtttcgcctccccaccgagg CRISPR spacer aagggaaggctcgcgtttcgcctccccaccgaac Protospacer ********************************.
aggatgtcgcagtccatcagccgcttgatcccgt CRISPR spacer agaatgtcgcagtccatcaaccgcttgatcccgt Protospacer **.****************.**************
aggatgtcgcagtccatcagccgcttgatcccgt CRISPR spacer agaatgtcgcagtccatgagccgcttgatcccgt Protospacer **.************** ****************
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer atcaaagggccgagcgtgccgcgcagcctgctgg Protospacer *****.***************************
attgtgggtcgccagctgcagacgttcacgacgt CRISPR spacer atagtgggtcgccagctgcagacgttcacgactg Protospacer ** *****************************
gatcaggctagccatgacgggctccattacgcgt CRISPR spacer gatcaggctagccattaccggctccattacgcgg Protospacer *************** ** **************
gatcaggctagccatgacgggctccattacgcgt CRISPR spacer gatcaggctagccattaccggctccattacgcgg Protospacer *************** ** **************
aggagtacatgccgagggcgtctgtgaccatagt CRISPR spacer atgagtacatgccgagggcgtcggtgaccatatc Protospacer * ******************** ********* .
aggagtacatgccgagggcgtctgtgaccatagt CRISPR spacer atgagtacatgccgagggcgtcggtgaccatatc Protospacer * ******************** ********* .
----acggattccgatgcggcgacttccagcccga CRISPR spacer
tgccgcg----ccgatgcggcgacttccagtccga Protospacer
.** *******************.****
tcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer tcgcggatgccacggcgcgggtcatctgggg Protospacer **************.***.****.*.*.* *
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer acagcaggccgagcgtgccgcccagcctgcc Protospacer **. .*************** ********.
tcaaggggccgagcgtgccgcgcagc-ctgct CRISPR spacer tgtaggggcccagcgtggcgcgcagcgccgc- Protospacer * ******* ****** ******** *.**
atcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer atcgcggatgccacggcgcgggtcatctgggg Protospacer ***************.***.****.*.*.* *
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer gctcgatgtagtccatcagccgcttcatccc Protospacer * .* .*.**************** *****
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcgt Protospacer * ***** ****.**************
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcgt Protospacer * ***** ****.**************
----aacggattccgatgcggcgacttccagcccga CRISPR spacer
ctgccgcg----ccgatgcggcgacttccagtccga Protospacer
.** *******************.****
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer gacagcaggccgagcgtgccgcccagcctgcc Protospacer . **. .*************** ********.
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagc-ctgct CRISPR spacer gtgtaggggcccagcgtggcgcgcagcgccgc- Protospacer .* ******* ****** ******** *.**
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer atcgagcggccgagcgtgccgcgattcaggct Protospacer ***.** **************** * ***
acggattccgatgcggcgacttccagcccga CRISPR spacer ctgcgcgccgatgcggcaacctccagcccga Protospacer .* .. **********.**.**********
acggattccgatgcggcgacttccagcccga CRISPR spacer tcatgcccctacgcggcgacttccagcccga Protospacer *. ...** *.*******************
tcgcggatgccacgacgcaggtcgtttagcg-- CRISPR spacer ctgcggacgccacgacgcagggcg--tggctgc Protospacer ..*****.************* ** *.**
ggatgtcgcagtccatcagccgcttgatccc CRISPR spacer ggatgtcgcagtcgatcagcggcgcggcgtc Protospacer ************* ****** ** .*.. .*
atcaggctagccatgacgggctccattacgc CRISPR spacer ttcaggccagccatgacggcctcctcgtcgg Protospacer ******.*********** **** . **
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttacccatttcagcatcatcaccagcat Protospacer * ***** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer ccttcgaccagttctacatcatgaccagcgg Protospacer .* * . ******* ******* *******.
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ggtggatgccgaacgtgcggcgcagcctgct Protospacer .*. *****.***** ************
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgctgtcgccgagcttgccgcgcaggctgct Protospacer . * ******* ********** *****
aggatgtcgcagtccatcagccgcttgatccc CRISPR spacer aggatgtcgcagtcgatcagcggcgcggcgtc Protospacer ************** ****** ** .*.. .*
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcgt Protospacer
* ***** ****.**************
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcgt Protospacer
* ***** ****.**************
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer aggtggatgccgaacgtgcggcgcagcctgct Protospacer * .*. *****.***** ************
-----atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer
ccgctgtc-----gccgagcttgccgcgcaggctgct Protospacer
.** ******* ********** *****
-----atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer
tcgatatc-----gccgagcgtgccgcgcaggatgcg Protospacer
*** ****************** ***
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer gacagcaggccgagcgtgccgcccagcctgccgg Protospacer . **. .*************** ********.*
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer gcatgggtcgatgcggcgacctccagcctga Protospacer .*. . .************.*******.**
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggtgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer ggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
acggattccgatgcggcgacttccagcccga CRISPR spacer gcctgggtcgatgcggcgacctccagcctga Protospacer .* . .************.*******.**
tcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer ccgcggatcccgcgacgcaggtcgggcccct Protospacer .******* **.************ . *
tcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer gcgcggatgccacggcgccggtcgggcaagt Protospacer *************.*** ***** .*.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer gtagttaccagttcatcatcatcaccaacgg Protospacer .* ******** ***********.**.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttgcccatttcagcatcatcaccagcat Protospacer * .**** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer aatttgcccatttcagcatcatcaccagcat Protospacer * .**** ****.*************.
tcatgacccagttcaacatcatcaccagcga CRISPR spacer agtttgcccatttcagcatcatcaccagcat Protospacer * .**** ****.*************.
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ggaagcggccgaacgtgccgcgcagcgcaag Protospacer *** ******.************* ..
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgatcttgccgagcgtgccgcgccgccggcc Protospacer . * **************** *** **.
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgctcgccccgagcttgccgcgcaggctgct Protospacer . * ****** ********** *****
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgctcgccccgagcttgccgcgcaggctgct Protospacer . * ****** ********** *****
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgagcttgcccagcgtgccgcgcaggctgcc Protospacer . *. *** ************** ****.
