Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_NFFQ01000005 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_5_length_275623, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_NFFQ01000069 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_69_length_7015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000454 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_454_length_436, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000348 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_348_length_504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000398 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_398_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000345 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_345_length_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000217 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_217_length_754, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000324 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_324_length_526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000031 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_31_length_93162, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFQ01000302 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_302_length_560, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000427 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_427_length_447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000293 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_293_length_577, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000381 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_381b_length_305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000141 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_141_length_1088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000150 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_150b_length_944, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000410 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_410_length_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000198 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_198b_length_709, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000102 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_102_length_1348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000444 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_444_length_441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000225 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_225a_length_681, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000255 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_255_length_647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000457 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_457_length_435, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000338 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_338_length_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000280 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_280b_length_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000375 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_375_length_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000131 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_131_length_1144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000099 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_99_length_1380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000409 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_409_length_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000443 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_443_length_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000029 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_29_length_95900, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFQ01000310 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_310_length_551, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000096 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_96a_length_1182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000101 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_101a_length_1274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000176 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_176_length_939, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000429 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_429_length_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000448 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_448_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000412 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_412_length_457, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000382 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_382_length_474, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000361 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_361a_length_394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000417 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_417_length_454, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000339 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_339_length_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000318 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_318_length_538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000183 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_183_length_915, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000317 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_317_length_541, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000072 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_72_length_5330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000321 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_321_length_533, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000268 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_268_length_630, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000207 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_207b_length_698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000125 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_125a_length_1129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000388 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_388_length_469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000209 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_209_length_811, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000320 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_320_length_536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000196 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_196_length_864, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000110 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_110_length_1288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000216 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_216_length_754, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000201 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_201_length_841, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000001 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_1_length_486179, whole genome shotgun sequence 0 crisprs WYL,DinG 0 0 0 0
NZ_NFFQ01000390 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_390_length_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000033 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_33_length_68889, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000227 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_227_length_727, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000466 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_466_length_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000453 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_453_length_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000397 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_397_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000327 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_327_length_524, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000456 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_456_length_434, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000074 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_74_length_5262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000045 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_45_length_37866, whole genome shotgun sequence 1 crisprs NA 0 26 0 0
NZ_NFFQ01000095 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_95b_length_1381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000030 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_30_length_95397, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000053 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_53_length_29406, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000306 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_306_length_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000332 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_332_length_521, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000464 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_464_length_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000011 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_11_length_214855, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000314 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_314_length_547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000067 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_67b_length_7539, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000021 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_21_length_134100, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_NFFQ01000132 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_132_length_1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000070 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_70_length_6168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000085 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_85_length_2019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000077 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_77_length_3075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000260 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_260_length_638, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000282 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_282_length_593, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000337 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_337_length_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000233 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_233_length_710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000379 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_379_length_476, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000215 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_215_length_759, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000384 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_384_length_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000399 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_399_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000372 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_372_length_480, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000300 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_300_length_562, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000219 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_219_length_750, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000467 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_467_length_400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000151 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_151_length_1046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000256 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_256_length_645, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000206 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_206_length_823, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000048 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_48_length_34175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000008 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_8_length_235225, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000447 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_447_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000245 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_245_length_674, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000229 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_229_length_721, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000341 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_341_length_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000395 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_395_length_465, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000445 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_445_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000258 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_258_length_641, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000471 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_471_length_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000104 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_104a_length_1043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000012 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_12_length_190528, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000091 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_91_length_1492, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000420 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_420_length_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000094 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_94a_length_1355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000191 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_191_length_895, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000351 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_351_length_503, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000385 