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgatatcgccgagcgtgccgcgcaggatgcg Protospacer . * . ****************** ***
aacggattccgatgcggcgacttccagcccga CRISPR spacer gctgcgcgccgatgcggcaacctccagcccga Protospacer . .* .. **********.**.**********
aacggattccgatgcggcgacttccagcccga CRISPR spacer ctcatgcccctacgcggcgacttccagcccga Protospacer *. ...** *.*******************
aacggattccgatgcggcgacttccagcccga CRISPR spacer agcctgggtcgatgcggcgacctccagcctga Protospacer *.* . .************.*******.**
atcgcggatgccacgacgcaggtcgtttagcg-- CRISPR spacer gctgcggacgccacgacgcagggcg--tggctgc Protospacer ...*****.************* ** *.**
gatcaggctagccatgacgggctccattacgc CRISPR spacer cttcaggccagccatgacggcctcctcgtcgg Protospacer ******.*********** **** . **
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttacccatttcagcatcatcaccagcat Protospacer
* ***** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
----atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tgtagtta----ccagttcatcatcatcaccaacgg Protospacer
.*.* ******** ***********.**.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer gccttcgaccagttctacatcatgaccagcgg Protospacer ..* * . ******* ******* *******.
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer aggaagcggccgaacgtgccgcgcagcgcaag Protospacer * *** ******.************* ..
----aacggattccgatgcggcgacttccagcccgagg CRISPR spacer
ctgccgcg----ccgatgcggcgacttccagtccgaca Protospacer
.** *******************.**** .
aggatgtcgcagtccatcagccgcttgatcccgt CRISPR spacer aggatgtcgcagtcgatcagcggcgcggcgtcct Protospacer ************** ****** ** .*.. .* *
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer aggtggatgccgaacgtgcggcgcagcctgctgg Protospacer * .*. *****.***** *************
-----atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer
ccgctgtc-----gccgagcttgccgcgcaggctgctga Protospacer
.** ******* ********** ******
tcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer cgccggggtcgagcgcgccgcgcagccacgg Protospacer . ****.******.***********
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cgcatgggtcgatgcggcgacctccagcctga Protospacer .*. . .************.*******.**
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggtgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
aacggattccgatgcggcgacttccagcccga CRISPR spacer cggcgtccccgatgcggcgatttccagtccgt Protospacer . * ..************.******.***
atcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer gccgcggatcccgcgacgcaggtcgggcccct Protospacer ..******* **.************ . *
atcgcggatgccacgacgcaggtcgtttagcg CRISPR spacer cgcgcggatgccacggcgccggtcgggcaagt Protospacer *************.*** ***** .*.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttgcccatttcagcatcatcaccagcat Protospacer
* .**** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
caatttgcccatttcagcatcatcaccagcat Protospacer
* .**** ****.*************.
atcatgacccagttcaacatcatcaccagcga CRISPR spacer
tagtttgcccatttcagcatcatcaccagcat Protospacer
* .**** ****.*************.
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ccgatcttgccgagcgtgccgcgccgccggcc Protospacer . * **************** *** **.
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ccgctcgccccgagcttgccgcgcaggctgct Protospacer . * ****** ********** *****
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ccgctcgccccgagcttgccgcgcaggctgct Protospacer . * ****** ********** *****
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer gcgagcttgcccagcgtgccgcgcaggctgcc Protospacer .. *. *** ************** ****.
aacggattccgatgcggcgacttccagcccgagg CRISPR spacer ctcatgcccctacgcggcgacttccagcccgagc Protospacer *. ...** *.********************
aacggattccgatgcggcgacttccagcccgagg CRISPR spacer gctgcgcgccgatgcggcaacctccagcccgatg Protospacer . .* .. **********.**.********** *
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcgtag Protospacer
* ***** ****.************** .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcgtag Protospacer
* ***** ****.************** .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat Protospacer
* ***** ****.*************. .*
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer aggaagcggccgaacgtgccgcgcagcgcaagct Protospacer * *** ******.************* .. *
atcaaggggccgagcgtgccgcgcagcctgct CRISPR spacer ccgccggggtcgagcgcgccgcgcagccacgg Protospacer . ****.******.***********
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
caatttacccatttcagcatcatcaccagcataa Protospacer
* ***** ****.*************. .
atcatgacccagttcaacatcatcaccagcgagt CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag Protospacer
* ***** ****.*************. .
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer ccgctcgccccgagcttgccgcgcaggctgctga Protospacer . * ****** ********** ******
atcaaggggccgagcgtgccgcgcagcctgctgt CRISPR spacer ccgctcgccccgagcttgccgcgcaggctgctga Protospacer . * ****** ********** ******
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NFFQ01000064_1 | 288-862 | TypeI-F |
I-F
|
9 spacers
|
cas6f,cas7f,cas5f,cas8f,cas3f,cas1 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_NFFQ01000064_2 | 9386-10796 | TypeI-F |
I-F
|
23 spacers
|
cas1,cas3f,cas8f,cas5f,cas7f,cas6f |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_KM670336 | Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence | 150606-150637 | 0 | 1.0 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP014764 | Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-704, complete sequence | 31661-31692 | 0 | 1.0 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP020602 | Pseudomonas aeruginosa strain E6130952 plasmid pJHX613, complete sequence | 30972-31003 | 0 | 1.0 | |
| NZ_NFFQ01000064_1 | 496-527 | 32 | NC_030931 | Pseudomonas phage phi2, complete genome | 5666-5697 | 0 | 1.0 | |
| NZ_NFFQ01000064_1 | 737-768 | 32 | HQ711985 | Pseudomonas phage vB_PaeS_PMG1, complete genome | 30578-30609 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10677-10708 | 32 | MK819239 | Pseudomonas phage vB_PaeP_YA3, complete genome | 4870-4901 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10677-10708 | 32 | NC_023575 | Pseudomonas phage vB_PaeP_Tr60_Ab31 | 4738-4769 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | MK511013 | Pseudomonas phage BR161, partial genome | 4426-4457 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | MK511002 | Pseudomonas phage CF57, partial genome | 4325-4356 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | MK511009 | Pseudomonas phage CF136, partial genome | 4281-4312 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | MK511003 | Pseudomonas phage CF65, partial genome | 4312-4343 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | KT887557 | Pseudomonas phage phi1, complete genome | 28596-28627 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | MK511005 | Pseudomonas phage CF81, partial genome | 4417-4448 | 0 | 1.0 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | NC_028657 | Pseudomonas phage YMC11/02/R656, complete genome | 50922-50953 | 0 | 1.0 | |
| NZ_NFFQ01000064_1 | 316-347 | 32 | NZ_CP045255 | Proteus mirabilis strain L90-1 plasmid pL902, complete sequence | 19422-19453 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP015073 | Escherichia coli strain Ecol_743 plasmid pEC743_4, complete sequence | 21833-21864 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP045255 | Proteus mirabilis strain L90-1 plasmid pL902, complete sequence | 19821-19852 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | AP018710 | Uncultured bacterium plasmid pSN1216-29 DNA, complete sequence | 29973-30004 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP021021 | Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pE, complete sequence | 22323-22354 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP021004 | Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pE, complete sequence | 33925-33956 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_006548 | Pseudomonas phage B3, complete genome | 25234-25265 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | AF232233 | Bacteriophage B3, complete genome | 25234-25265 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | KM389321 | UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000158 genomic sequence | 1134-1165 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | KM389212 | UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence | 11786-11817 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | KM389210 | UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence | 37314-37345 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | KM389463 | UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence | 37680-37711 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NC_023575 | Pseudomonas phage vB_PaeP_Tr60_Ab31 | 32878-32909 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NC_030929 | Pseudomonas phage JBD44, complete genome | 43163-43194 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NC_028657 | Pseudomonas phage YMC11/02/R656, complete genome | 4370-4401 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10256-10287 | 32 | KT887559 | Pseudomonas phage phi3, complete genome | 18643-18674 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | NC_026587 | Pseudomonas phage vB_PaeM_PAO1_Ab03, complete genome | 8602-8633 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 18100-18131 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | LN610581 | Pseudomonas phage vB_PaeM_PAO1_Ab04, complete genome | 8469-8500 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | LN610576 | Pseudomonas phage vB_PaeM_PAO1_Ab17, complete genome | 8932-8963 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | KT887557 | Pseudomonas phage phi1, complete genome | 52942-52973 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10376-10407 | 32 | NC_023575 | Pseudomonas phage vB_PaeP_Tr60_Ab31 | 10536-10567 | 1 | 0.969 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | MT613935 | Pseudomonas phage Persinger, complete genome | 15399-15431 | 1 | 0.97 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | NC_023575 | Pseudomonas phage vB_PaeP_Tr60_Ab31 | 42166-42197 | 1 | 0.969 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | NZ_CP046349 | Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed2, complete sequence | 31072-31103 | 2 | 0.938 | |
| NZ_NFFQ01000064_1 | 376-407 | 32 | KC170285 | Uncultured bacterium plasmid pMBUI2, complete sequence | 7570-7601 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_KY494864 | Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence | 123799-123830 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_KU130294 | Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence | 113804-113835 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_LT969519 | Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 | 148602-148633 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP009975 | Pseudomonas putida S12 plasmid pTTS12, complete sequence | 119419-119450 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP039989 | Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence | 112951-112982 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP039991 | Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence | 113104-113135 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_MN433457 | Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence | 165303-165334 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP029096 | Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence | 150729-150760 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP045003 | Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence | 440044-440075 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP045917 | Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence | 116452-116483 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP029094 | Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence | 398781-398812 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | MF344571 | Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence | 116234-116265 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | MF344568 | Pseudomonas aeruginosa plasmid p727-IMP, complete sequence | 118914-118945 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | MF344569 | Pseudomonas aeruginosa plasmid p12939-PER, complete sequence | 115504-115535 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | MF344570 | Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence | 117232-117263 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP039294 | Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence | 360806-360837 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | CP027478 | Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence | 190944-190975 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP027170 | Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence | 398692-398723 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP040126 | Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence | 116429-116460 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP015879 | Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence | 46122-46153 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_CP016215 | Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence | 188852-188883 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_KY883660 | Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence | 119882-119913 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | KT887559 | Pseudomonas phage phi3, complete genome | 19171-19202 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | HQ711985 | Pseudomonas phage vB_PaeS_PMG1, complete genome | 31640-31671 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MK511012 | Pseudomonas phage BR153, partial genome | 528-559 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NC_011373 | Pseudomonas phage PAJU2, complete genome | 35086-35117 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | AP009624 | Pseudomonas phage PAJU2 DNA, complete genome | 35086-35117 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KT887559 | Pseudomonas phage phi3, complete genome | 19219-19250 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | MG707188 | Pseudomonas phage TC7, partial genome | 10612-10643 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | KM389212 | UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence | 4934-4965 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | MK511012 | Pseudomonas phage BR153, partial genome | 49746-49777 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | KM389210 | UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence | 44166-44197 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | KM389463 | UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence | 43602-43633 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | NC_030931 | Pseudomonas phage phi2, complete genome | 1740-1771 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 10316-10347 | 32 | NC_030929 | Pseudomonas phage JBD44, complete genome | 37241-37272 | 2 | 0.938 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_011165 | Pseudomonas phage LBL3, complete genome | 53620-53651 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT491205 | Pseudomonas phage vB_PaeM_USP_2, complete genome | 54309-54340 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT933737 | Pseudomonas phage PASA16, complete genome | 25888-25919 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | KM389325 | UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence | 6443-6474 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | FM201281 | Pseudomonas phage LBL3 complete genome | 53620-53651 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MN615701 | Pseudomonas phage vB_PaeM_SMS21, complete genome | 55444-55475 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT118290 | Pseudomonas phage Epa10, complete genome | 65214-65245 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_048676 | Pseudomonas phage SL1, complete genome | 17250-17281 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | GU815091 | Pseudomonas phage JG024, complete genome | 54932-54963 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | KM389212 | UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence | 6903-6934 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT108727 | Pseudomonas phage Epa11, complete genome | 39910-39941 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MN131141 | Pseudomonas virus PaP1_EPu-2019, complete genome | 62174-62205 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | KM389210 | UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence | 42197-42228 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MN615700 | Pseudomonas phage vB_PaeM_SMS12, complete genome | 55142-55173 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | KR054033 | Pseudomonas phage DL68, complete genome | 20385-20416 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MK318076 | Pseudomonas phage vB_PaeM_fHoPae01, complete genome | 61981-62012 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_011703 | Pseudomonas phage 14-1, complete genome | 54848-54879 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT491204 | Pseudomonas phage vB_PaeM_USP_1, complete genome | 54267-54298 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MN131143 | Pseudomonas virus PA11P1, complete genome | 61611-61642 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MT119369 | Pseudomonas phage sortsol, complete genome | 54684-54715 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MN615702 | Pseudomonas phage vB_PaeM_SMS29, complete genome | 55269-55300 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MF623055 | Pseudomonas phage BrSP1, complete genome | 61752-61783 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_050147 | Pseudomonas phage Epa13, complete genome | 39970-40001 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_042080 | Pseudomonas phage vB_PaeM_E215, complete genome | 41825-41856 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_050148 | Pseudomonas virus Pa193, complete genome | 62212-62243 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | NC_011373 | Pseudomonas phage PAJU2, complete genome | 35168-35199 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | AP009624 | Pseudomonas phage PAJU2 DNA, complete genome | 35168-35199 | 3 | 0.906 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | AF165214 | Bacteriophage D3, complete genome | 40700-40731 | 4 | 0.875 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MG676466 | Pseudomonas phage TC6, complete genome | 35473-35504 | 4 | 0.875 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NC_031274 | Pseudomonas phage O4, complete genome | 37306-37337 | 4 | 0.875 | |
| NZ_NFFQ01000064_1 | 737-768 | 32 | MK511012 | Pseudomonas phage BR153, partial genome | 49801-49832 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 9895-9926 | 32 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 14335-14366 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | MK511034 | Pseudomonas phage BR243, partial genome | 38120-38151 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | MK511002 | Pseudomonas phage CF57, partial genome | 46758-46789 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | MK511003 | Pseudomonas phage CF65, partial genome | 46745-46776 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | MK511022 | Pseudomonas phage CF74, partial genome | 42693-42724 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | MK511005 | Pseudomonas phage CF81, partial genome | 46850-46881 | 5 | 0.844 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP029831 | Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence | 680679-680710 | 6 | 0.812 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MG707188 | Pseudomonas phage TC7, partial genome | 11379-11410 | 6 | 0.812 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | MF788075 | Pseudomonas phage IME180, complete genome | 36271-36302 | 6 | 0.812 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | LN997843 | Streptomyces reticuli genome assembly TUE45, plasmid : II | 592288-592319 | 6 | 0.812 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | MH450118 | Arthrobacter phage Herb, complete genome | 24637-24669 | 6 | 0.818 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | NZ_CP019037 | Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence | 125966-125997 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NC_006462 | Thermus thermophilus HB8 plasmid pTT27, complete sequence | 80641-80672 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NC_005838 | Thermus thermophilus HB27 plasmid pTT27, complete sequence | 41634-41665 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NZ_AP019802 | Thermus thermophilus strain HC11 plasmid pHC11, complete sequence | 203615-203646 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MK937601 | Gordonia phage Charming, complete genome | 39633-39664 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976519 | Gordonia phage Tangent, complete genome | 39645-39676 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976510 | Gordonia phage Fosterous, complete genome | 39094-39125 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH153809 | Gordonia phage Sitar, complete genome | 40618-40649 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976518 | Gordonia phage Stultus, complete genome | 39571-39602 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH479924 | Gordonia phage Rofo, complete genome | 40054-40085 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MK937594 | Gordonia phage Galadriel, complete genome | 39901-39932 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MN329673 | Gordonia phage Jabberwocky, complete genome | 40939-40970 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MT723934 | Gordonia phage Love, complete genome | 41066-41097 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH651166 | Gordonia phage Angelicage, complete genome | 39723-39754 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MT639640 | Gordonia phage Paries, complete genome | 40728-40759 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MK977702 | Gordonia terrae phage McKinley, complete genome | 40439-40470 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_042108 | Gordonia phage Brandonk123, complete genome | 40132-40163 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976514 | Gordonia phage Nordenberg, complete genome | 39259-39290 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976506 | Gordonia phage Affeca, complete genome | 39305-39336 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_042045 | Gordonia phage Lennon, complete genome | 40618-40649 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MT498035 | Gordonia Phage Barsten, complete genome | 39878-39909 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976512 | Gordonia phage Geodirt, complete genome | 40513-40544 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_031239 | Gordonia phage Vivi2, complete genome | 40671-40702 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MG593802 | Streptomyces phage Omar, complete genome | 13897-13928 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP039697 | Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence | 261676-261707 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10256-10287 | 32 | NC_017273 | Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence | 50587-50618 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10256-10287 | 32 | NC_017590 | Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence | 123778-123809 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10256-10287 | 32 | NZ_LR027519 | Thermus thermophilus isolate TTHNAR1 plasmid 3, complete sequence | 59425-59456 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10256-10287 | 32 | NC_017767 | Thermus thermophilus HB8 plasmid pVV8, complete sequence | 62832-62863 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10436-10467 | 32 | NZ_CP012886 | Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence | 301502-301533 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 10557-10588 | 32 | NZ_AP022593 | Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence | 2896440-2896471 | 7 | 0.781 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | NZ_CP020332 | Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence | 242375-242406 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | MN850624 | Escherichia phage usur, complete genome | 11474-11505 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | MN850583 | Escherichia phage glasur, complete genome | 30458-30489 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NZ_CP016452 | Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence | 912721-912752 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9655-9686 | 32 | NC_016113 | Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence | 602884-602915 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9655-9686 | 32 | NC_017585 | Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence | 1210184-1210215 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_AP022593 | Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence | 3118349-3118380 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_015583 | Novosphingobium sp. PP1Y plasmid Mpl, complete sequence | 783923-783954 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP017244 | Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence | 1851733-1851764 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MH976511 | Gordonia phage Gaea, complete genome | 39009-39040 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | MT723937 | Gordonia phage JKSyngboy, complete genome | 39780-39811 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_012811 | Methylorubrum extorquens AM1 megaplasmid, complete sequence | 337910-337941 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013635 | Rhizobium sp. N324 plasmid pRspN324e, complete sequence | 260677-260708 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP016453 | Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence | 484297-484328 