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_385_length_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000220 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_220_length_745, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000365 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_365_length_487, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000166 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_166_length_975, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000155 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_155_length_1020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000342 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_342_length_509, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000143 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_143_length_1081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000036 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_36_length_59111, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_NFFQ01000171 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_171_length_964, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000120 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_120_length_1231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000065 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_65a_length_9935, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000027 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_27_length_106451, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFQ01000276 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_276_length_605, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000462 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_462_length_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000034 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_34_length_65202, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NFFQ01000442 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_442_length_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000041 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_41_length_47619, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000313 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_313_length_547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000195 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_195_length_870, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000326 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_326_length_525, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000377 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_377_length_477, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000298 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_298_length_567, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000197 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_197_length_863, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000004 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_4_length_361198, whole genome shotgun sequence 0 crisprs DEDDh 0 0 2 0
NZ_NFFQ01000152 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_152_length_1042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000052 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_52_length_29446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000368 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_368_length_486, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000271 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_271_length_617, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000144 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_144_length_1079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000261 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_261a_length_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000189 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_189b_length_847, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000180 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_180_length_923, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000243 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_243_length_678, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000098 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_98_length_1389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000423 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_423_length_450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000277 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_277_length_604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000315 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_315_length_546, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000089 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_89_length_1547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000221 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_221b_length_583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000265 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_265_length_636, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000093 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_93_length_1457, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000226 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_226_length_728, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000182 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_182_length_916, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000039 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_39_length_51894, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000130 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_130_length_1159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000355 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_355_length_498, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000123 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_123a_length_948, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000411 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_411_length_457, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000446 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_446_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000380 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_380_length_475, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000075 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_75_length_4905, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000009 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_9_length_223903, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFQ01000285 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_285_length_589, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000210 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_210_length_808, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000406 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_406_length_461, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000288 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_288_length_584, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000199 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_199_length_849, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000451 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_451_length_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000290 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_290_length_579, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000160 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_160_length_1007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000458 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_458_length_434, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000139 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_139_length_1098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000168 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_168_length_969, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000358 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_358_length_494, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000138 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_138b_length_896, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000278 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_278_length_601, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000299 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_299_length_565, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000436 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_436_length_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000419 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_419_length_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000296 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_296_length_573, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000460 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_460_length_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000124 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_124_length_1198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000145 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_145_length_1072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000266 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_266_length_634, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000391 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_391_length_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000312 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_312_length_548, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000343 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_343_length_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000149 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_149_length_1051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000450 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_450_length_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000137 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_137_length_1110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000035 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_35_length_62727, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000119 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_119_length_1235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000328 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_328_length_523, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000376 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_376_length_477, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000016 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_16_length_156229, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NFFQ01000291 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_291_length_578, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000079 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_79_length_2992, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFQ01000301 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_301_length_561, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000279 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_279_length_597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000374 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_374_length_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000116 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_116_length_1267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000212 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_212_length_785, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000064 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_64_length_11973, whole genome shotgun sequence 2 crisprs cas6f,cas7f,cas5f,cas8f,cas3f,cas1 0 24 0 0
NZ_NFFQ01000437 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_437_length_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000084 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_84a_length_1952, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000303 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_303_length_559, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000194 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_194_length_871, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000331 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_331_length_522, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000349 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_349_length_503, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000356 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_356_length_497, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000181 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_181_length_923, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000173 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_173_length_949, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000211 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_211_length_792, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000040 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_40_length_49800, whole genome shotgun sequence 2 crisprs NA 1 2 0 4
NZ_NFFQ01000224 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_224_length_731, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000006 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_6_length_265646, whole genome shotgun sequence 0 crisprs RT 0 0 1 0