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9775-9806 | 32 | NZ_CP017076 | Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence | 838793-838824 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NZ_CP016080 | Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence | 121507-121538 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP039697 | Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence | 2300-2331 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP039697 | Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence | 739545-739576 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP015737 | Shinella sp. HZN7 plasmid pShin-01, complete sequence | 294254-294285 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP021827 | Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence | 569539-569570 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10436-10467 | 32 | NC_013855 | Azospirillum sp. B510 plasmid pAB510a, complete sequence | 148883-148914 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | GU070616 | Salmonella phage PVP-SE1, complete genome | 31367-31398 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | JX181824 | Salmonella phage SSE-121, complete genome | 35937-35968 | 8 | 0.75 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NZ_CP024427 | Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence | 23669-23700 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NZ_CP020443 | Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence | 9972-10003 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9655-9686 | 32 | CP054927 | Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence | 261103-261134 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9655-9686 | 32 | NZ_CP038637 | Cupriavidus oxalaticus strain X32 plasmid unnamed2, complete sequence | 25522-25553 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP032346 | Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence | 1041376-1041407 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP032322 | Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence | 97688-97719 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP021082 | Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence | 229957-229988 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP024895 | Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence | 241142-241173 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP019949 | Methylocystis bryophila strain S285 plasmid p1, complete sequence | 157867-157898 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP041250 | Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence | 15343-15374 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_011982 | Agrobacterium vitis S4 plasmid pTiS4, complete sequence | 171414-171445 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_011982 | Agrobacterium vitis S4 plasmid pTiS4, complete sequence | 182823-182854 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9835-9866 | 32 | HQ634156 | Vibrio phage PWH3a-P1 genomic sequence | 74142-74173 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10016-10047 | 32 | NZ_CP021082 | Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence | 190722-190753 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | NC_006949 | Enterobacteria phage ES18, complete genome | 45744-45775 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | AY736146 | Salmonella typhimurium bacteriophage ES18, complete sequence | 45744-45775 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | MK972697 | Salmonella phage SF10, complete genome | 32001-32032 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | MK972696 | Salmonella phage Si3 KFo-2019, complete genome | 31866-31897 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | X67137 | Salmonella typhimurium bacteriophage ES18 genes 13, 19 and 15 | 1652-1683 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | MK972695 | Salmonella phage SI5, complete genome | 36532-36563 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | MK972688 | Salmonella phage SI8, complete genome | 3577-3608 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10076-10107 | 32 | MK972689 | Salmonella phage SF6, complete genome | 30245-30276 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP028971 | Aminobacter sp. MSH1 plasmid pUSP3, complete sequence | 5227-5258 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP022367 | Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence | 220844-220875 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KY555145 | Caulobacter phage Ccr29, complete genome | 26583-26614 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | MN062720 | Microbacterium phage FuzzBuster, complete genome | 31525-31556 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KY555143 | Caulobacter phage Ccr2, complete genome | 24416-24447 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NC_019410 | Caulobacter phage CcrKarma, complete genome | 24035-24066 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NC_019407 | Caulobacter phage CcrMagneto, complete genome | 23211-23242 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KY555144 | Caulobacter phage Ccr5, complete genome | 23808-23839 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KY006853 | Erythrobacter phage vB_EliS_R6L, complete genome | 32756-32787 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | KY555142 | Caulobacter phage Ccr10, complete genome | 23941-23972 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NC_019411 | Caulobacter phage CcrSwift, complete genome | 23172-23203 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | NZ_CP010990 | Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence | 295468-295500 | 9 | 0.727 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | NZ_CP010991 | Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence | 3454-3486 | 9 | 0.727 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | NZ_CP012186 | Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence | 199995-200027 | 9 | 0.727 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | MT114163 | Mycobacterium phage Settecandela, complete genome | 41139-41171 | 9 | 0.727 | |
| NZ_NFFQ01000064_2 | 10496-10528 | 33 | MK937592 | Mycobacterium phage Phrappuccino, complete genome | 41139-41171 | 9 | 0.727 | |
| NZ_NFFQ01000064_2 | 10677-10708 | 32 | NZ_CP015090 | Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence | 169909-169940 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 10737-10768 | 32 | KR052482 | Sinorhizobium phage phiN3, complete genome | 201490-201521 | 9 | 0.719 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | NC_021289 | Burkholderia insecticola plasmid p1, complete sequence | 429165-429196 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9414-9445 | 32 | NZ_AP022319 | Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence | 1310290-1310321 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9535-9566 | 32 | NZ_AP018284 | Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome | 31677-31708 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9595-9626 | 32 | NZ_CP040822 | Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence | 31304-31335 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP020900 | Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence | 49371-49402 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP006991 | Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence | 359112-359143 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013556 | Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence | 371343-371374 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013589 | Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence | 361321-361352 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013562 | Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence | 402001-402032 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013531 | Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence | 377868-377899 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013536 | Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence | 543082-543113 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013541 | Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence | 364688-364719 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013567 | Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence | 371343-371374 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP013584 | Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence | 377868-377899 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP021128 | Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence | 309160-309191 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | CP007645 | Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence | 365700-365731 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NC_010997 | Rhizobium etli CIAT 652 plasmid pC, complete sequence | 357973-358004 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NC_023316 | Streptomyces sp. 14R-10 plasmid pZL1, complete sequence | 112937-112968 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NZ_CP012399 | Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence | 771625-771656 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 10196-10227 | 32 | NZ_CP015737 | Shinella sp. HZN7 plasmid pShin-01, complete sequence | 262796-262827 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 10436-10467 | 32 | NZ_CP039340 | Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence | 226660-226691 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 10436-10467 | 32 | NZ_CP016452 | Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence | 886517-886548 | 10 | 0.688 | |
| NZ_NFFQ01000064_2 | 9715-9746 | 32 | NZ_CP014797 | Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence | 34507-34538 | 11 | 0.656 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NZ_CP040765 | Paracoccus sp. 2251 plasmid unnamed1, complete sequence | 95347-95378 | 11 | 0.656 | |
| NZ_NFFQ01000064_2 | 10136-10167 | 32 | NZ_CP042332 | Bosea sp. F3-2 plasmid pB32-1, complete sequence | 274510-274541 | 11 | 0.656 |
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatgttgatttgcgtggc Protospacer ********************************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatgttgatttgcgtggc Protospacer ********************************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatgttgatttgcgtggc Protospacer ********************************
aattcacctgctgcggcattccgagcgacaac CRISPR spacer aattcacctgctgcggcattccgagcgacaac Protospacer ********************************
atagctacgccgagccagttgtaagctgacgc CRISPR spacer atagctacgccgagccagttgtaagctgacgc Protospacer ********************************
cttgccctcggccaattgctggccgactcggt CRISPR spacer cttgccctcggccaattgctggccgactcggt Protospacer ********************************
cttgccctcggccaattgctggccgactcggt CRISPR spacer cttgccctcggccaattgctggccgactcggt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggctttctctgcatctttgatgt Protospacer ********************************
ttttcgaccgacgcgatggcacaagcaaacct CRISPR spacer ttttcgaccgatgcgatggcacaagcaaacct Protospacer ***********.********************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatgttgatttgcgtagc Protospacer *****************************.**
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatattgatttgcgtggc Protospacer *****************.**************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccctgcatgttgatttgcgtagc Protospacer *****************************.**
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttggcctgcatgttgatttgcgtggc Protospacer ********* **********************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttggcctgcatgttgatttgcgtggc Protospacer ********* **********************
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer attcagccgttcctcgacgatctgcacgccat Protospacer ** *****************************
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer attcagccgttcctcgacgatctgcacgccat Protospacer ** *****************************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagattctgcggtgatgatcccgccccagatc Protospacer ******************* ************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagcttctgcggtgatgatgccgccccagatc Protospacer *** ****************************
gagggtcaggactgggccacctacctgggcca CRISPR spacer gagggtcaggactgggccacctacctgagcca Protospacer ***************************.****
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgttcgagcagcaact Protospacer ************.*******************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgttcgagcagcaact Protospacer ************.*******************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgttcgagcagcaact Protospacer ************.*******************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgttcgagcagcaact Protospacer ************.*******************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgttcgagcagcaact Protospacer ************.*******************
ggaatcaactctgcggtaaacgcctttgtaca CRISPR spacer ggaatcaactctgcggtaaacgcctttgtcca Protospacer ***************************** **
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer acgcggcgtgcagcttggtggcggtctggtgca Protospacer ****.****************************
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gtcccgaacggccttctctgcatctttgatgt Protospacer ************.*******************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttgccttgcaggttgatttgcgtggc Protospacer ***********.**** ***************
atgtagttgccctgcatgttgatttgcgtggc CRISPR spacer atgtagttggcctgcatattgatttgcgtggc Protospacer ********* *******.**************
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcctcgatcagggttgttgtggattgcaaaga Protospacer ** *****************.***********
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer ccgtccagcggcggctggatctcgccggggaa Protospacer ****** * ***********************
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer agggaggaagtcgcggcactgcgcgcaagggt Protospacer * ************.*****************
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer agggaggaagtcgaagcactgcgcgcaagggt Protospacer * *********** ******************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagcttctgcggtgatgatgccgccccatatc Protospacer *** ************************ ***
tagattctgcggtgatgatgccgccccagatc CRISPR spacer tagcttctgcggtgatgatgccgccccatatc Protospacer *** ************************ ***
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer atgaacgcctcgatctcggtgcggctcttcca Protospacer ************************ ******
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
cacgtctggctcacactgttcgagcagcaact CRISPR spacer cacgtctggctcgcactgctcgagcagcaact Protospacer ************.*****.*************
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aggcaggaagtcgcagcactgcgcgcaagggc Protospacer * * ***************************.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer gcatgaaccatcgacgcacagcaatctggcta Protospacer * *******.*** ******************
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer gcatgaaccatcgacgcacagcaatctggcta Protospacer * *******.*** ******************
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer gagaaggaagtctcagcactgcgcgcaagggt Protospacer . *.******** *******************
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer agggaggaagtcgcagcactgtgcgcaaagct Protospacer * *******************.******.* *
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer agggaggaagtcgcagcactgtgcgcaaagct Protospacer * *******************.******.* *
atagctacgccgagccagttgtaagctgacgc CRISPR spacer atggtgattccgagccagttgtaagctgacgc Protospacer **.*. *. ***********************
acattcatgcgagacgggatcaagcgattgat CRISPR spacer acgttcatgcgcgacgggatcaagcggctcat Protospacer **.******** **************..* **
tagattctgcggtgatgatgccgccccagatc CRISPR spacer gttgctctgcggtgatgatgccgccccagatc Protospacer ..***************************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer gttgctctgcggtgatgatgccgccccagatc Protospacer ..***************************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer gttgctctgcggtgatgatgccgccccagatc Protospacer ..***************************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer gttgctctgcggtgatgatgccgccccagatc Protospacer ..***************************
tagattctgcggtgatgatgccgccccagatc CRISPR spacer gttgctctgcggtgatgatgccgccccagatc Protospacer ..***************************
atgcagcc-gttcctcgacgatctgcacgccat CRISPR spacer -cgcgtccggttcctcgacgatcagcacgccag Protospacer .**. ** ************** ********
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer agggaggaagtcgcggcactgcgcgccaaact Protospacer * ************.*********** *.. *
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aaggaggaagtcgctgaactgcgcgcaaaact Protospacer * ************ * ***********.. *
atgaacgcctcgatctcggtgcgg-gacttcca CRISPR spacer atgagcggctcgatctcggtgcggtcgcgtcc- Protospacer ****.** **************** .* ***
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer gggcaccgtgccgcttggtggcggtctggtcct Protospacer . *** ***** ****************** *
ggcatgcgcgtgaccgagctggccttactgga CRISPR spacer ggcatccgcgtgatcgagctggcctgcaacga Protospacer ***** *******.*********** **
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer tctccggggggcggctggacctcgccggggag Protospacer .* .* ************.***********.
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer tctccggggggcggctggacctcgccggggag Protospacer .* .* ************.***********.