NZ_NFFQ01000178 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_178_length_931, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000049 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_49_length_33638, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_NFFQ01000248 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_248_length_664, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000344 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_344_length_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000274 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_274_length_607, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000050 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_50_length_32985, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000062 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_62_length_14675, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000404 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_404_length_462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000025 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_25_length_107511, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000439 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_439_length_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000113 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_113_length_1278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000297 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_297_length_568, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000018 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_18_length_150369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000111 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_111_length_1280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000333 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_333_length_520, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000378 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_378_length_476, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000347 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_347_length_504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000289 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_289_length_583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000432 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_432_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000175 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_175_length_941, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000461 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_461_length_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000014 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_14_length_157157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000184 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_184_length_912, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000002 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_2_length_405276, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_NFFQ01000148 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_148_length_1053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000364 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_364_length_490, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000092 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_92_length_1469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000360 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_360_length_493, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000252 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_252_length_660, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000275 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_275_length_606, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000177 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_177_length_938, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000165 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_165_length_979, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000133 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_133b_length_961, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000329 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_329_length_523, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000169 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_169_length_967, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000046 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_46_length_36379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000426 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_426_length_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000090 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_90_length_1530, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000340 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_340_length_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000262 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_262_length_638, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000414 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_414_length_455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000106 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_106_length_1314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000267 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_267_length_630, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000322 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_322_length_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000115 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_115b_length_1180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000441 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_441_length_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000185 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_185_length_909, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000465 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_465_length_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000463 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_463_length_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000222 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_222b_length_683, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000063 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_63_length_11992, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000136 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_136b_length_1067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000257 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_257_length_641, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000205 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_205_length_824, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000253 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_253_length_660, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000156 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_156_length_1009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000200 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_200_length_845, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000134 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_134b_length_1106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000396 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_396_length_465, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000010 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_10_length_217837, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_NFFQ01000170 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_170a_length_702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000230 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_230_length_720, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000235 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_235_length_709, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000357 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_357_length_496, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000066 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_66_length_8153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000430 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_430_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000157 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_157_length_1009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000167 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_167_length_969, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000425 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_425_length_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000308 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_308_length_554, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000213 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_213_length_780, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000316 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_316_length_546, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000241 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_241_length_687, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000060 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_60_length_16712, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_NFFQ01000240 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_240_length_690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000234 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_234_length_710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000043 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_43_length_39801, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000394 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_394_length_465, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000292 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_292_length_578, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000127 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_127_length_1164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000107 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_107a_length_1108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000121 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_121_length_1227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000373 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_373_length_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000295 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_295a_length_441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000346 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_346_length_506, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000204 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_204_length_824, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000438 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_438_length_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000354 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_354_length_498, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000208 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_208_length_811, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000193 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_193_length_876, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000118 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_118b_length_1234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000251 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_251_length_660, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000468 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_468_length_400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000459 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_459_length_434, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000408 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_408_length_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000334 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_334_length_519, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000142 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_142_length_1085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000032 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_32b_length_71450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000392 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_392_length_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000159 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_159_length_1008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000071 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_71_length_5483, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000237 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_237_length_701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000172 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_172_length_958, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000214 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_214_length_761, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000161 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_161_length_1006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000273 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_273_length_613, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000140 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_140_length_1092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000434 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_434_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000401 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_401_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000386 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_386_length_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000163 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_163_length_992, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000371 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_371_length_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000431 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_431_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000179 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_179_length_927, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000126 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_126a_length_942, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000061 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_61_length_16473, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000023 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_23_length_115079, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_NFFQ01000015 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_15_length_156727, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000153 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_153_length_1040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000350 