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer tctccggggggcggctggacctcgccggggag Protospacer .* .* ************.***********.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctgcacatcac Protospacer . ********** *************..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gtgcagccgttcctcgacgcactgatgggcat Protospacer .****************** *** * ***
atgaacgcctcgatctcggtgcgg-gacttcca CRISPR spacer ttgatcgcctcgatctcggtccggcggcctgc- Protospacer *** *************** *** *.*.* *
gagggtcaggactgggccacctacctgggcca CRISPR spacer gagacggaggacggggccaccttcctgggcaa Protospacer ***. ***** ********* ******* *
gagggtcaggactgggccacctacctgggcca CRISPR spacer gagacggaggacggggccaccttcctgggcaa Protospacer ***. ***** ********* ******* *
gagggtcaggactgggccacctacctgggcca CRISPR spacer gagacggaggacggggccaccttcctgggcaa Protospacer ***. ***** ********* ******* *
gagggtcaggactgggccacctacctgggcca CRISPR spacer gagacggaggacggggccaccttcctgggcaa Protospacer ***. ***** ********* ******* *
--ggccaccgccggacccgcgcatggcgcctgct CRISPR spacer tcggc--ccgccgggcccgcgcattgcgccggta Protospacer *** *******.********* ***** *.
gctctcgatcctcggcaaggtggtaacgatat CRISPR spacer gctctcgatcctcggcctggtggtgctgatcg Protospacer **************** ******. .***
ggcatgcgcgtgaccgagctggccttactgga------ CRISPR spacer ggcatgagcgtgaccgagctgtcc------gaggaact Protospacer ****** ************** ** **
ggcatgcgcgtgaccgagctggccttactgga CRISPR spacer ggcatacgcctgaccgagctggctggccttgg Protospacer *****.*** *************. ** *.
ggcatgcgcgtgaccgagctggccttactgga CRISPR spacer ggcatacgcctgaccgagctggctggccttgg Protospacer *****.*** *************. ** *.
-ccgtcctggggcggctggatctcgccggggaa CRISPR spacer gacgt-ctggggcggctgggtctcggcggatgc Protospacer *** *************.***** ***. .
ctcgccttacggctacgcgccgatctcgccca CRISPR spacer ctcgccgtacggatacgcgccgaaccgggcgg Protospacer ****** ***** ********** *. * * .
ctcgccttacggctacgcgccgatctcgccca CRISPR spacer ctcgccgtacggatacgcgccgaaccgggcgg Protospacer ****** ***** ********** *. * * .
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer atgcagcaggtcctcgacgatctcggcgcgca Protospacer ******* * ************* .***
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer ggcctgccgtgcctcgaagatctgcacgcccg Protospacer . * ***** ****** ************
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer ctgcagccgttccaccacgatctgcgggtgac Protospacer ************ * *********. *. *.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctacacatcac Protospacer . ********** *********.***..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gaccagccgttccacgacgatctacacatcac Protospacer . ********** *********.***..**.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cggaggccgttcctcgacgaacggcacgacgt Protospacer * .*************** * ***** *.*
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer ctgcagccgttcctggacgaactgatcgaaac Protospacer ************* ***** *** ** *.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer atggtcggtttcctcgacgatctgaacggcat Protospacer *** *************** *** ***
acggaggaagtcgcagcactgcgcgcaagggt CRISPR spacer aaggcggtagtcgcagcactgcgcgattgcgg Protospacer * ** ** ***************** * *
-tagattctgcggtgatgatgccgccccagatc CRISPR spacer gccggccct-cggcgatgatgccgccccaggtc Protospacer . *...** ***.****************.**
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer ttcaacgcctcgatctcgatgcgcgacgtgac Protospacer * ***************.**** *** *
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer ttcaacgcctcgatctcgatgcgcgacgtgac Protospacer * ***************.**** *** *
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer agcagcgcctcggtctcggcgcgggactgcgc Protospacer * *.*******.******.******** *
atgaacgcctcgatctcggtgcgggacttcca---- CRISPR spacer atgaacgcctctatctcggtacga----tcgagaaa Protospacer *********** ********.**. ** *
ggccaccgccggacccgcgcatggcgcctgct CRISPR spacer ggatgccgccggacccgcggatggtgccctcc Protospacer ** ..************** ****.***. *.
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer atcaacaacggctttcaatgcatctttgatag Protospacer .** ********** ************.
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer atcaacaacggctttcaatgcatctttgatag Protospacer .** ********** ************.
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer gcaagcaatggccgctggatctggccggggaa Protospacer *. * . *** ********* *********
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer gcaagcaatggccgctggatctggccggggaa Protospacer *. * . *** ********* *********
ctcgccttacggctacgcgccgatctcgccca CRISPR spacer atgatggaacgcctacgcgccggtctcgccca Protospacer * .. *** **********.*********
ctcgccttacggctacgcgccgatctcgccca CRISPR spacer agcgatacgcggctacgcgcagatctcgcgca Protospacer ** . ..*********** ******** **
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gcgcagccgttccttgccgatctgcccttcga Protospacer ..************.* ******** * .*.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer ctgaagccgatcctcgacgatctgatgacccg Protospacer ** ***** ************** .**
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer ggacagccgttcctcgccgatctgaacggtga Protospacer . .************* ******* *** ..
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gcacagcggttcgtcgacgatctgcaccctgg Protospacer ...**** **** ************** *..
atgcag-ccgttcctcgacgatctgcacgccat CRISPR spacer -tacgatccgttcctcgactatctgcgcgcgga Protospacer *.*.. ************ ******.*** .
atgcagccgttcctcgacgatctgca----cgccat CRISPR spacer ggtcagcagttcctggacgatctgcagcagcg---- Protospacer . **** ****** *********** **
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gtcgagccgttcctcgccgatccgcaccatgt Protospacer .* ************ *****.**** ..*
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer gtcgagccgttcctcgccgatccgcaccatgt Protospacer .* ************ *****.**** ..*
agcaagtgtggcgtgaatggtctgaccgcact CRISPR spacer cgaaagtgttgcgtgaatggtatgactttaga Protospacer * ****** *********** ****. .*
gaggtgtcaatctgcgacaccgtgcagagtca CRISPR spacer ctggtggccatctgcgacaccgtgccggagcg Protospacer **** * **************** *.. *.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
gaatgaaccgtcgccgcacagcaatctggcta CRISPR spacer aaatgaaccgttgccgcacaggaagtcagccc Protospacer .**********.********* ** ...**.
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer atgaccgcctcgatctcggcgcgatacgcttc Protospacer **** **************.***. ** ...
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer cggatcgcctcgatctcggcgcgggtcaccgg Protospacer ** **************.***** * .* .