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_350_length_503, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000026 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_26_length_106862, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000057 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_57_length_25722, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000469 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_469_length_378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000264 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_264_length_636, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000097 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_97b_length_1254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000038 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_38_length_54152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000352 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_352_length_502, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000044 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_44_length_38106, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_NFFQ01000393 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_393_length_466, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000359 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_359_length_493, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000056 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_56_length_26352, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFQ01000187 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_187_length_905, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000190 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_190_length_896, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000203 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_203_length_831, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000037 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_37a_length_55508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000020 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_20_length_141227, whole genome shotgun sequence 1 crisprs csf3gr5,csf2gr7,csf1gr8,csf5gr6,DinG 0 3 0 0
NZ_NFFQ01000370 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_370_length_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000003 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_3_length_404382, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_NFFQ01000108 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_108_length_1307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000076 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_76_length_3141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000088 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_88_length_1689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000389 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_389_length_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000122 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_122_length_1218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000286 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_286_length_586, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000284 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_284_length_592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000400 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_400_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000283 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_283_length_592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000083 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_83_length_2253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000418 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_418_length_453, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000325 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_325_length_526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000319 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_319_length_536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000158 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_158a_length_784, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000117 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_117b_length_1145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000129 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_129_length_1160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000403 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_403_length_463, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000309 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_309_length_552, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000413 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_413_length_456, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000353 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_353_length_501, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000218 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_218_length_751, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000192 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_192_length_885, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000087 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_87_length_1702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000422 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_422_length_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000239 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_239_length_693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000363 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_363_length_491, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000054 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_54_length_28099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000269 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_269_length_625, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000250 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_250_length_662, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000433 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_433_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000304 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_304_length_559, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000109 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_109_length_1289, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000335 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_335_length_518, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000449 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_449_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000164 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_164_length_984, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000024 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_24_length_113478, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_NFFQ01000440 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_440_length_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000242 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_242_length_683, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000416 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_416b_length_411, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000238 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_238_length_693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000022 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_22_length_123518, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000080 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_80_length_2601, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000058 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_58_length_24392, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000415 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_415_length_455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000146 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_146_length_1071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000202 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_202_length_841, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000055 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_55_length_27704, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000007 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_7_length_246973, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000154 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_154b_length_995, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000455 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_455_length_436, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000383 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_383_length_471, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000186 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_186_length_908, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000330 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_330_length_522, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000402 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_402_length_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000369 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_369_length_484, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000112 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_112a_length_1180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000407 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_407_length_459, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000017 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_17_length_155119, whole genome shotgun sequence 0 crisprs DEDDh,DinG 0 0 1 0
NZ_NFFQ01000105 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_105_length_1316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000174 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_174b_length_840, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000405 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_405_length_461, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000428 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_428_length_447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000228 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_228_length_725, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000311 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_311_length_550, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000162 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_162_length_1004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000387 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_387_length_469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000270 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_270_length_618, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000367 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_367_length_487, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000028 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_28_length_99138, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_NFFQ01000128 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_128a_length_1066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000470 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_470_length_367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000073 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_73_length_5327, whole genome shotgun sequence 0 crisprs RT 0 0 1 0
NZ_NFFQ01000019 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_19a_length_149338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000051 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_51_length_30841, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000081 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_81_length_2426, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFQ01000366 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_366_length_487, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000188 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_188_length_904, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000272 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_272_length_615, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000232 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_232_length_714, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000223 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_223_length_731, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000452 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_452_length_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000086 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_86_length_1820, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000078 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_78_length_3002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000435 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_435_length_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000231 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_231_length_719, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000307 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_307_length_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000294 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_294_length_574, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000323 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_323_length_529, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000263 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_263_length_637, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000147 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_147_length_1068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000259 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_259_length_640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000068 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_68_length_7209, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000254 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_254_length_657, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000082 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_82_length_2322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000246 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_246_length_669, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000421 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_421_length_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000236 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_236_length_702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000047 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_47_length_34712, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000059 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_59a_length_20128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000013 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_13_length_168743, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFQ01000103 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_103_length_1337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000281 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_281_length_596, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000287 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_287_length_586, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000249 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_249_length_663, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000362 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_362_length_492, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000336 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_336_length_518, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000244 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_244_length_675, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000424 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_424_length_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000305 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_305_length_559, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000135 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_135_length_1123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000042 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_42_length_41647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000247 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_247_length_668, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000114 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_114_length_1277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFQ01000100 Pseudomonas aeruginosa strain S700_C14_RS S700_C14_RS_NODE_100_length_1366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_NFFQ01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 544 : 22645 20 Pseudomonas_phage(68.42%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_NFFQ01000064
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000064_1 288-862 TypeI-F I-F
9 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000064_2 9386-10796 TypeI-F I-F
23 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_KM670336 Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence 150606-150637 0 1.0
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP014764 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-704, complete sequence 31661-31692 0 1.0
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP020602 Pseudomonas aeruginosa strain E6130952 plasmid pJHX613, complete sequence 30972-31003 0 1.0
NZ_NFFQ01000064_1 1.4|496|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 496-527 32 NC_030931 Pseudomonas phage phi2, complete genome 5666-5697 0 1.0
NZ_NFFQ01000064_1 1.8|737|32|NZ_NFFQ01000064|CRISPRCasFinder,CRT 737-768 32 HQ711985 Pseudomonas phage vB_PaeS_PMG1, complete genome 30578-30609 0 1.0
NZ_NFFQ01000064_2 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10677-10708 32 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 4870-4901 0 1.0
NZ_NFFQ01000064_2 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10677-10708 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 4738-4769 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 MK511013 Pseudomonas phage BR161, partial genome 4426-4457 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 MK511002 Pseudomonas phage CF57, partial genome 4325-4356 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 MK511009 Pseudomonas phage CF136, partial genome 4281-4312 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 MK511003 Pseudomonas phage CF65, partial genome 4312-4343 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 KT887557 Pseudomonas phage phi1, complete genome 28596-28627 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 MK511005 Pseudomonas phage CF81, partial genome 4417-4448 0 1.0
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 NC_028657 Pseudomonas phage YMC11/02/R656, complete genome 50922-50953 0 1.0
NZ_NFFQ01000064_1 1.1|316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 316-347 32 NZ_CP045255 Proteus mirabilis strain L90-1 plasmid pL902, complete sequence 19422-19453 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP015073 Escherichia coli strain Ecol_743 plasmid pEC743_4, complete sequence 21833-21864 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP045255 Proteus mirabilis strain L90-1 plasmid pL902, complete sequence 19821-19852 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 AP018710 Uncultured bacterium plasmid pSN1216-29 DNA, complete sequence 29973-30004 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP021021 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pE, complete sequence 22323-22354 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP021004 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pE, complete sequence 33925-33956 1 0.969
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_006548 Pseudomonas phage B3, complete genome 25234-25265 1 0.969
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 AF232233 Bacteriophage B3, complete genome 25234-25265 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 KM389321 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000158 genomic sequence 1134-1165 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 11786-11817 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 37314-37345 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 37680-37711 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 32878-32909 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NC_030929 Pseudomonas phage JBD44, complete genome 43163-43194 1 0.969
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NC_028657 Pseudomonas phage YMC11/02/R656, complete genome 4370-4401 1 0.969
NZ_NFFQ01000064_2 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10256-10287 32 KT887559 Pseudomonas phage phi3, complete genome 18643-18674 1 0.969
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 NC_026587 Pseudomonas phage vB_PaeM_PAO1_Ab03, complete genome 8602-8633 1 0.969
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 18100-18131 1 0.969
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 LN610581 Pseudomonas phage vB_PaeM_PAO1_Ab04, complete genome 8469-8500 1 0.969
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 LN610576 Pseudomonas phage vB_PaeM_PAO1_Ab17, complete genome 8932-8963 1 0.969
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 KT887557 Pseudomonas phage phi1, complete genome 52942-52973 1 0.969
NZ_NFFQ01000064_2 2.17|10376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10376-10407 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 10536-10567 1 0.969
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 MT613935 Pseudomonas phage Persinger, complete genome 15399-15431 1 0.97
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 42166-42197 1 0.969
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 NZ_CP046349 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed2, complete sequence 31072-31103 2 0.938
NZ_NFFQ01000064_1 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 376-407 32 KC170285 Uncultured bacterium plasmid pMBUI2, complete sequence 7570-7601 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 123799-123830 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 113804-113835 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 148602-148633 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 119419-119450 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 112951-112982 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 113104-113135 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 165303-165334 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 150729-150760 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 440044-440075 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 116452-116483 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 398781-398812 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 116234-116265 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 118914-118945 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 115504-115535 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 117232-117263 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 360806-360837 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 190944-190975 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 398692-398723 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 116429-116460 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 46122-46153 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 188852-188883 2 0.938
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 119882-119913 2 0.938
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 KT887559 Pseudomonas phage phi3, complete genome 19171-19202 2 0.938
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 HQ711985 Pseudomonas phage vB_PaeS_PMG1, complete genome 31640-31671 2 0.938
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MK511012 Pseudomonas phage BR153, partial genome 528-559 2 0.938
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NC_011373 Pseudomonas phage PAJU2, complete genome 35086-35117 2 0.938
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 AP009624 Pseudomonas phage PAJU2 DNA, complete genome 35086-35117 2 0.938
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KT887559 Pseudomonas phage phi3, complete genome 19219-19250 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 MG707188 Pseudomonas phage TC7, partial genome 10612-10643 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 4934-4965 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 MK511012 Pseudomonas phage BR153, partial genome 49746-49777 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 44166-44197 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 43602-43633 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 NC_030931 Pseudomonas phage phi2, complete genome 1740-1771 2 0.938
NZ_NFFQ01000064_2 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10316-10347 32 NC_030929 Pseudomonas phage JBD44, complete genome 37241-37272 2 0.938
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_011165 Pseudomonas phage LBL3, complete genome 53620-53651 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT491205 Pseudomonas phage vB_PaeM_USP_2, complete genome 54309-54340 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT933737 Pseudomonas phage PASA16, complete genome 25888-25919 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 6443-6474 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 FM201281 Pseudomonas phage LBL3 complete genome 53620-53651 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MN615701 Pseudomonas phage vB_PaeM_SMS21, complete genome 55444-55475 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT118290 Pseudomonas phage Epa10, complete genome 65214-65245 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_048676 Pseudomonas phage SL1, complete genome 17250-17281 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 GU815091 Pseudomonas phage JG024, complete genome 54932-54963 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 6903-6934 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT108727 Pseudomonas phage Epa11, complete genome 39910-39941 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MN131141 Pseudomonas virus PaP1_EPu-2019, complete genome 62174-62205 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 42197-42228 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MN615700 Pseudomonas phage vB_PaeM_SMS12, complete genome 55142-55173 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 KR054033 Pseudomonas phage DL68, complete genome 20385-20416 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MK318076 Pseudomonas phage vB_PaeM_fHoPae01, complete genome 61981-62012 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_011703 Pseudomonas phage 14-1, complete genome 54848-54879 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT491204 Pseudomonas phage vB_PaeM_USP_1, complete genome 54267-54298 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MN131143 Pseudomonas virus PA11P1, complete genome 61611-61642 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MT119369 Pseudomonas phage sortsol, complete genome 54684-54715 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MN615702 Pseudomonas phage vB_PaeM_SMS29, complete genome 55269-55300 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MF623055 Pseudomonas phage BrSP1, complete genome 61752-61783 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_050147 Pseudomonas phage Epa13, complete genome 39970-40001 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_042080 Pseudomonas phage vB_PaeM_E215, complete genome 41825-41856 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_050148 Pseudomonas virus Pa193, complete genome 62212-62243 3 0.906
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 NC_011373 Pseudomonas phage PAJU2, complete genome 35168-35199 3 0.906
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 AP009624 Pseudomonas phage PAJU2 DNA, complete genome 35168-35199 3 0.906
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 AF165214 Bacteriophage D3, complete genome 40700-40731 4 0.875
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MG676466 Pseudomonas phage TC6, complete genome 35473-35504 4 0.875
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NC_031274 Pseudomonas phage O4, complete genome 37306-37337 4 0.875