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaagcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer gggaacgcctcgaactcgatgcgggtcggaga Protospacer . *********** ****.****** * *
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaagcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaagcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaggcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaagcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtgcgggacttcca---- CRISPR spacer cggaacgcctcggtttcggtgcggg----cgaagat Protospacer **********.*.********** * *
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaagcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
atgaacgcctcgatctcggtg-----cgggacttcca CRISPR spacer cggaaggcctcgatctcggcgcgggtcgggac----- Protospacer *** *************.* ******
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer tccggacgggcagcttggtggcggtgtggtcga Protospacer * ..** **************** **** *
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer tccggacgggcagcttggtggcggtgtggtcga Protospacer * ..** **************** **** *
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer tccggacgggcagcttggtggcggtgtggtcga Protospacer * ..** **************** **** *
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer gaccggcgtgcagcttgttggtggtctggcccg Protospacer . *.************ ***.*******. *.
acgcagcgtgcagcttggtggcggtctggtgca CRISPR spacer gaccggcgtgcagcttgttggtggtctggcccg Protospacer . *.************ ***.*******. *.
cttgccctcggccaattgctggccgactcggt CRISPR spacer cggcccctcggccagtggctggccgaccgaga Protospacer * **********.* **********. .*
gtcccgaacggctttctctgcatctttgatgt CRISPR spacer gcgcttggcggcttcctgtgcatctttgatgc Protospacer *. *. ..******.** *************.
ggcatgcgcgtgaccgagctggccttactgga CRISPR spacer ggcatgcgcgtgatcgagctcgcacacatcat Protospacer *************.****** ** . * .
ggcatgcgcgtgaccgagctggccttactgga CRISPR spacer ggcatgcgcgtgatcgagcttgcgcacatcat Protospacer *************.****** ** . * .
tcgtcgatcagggttgttgtagattgcaaaga CRISPR spacer tcgtctatcagagttgttgtagaacatcccaa Protospacer ***** *****.*********** ... .*
ccgtcctggggcggctggatctcgccggggaa CRISPR spacer ggccccgggggcggctgggtctcgccgcgctt Protospacer .** ***********.******** *
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcggcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcggcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcggcacgctcg Protospacer .* ********** ***** ******.
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgctatccgttcctcgccgatcagcacgctcg Protospacer .* ********** ***** ******.
tagattctgcggtgatgatgccgccccagatc CRISPR spacer ccacggtcgcggtgatgatggcgcgccagatc Protospacer . . ..************ *** *******
tagattctgcggtgatgatgccgccccagatc CRISPR spacer cggcgagcacggtgatgatgccgaaccagatc Protospacer ..* ..************** *******
atgaacgcctcgatctcggtgcgggacttcca CRISPR spacer tgcgccgcctcgatatcggtgcgggcctcgaa Protospacer . ********* ********** **. *
ggccaccgccggacccgcgcatggcgcctgct CRISPR spacer catggccgctggacccgcccatggcgccggac Protospacer .. .****.******** ********* * .
ggccaccgccggacccgcgcatggcgcctgct CRISPR spacer attcaccgccggccccgtgcatggcggatttg Protospacer . .********* ****.******** * .
atgcagccgttcctcgacgatctgcacgccat CRISPR spacer cgagagccgtccctcggcgatctgcacctgca Protospacer . ******.*****.********** .
tagattctgcggtgatgatgccgccccagatc CRISPR spacer cgctcgttgcggtgatgatcctgccccagaaa Protospacer .. . .************ *.********
tagattctgcggtgatgatgccgccccagatc CRISPR spacer cgatgagcgcggtgatgatccagccccagatg Protospacer ... .*********** * *********
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 53809 : 61471 | 10 | uncultured_Caudovirales_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 364 : 36932 | 43 | uncultured_Caudovirales_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 162888 : 171513 | 10 | uncultured_Caudovirales_phage(42.86%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 690 : 5327 | 8 | Pseudomonas_phage(66.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_NFFQ01000020_1 | 79683-79725 | 43 | MN961671 | Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence | 168287-168329 | 0 | 1.0 | |
| NZ_NFFQ01000020_1 | 79683-79725 | 43 | MN961672 | Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence | 116299-116341 | 0 | 1.0 | |
| NZ_NFFQ01000020_1 | 79501-79567 | 67 | MN961671 | Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence | 168108-168174 | 7 | 0.896 | |
| NZ_NFFQ01000020_1 | 79501-79567 | 67 | MN961672 | Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence | 116120-116186 | 7 | 0.896 | |
| NZ_NFFQ01000020_1 | 79501-79567 | 67 | NC_018746 | Pseudomonas putida ND6 plasmid pND6-2, complete sequence | 90688-90754 | 8 | 0.881 | |
| NZ_NFFQ01000020_1 | 79589-79661 | 73 | MN961671 | Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence | 168193-168265 | 14 | 0.808 | |
| NZ_NFFQ01000020_1 | 79589-79661 | 73 | MN961672 | Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence | 116205-116277 | 14 | 0.808 |
cgccccataagttttcacttctcaccccatatatattcaccct CRISPR spacer cgccccataagttttcacttctcaccccatatatattcaccct Protospacer *******************************************
cgccccataagttttcacttctcaccccatatatattcaccct CRISPR spacer cgccccataagttttcacttctcaccccatatatattcaccct Protospacer *******************************************
tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg CRISPR spacer tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg Protospacer ************************************************************
tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg CRISPR spacer tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg Protospacer ************************************************************
tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg CRISPR spacer tcccccgatcctggtgctcgaccggtagccttcaaatggccccatatgctttcacctttg Protospacer ***********************.************************************
ttcacgctccccacatccattcacctttcggcccacatccattcacctctcaccccatag CRISPR spacer ttcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatag Protospacer ****************************** *****************************
ttcacgctccccacatccattcacctttcggcccacatccattcacctctcaccccatag CRISPR spacer ttcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatag Protospacer ****************************** *****************************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 27729 : 33915 | 9 | Vibrio_phage(16.67%) | NA | ||
| DBSCAN-SWA_2 | 244571 : 253600 | 8 | Bacillus_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 27300 : 71899 | 42 | Pseudomonas_phage(40.91%) | attL 20073:20088|attR 66623:66638 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 136979 : 154721 | 23 | uncultured_Caudovirales_phage(41.18%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 245794 : 253240 | 9 | Acinetobacter_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 544 : 22645 | 20 | Pseudomonas_phage(68.42%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 183 : 7064 | 14 | Pseudomonas_phage(85.71%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 113051 : 123100 | 11 | Pseudomonas_phage(50.0%) | attL 112637:112649|attR 121681:121693 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 287 : 41876 | 54 | Pseudomonas_phage(60.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 44165 : 82625 | 33 | Agrobacterium_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|