NZ_NFFQ01000064_1 1.8|737|32|NZ_NFFQ01000064|CRISPRCasFinder,CRT 737-768 32 MK511012 Pseudomonas phage BR153, partial genome 49801-49832 5 0.844
NZ_NFFQ01000064_2 2.9|9895|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9895-9926 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 14335-14366 5 0.844
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 MK511034 Pseudomonas phage BR243, partial genome 38120-38151 5 0.844
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 MK511002 Pseudomonas phage CF57, partial genome 46758-46789 5 0.844
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 MK511003 Pseudomonas phage CF65, partial genome 46745-46776 5 0.844
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 MK511022 Pseudomonas phage CF74, partial genome 42693-42724 5 0.844
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 MK511005 Pseudomonas phage CF81, partial genome 46850-46881 5 0.844
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 680679-680710 6 0.812
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MG707188 Pseudomonas phage TC7, partial genome 11379-11410 6 0.812
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 MF788075 Pseudomonas phage IME180, complete genome 36271-36302 6 0.812
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 592288-592319 6 0.812
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 MH450118 Arthrobacter phage Herb, complete genome 24637-24669 6 0.818
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 125966-125997 7 0.781
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 80641-80672 7 0.781
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 41634-41665 7 0.781
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 203615-203646 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MK937601 Gordonia phage Charming, complete genome 39633-39664 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976519 Gordonia phage Tangent, complete genome 39645-39676 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976510 Gordonia phage Fosterous, complete genome 39094-39125 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH153809 Gordonia phage Sitar, complete genome 40618-40649 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976518 Gordonia phage Stultus, complete genome 39571-39602 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH479924 Gordonia phage Rofo, complete genome 40054-40085 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MK937594 Gordonia phage Galadriel, complete genome 39901-39932 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MN329673 Gordonia phage Jabberwocky, complete genome 40939-40970 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MT723934 Gordonia phage Love, complete genome 41066-41097 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH651166 Gordonia phage Angelicage, complete genome 39723-39754 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MT639640 Gordonia phage Paries, complete genome 40728-40759 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MK977702 Gordonia terrae phage McKinley, complete genome 40439-40470 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_042108 Gordonia phage Brandonk123, complete genome 40132-40163 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976514 Gordonia phage Nordenberg, complete genome 39259-39290 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976506 Gordonia phage Affeca, complete genome 39305-39336 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_042045 Gordonia phage Lennon, complete genome 40618-40649 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MT498035 Gordonia Phage Barsten, complete genome 39878-39909 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976512 Gordonia phage Geodirt, complete genome 40513-40544 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_031239 Gordonia phage Vivi2, complete genome 40671-40702 7 0.781
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MG593802 Streptomyces phage Omar, complete genome 13897-13928 7 0.781
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 261676-261707 7 0.781
NZ_NFFQ01000064_2 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10256-10287 32 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 50587-50618 7 0.781
NZ_NFFQ01000064_2 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10256-10287 32 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 123778-123809 7 0.781
NZ_NFFQ01000064_2 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10256-10287 32 NZ_LR027519 Thermus thermophilus isolate TTHNAR1 plasmid 3, complete sequence 59425-59456 7 0.781
NZ_NFFQ01000064_2 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10256-10287 32 NC_017767 Thermus thermophilus HB8 plasmid pVV8, complete sequence 62832-62863 7 0.781
NZ_NFFQ01000064_2 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10436-10467 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 301502-301533 7 0.781
NZ_NFFQ01000064_2 2.20|10557|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10557-10588 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2896440-2896471 7 0.781
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 NZ_CP020332 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence 242375-242406 8 0.75
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 MN850624 Escherichia phage usur, complete genome 11474-11505 8 0.75
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 MN850583 Escherichia phage glasur, complete genome 30458-30489 8 0.75
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 912721-912752 8 0.75
NZ_NFFQ01000064_2 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9655-9686 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 602884-602915 8 0.75
NZ_NFFQ01000064_2 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9655-9686 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1210184-1210215 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3118349-3118380 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 783923-783954 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1851733-1851764 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MH976511 Gordonia phage Gaea, complete genome 39009-39040 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 MT723937 Gordonia phage JKSyngboy, complete genome 39780-39811 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 337910-337941 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 260677-260708 8 0.75
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 484297-484328 8 0.75
NZ_NFFQ01000064_2 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9775-9806 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 838793-838824 8 0.75
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 121507-121538 8 0.75
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 2300-2331 8 0.75
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 739545-739576 8 0.75
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 294254-294285 8 0.75
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 569539-569570 8 0.75
NZ_NFFQ01000064_2 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10436-10467 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 148883-148914 8 0.75
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 GU070616 Salmonella phage PVP-SE1, complete genome 31367-31398 8 0.75
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 JX181824 Salmonella phage SSE-121, complete genome 35937-35968 8 0.75
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 23669-23700 9 0.719
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 9972-10003 9 0.719
NZ_NFFQ01000064_2 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9655-9686 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 261103-261134 9 0.719
NZ_NFFQ01000064_2 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9655-9686 32 NZ_CP038637 Cupriavidus oxalaticus strain X32 plasmid unnamed2, complete sequence 25522-25553 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1041376-1041407 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 97688-97719 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 229957-229988 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 241142-241173 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP019949 Methylocystis bryophila strain S285 plasmid p1, complete sequence 157867-157898 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 15343-15374 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_011982 Agrobacterium vitis S4 plasmid pTiS4, complete sequence 171414-171445 9 0.719
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_011982 Agrobacterium vitis S4 plasmid pTiS4, complete sequence 182823-182854 9 0.719
NZ_NFFQ01000064_2 2.8|9835|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9835-9866 32 HQ634156 Vibrio phage PWH3a-P1 genomic sequence 74142-74173 9 0.719
NZ_NFFQ01000064_2 2.11|10016|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10016-10047 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 190722-190753 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 NC_006949 Enterobacteria phage ES18, complete genome 45744-45775 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 45744-45775 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 MK972697 Salmonella phage SF10, complete genome 32001-32032 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 MK972696 Salmonella phage Si3 KFo-2019, complete genome 31866-31897 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 X67137 Salmonella typhimurium bacteriophage ES18 genes 13, 19 and 15 1652-1683 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 MK972695 Salmonella phage SI5, complete genome 36532-36563 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 MK972688 Salmonella phage SI8, complete genome 3577-3608 9 0.719
NZ_NFFQ01000064_2 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10076-10107 32 MK972689 Salmonella phage SF6, complete genome 30245-30276 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP028971 Aminobacter sp. MSH1 plasmid pUSP3, complete sequence 5227-5258 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 220844-220875 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KY555145 Caulobacter phage Ccr29, complete genome 26583-26614 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 MN062720 Microbacterium phage FuzzBuster, complete genome 31525-31556 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KY555143 Caulobacter phage Ccr2, complete genome 24416-24447 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NC_019410 Caulobacter phage CcrKarma, complete genome 24035-24066 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NC_019407 Caulobacter phage CcrMagneto, complete genome 23211-23242 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KY555144 Caulobacter phage Ccr5, complete genome 23808-23839 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 32756-32787 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 KY555142 Caulobacter phage Ccr10, complete genome 23941-23972 9 0.719
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NC_019411 Caulobacter phage CcrSwift, complete genome 23172-23203 9 0.719
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 295468-295500 9 0.727
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 3454-3486 9 0.727
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 199995-200027 9 0.727
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 MT114163 Mycobacterium phage Settecandela, complete genome 41139-41171 9 0.727
NZ_NFFQ01000064_2 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10496-10528 33 MK937592 Mycobacterium phage Phrappuccino, complete genome 41139-41171 9 0.727
NZ_NFFQ01000064_2 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10677-10708 32 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 169909-169940 9 0.719
NZ_NFFQ01000064_2 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10737-10768 32 KR052482 Sinorhizobium phage phiN3, complete genome 201490-201521 9 0.719
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 429165-429196 10 0.688
NZ_NFFQ01000064_2 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9414-9445 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1310290-1310321 10 0.688
NZ_NFFQ01000064_2 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9535-9566 32 NZ_AP018284 Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome 31677-31708 10 0.688
NZ_NFFQ01000064_2 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9595-9626 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 31304-31335 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 49371-49402 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 359112-359143 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 371343-371374 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 361321-361352 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 402001-402032 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 377868-377899 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 543082-543113 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 364688-364719 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 371343-371374 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 377868-377899 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 309160-309191 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 365700-365731 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 357973-358004 10 0.688
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NC_023316 Streptomyces sp. 14R-10 plasmid pZL1, complete sequence 112937-112968 10 0.688
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 771625-771656 10 0.688
NZ_NFFQ01000064_2 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10196-10227 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 262796-262827 10 0.688
NZ_NFFQ01000064_2 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10436-10467 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 226660-226691 10 0.688
NZ_NFFQ01000064_2 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10436-10467 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 886517-886548 10 0.688
NZ_NFFQ01000064_2 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 9715-9746 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 34507-34538 11 0.656
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 95347-95378 11 0.656
NZ_NFFQ01000064_2 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT 10136-10167 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 274510-274541 11 0.656

1. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 0, identity: 1.0

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatgttgatttgcgtggc	Protospacer
********************************

2. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014764 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-704, complete sequence) position: , mismatch: 0, identity: 1.0

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatgttgatttgcgtggc	Protospacer
********************************

3. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020602 (Pseudomonas aeruginosa strain E6130952 plasmid pJHX613, complete sequence) position: , mismatch: 0, identity: 1.0

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatgttgatttgcgtggc	Protospacer
********************************

4. spacer 1.4|496|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 0, identity: 1.0

aattcacctgctgcggcattccgagcgacaac	CRISPR spacer
aattcacctgctgcggcattccgagcgacaac	Protospacer
********************************

5. spacer 1.8|737|32|NZ_NFFQ01000064|CRISPRCasFinder,CRT matches to HQ711985 (Pseudomonas phage vB_PaeS_PMG1, complete genome) position: , mismatch: 0, identity: 1.0

atagctacgccgagccagttgtaagctgacgc	CRISPR spacer
atagctacgccgagccagttgtaagctgacgc	Protospacer
********************************

6. spacer 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 0, identity: 1.0

cttgccctcggccaattgctggccgactcggt	CRISPR spacer
cttgccctcggccaattgctggccgactcggt	Protospacer
********************************

7. spacer 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 0, identity: 1.0

cttgccctcggccaattgctggccgactcggt	CRISPR spacer
cttgccctcggccaattgctggccgactcggt	Protospacer
********************************

8. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511013 (Pseudomonas phage BR161, partial genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

9. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

10. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511009 (Pseudomonas phage CF136, partial genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

11. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

12. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

13. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

14. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_028657 (Pseudomonas phage YMC11/02/R656, complete genome) position: , mismatch: 0, identity: 1.0

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggctttctctgcatctttgatgt	Protospacer
********************************

15. spacer 1.1|316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045255 (Proteus mirabilis strain L90-1 plasmid pL902, complete sequence) position: , mismatch: 1, identity: 0.969

ttttcgaccgacgcgatggcacaagcaaacct	CRISPR spacer
ttttcgaccgatgcgatggcacaagcaaacct	Protospacer
***********.********************

16. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015073 (Escherichia coli strain Ecol_743 plasmid pEC743_4, complete sequence) position: , mismatch: 1, identity: 0.969

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatgttgatttgcgtagc	Protospacer
*****************************.**

17. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045255 (Proteus mirabilis strain L90-1 plasmid pL902, complete sequence) position: , mismatch: 1, identity: 0.969

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatattgatttgcgtggc	Protospacer
*****************.**************

18. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AP018710 (Uncultured bacterium plasmid pSN1216-29 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccctgcatgttgatttgcgtagc	Protospacer
*****************************.**

19. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021021 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pE, complete sequence) position: , mismatch: 1, identity: 0.969

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttggcctgcatgttgatttgcgtggc	Protospacer
********* **********************

20. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021004 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pE, complete sequence) position: , mismatch: 1, identity: 0.969

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttggcctgcatgttgatttgcgtggc	Protospacer
********* **********************

21. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_006548 (Pseudomonas phage B3, complete genome) position: , mismatch: 1, identity: 0.969

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
attcagccgttcctcgacgatctgcacgccat	Protospacer
** *****************************

22. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AF232233 (Bacteriophage B3, complete genome) position: , mismatch: 1, identity: 0.969

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
attcagccgttcctcgacgatctgcacgccat	Protospacer
** *****************************

23. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389321 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000158 genomic sequence) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

24. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

25. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

26. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

27. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

28. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagattctgcggtgatgatcccgccccagatc	Protospacer
******************* ************

29. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_028657 (Pseudomonas phage YMC11/02/R656, complete genome) position: , mismatch: 1, identity: 0.969

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagcttctgcggtgatgatgccgccccagatc	Protospacer
*** ****************************

30. spacer 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KT887559 (Pseudomonas phage phi3, complete genome) position: , mismatch: 1, identity: 0.969

gagggtcaggactgggccacctacctgggcca	CRISPR spacer
gagggtcaggactgggccacctacctgagcca	Protospacer
***************************.****

31. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_026587 (Pseudomonas phage vB_PaeM_PAO1_Ab03, complete genome) position: , mismatch: 1, identity: 0.969

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgttcgagcagcaact	Protospacer
************.*******************

32. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgttcgagcagcaact	Protospacer
************.*******************

33. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to LN610581 (Pseudomonas phage vB_PaeM_PAO1_Ab04, complete genome) position: , mismatch: 1, identity: 0.969

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgttcgagcagcaact	Protospacer
************.*******************

34. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to LN610576 (Pseudomonas phage vB_PaeM_PAO1_Ab17, complete genome) position: , mismatch: 1, identity: 0.969

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgttcgagcagcaact	Protospacer
************.*******************

35. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 1, identity: 0.969

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgttcgagcagcaact	Protospacer
************.*******************

36. spacer 2.17|10376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 1, identity: 0.969

ggaatcaactctgcggtaaacgcctttgtaca	CRISPR spacer
ggaatcaactctgcggtaaacgcctttgtcca	Protospacer
***************************** **

37. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 1, identity: 0.97

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
acgcggcgtgcagcttggtggcggtctggtgca	Protospacer
****.****************************

38. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 1, identity: 0.969

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gtcccgaacggccttctctgcatctttgatgt	Protospacer
************.*******************

39. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046349 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttgccttgcaggttgatttgcgtggc	Protospacer
***********.**** ***************

40. spacer 1.2|376|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KC170285 (Uncultured bacterium plasmid pMBUI2, complete sequence) position: , mismatch: 2, identity: 0.938

atgtagttgccctgcatgttgatttgcgtggc	CRISPR spacer
atgtagttggcctgcatattgatttgcgtggc	Protospacer
********* *******.**************

41. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

42. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

43. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

44. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

45. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

46. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

47. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

48. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

49. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

50. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

51. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

52. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

53. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

54. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

55. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

56. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

57. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

58. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

59. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

60. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

61. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

62. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

63. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KT887559 (Pseudomonas phage phi3, complete genome) position: , mismatch: 2, identity: 0.938

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
ccgtccagcggcggctggatctcgccggggaa	Protospacer
****** * ***********************

64. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to HQ711985 (Pseudomonas phage vB_PaeS_PMG1, complete genome) position: , mismatch: 2, identity: 0.938

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
agggaggaagtcgcggcactgcgcgcaagggt	Protospacer
* ************.*****************

65. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 2, identity: 0.938

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
agggaggaagtcgaagcactgcgcgcaagggt	Protospacer
* *********** ******************

66. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011373 (Pseudomonas phage PAJU2, complete genome) position: , mismatch: 2, identity: 0.938

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagcttctgcggtgatgatgccgccccatatc	Protospacer
*** ************************ ***

67. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AP009624 (Pseudomonas phage PAJU2 DNA, complete genome) position: , mismatch: 2, identity: 0.938

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
tagcttctgcggtgatgatgccgccccatatc	Protospacer
*** ************************ ***

68. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KT887559 (Pseudomonas phage phi3, complete genome) position: , mismatch: 2, identity: 0.938

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
atgaacgcctcgatctcggtgcggctcttcca	Protospacer
************************  ******

69. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

70. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

71. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

72. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

73. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

74. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

75. spacer 2.16|10316|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 2, identity: 0.938

cacgtctggctcacactgttcgagcagcaact	CRISPR spacer
cacgtctggctcgcactgctcgagcagcaact	Protospacer
************.*****.*************

76. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011165 (Pseudomonas phage LBL3, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

77. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT491205 (Pseudomonas phage vB_PaeM_USP_2, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

78. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT933737 (Pseudomonas phage PASA16, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

79. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

80. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to FM201281 (Pseudomonas phage LBL3 complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

81. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN615701 (Pseudomonas phage vB_PaeM_SMS21, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

82. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

83. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_048676 (Pseudomonas phage SL1, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

84. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to GU815091 (Pseudomonas phage JG024, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

85. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

86. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT108727 (Pseudomonas phage Epa11, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

87. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN131141 (Pseudomonas virus PaP1_EPu-2019, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

88. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

89. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN615700 (Pseudomonas phage vB_PaeM_SMS12, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

90. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KR054033 (Pseudomonas phage DL68, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

91. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK318076 (Pseudomonas phage vB_PaeM_fHoPae01, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

92. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011703 (Pseudomonas phage 14-1, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

93. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT491204 (Pseudomonas phage vB_PaeM_USP_1, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

94. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN131143 (Pseudomonas virus PA11P1, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

95. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT119369 (Pseudomonas phage sortsol, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

96. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN615702 (Pseudomonas phage vB_PaeM_SMS29, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

97. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF623055 (Pseudomonas phage BrSP1, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

98. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_050147 (Pseudomonas phage Epa13, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

99. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_042080 (Pseudomonas phage vB_PaeM_E215, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

100. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_050148 (Pseudomonas virus Pa193, complete genome) position: , mismatch: 3, identity: 0.906

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aggcaggaagtcgcagcactgcgcgcaagggc	Protospacer
* * ***************************.

101. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011373 (Pseudomonas phage PAJU2, complete genome) position: , mismatch: 3, identity: 0.906

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
gcatgaaccatcgacgcacagcaatctggcta	Protospacer
* *******.*** ******************

102. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AP009624 (Pseudomonas phage PAJU2 DNA, complete genome) position: , mismatch: 3, identity: 0.906

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
gcatgaaccatcgacgcacagcaatctggcta	Protospacer
* *******.*** ******************

103. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AF165214 (Bacteriophage D3, complete genome) position: , mismatch: 4, identity: 0.875

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
gagaaggaagtctcagcactgcgcgcaagggt	Protospacer
. *.******** *******************

104. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MG676466 (Pseudomonas phage TC6, complete genome) position: , mismatch: 4, identity: 0.875

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
agggaggaagtcgcagcactgtgcgcaaagct	Protospacer
* *******************.******.* *

105. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_031274 (Pseudomonas phage O4, complete genome) position: , mismatch: 4, identity: 0.875

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
agggaggaagtcgcagcactgtgcgcaaagct	Protospacer
* *******************.******.* *

106. spacer 1.8|737|32|NZ_NFFQ01000064|CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 5, identity: 0.844

atagctacgccgagccagttgtaagctgacgc	CRISPR spacer
atggtgattccgagccagttgtaagctgacgc	Protospacer
**.*. *. ***********************

107. spacer 2.9|9895|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.844

acattcatgcgagacgggatcaagcgattgat	CRISPR spacer
acgttcatgcgcgacgggatcaagcggctcat	Protospacer
**.******** **************..* **

108. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 5, identity: 0.844

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gttgctctgcggtgatgatgccgccccagatc	Protospacer
   ..***************************

109. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 5, identity: 0.844

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gttgctctgcggtgatgatgccgccccagatc	Protospacer
   ..***************************

110. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 5, identity: 0.844

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gttgctctgcggtgatgatgccgccccagatc	Protospacer
   ..***************************

111. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 5, identity: 0.844

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gttgctctgcggtgatgatgccgccccagatc	Protospacer
   ..***************************

112. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 5, identity: 0.844

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gttgctctgcggtgatgatgccgccccagatc	Protospacer
   ..***************************

113. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.812

atgcagcc-gttcctcgacgatctgcacgccat	CRISPR spacer
-cgcgtccggttcctcgacgatcagcacgccag	Protospacer
 .**. ** ************** ******** 

114. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 6, identity: 0.812

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
agggaggaagtcgcggcactgcgcgccaaact	Protospacer
* ************.*********** *.. *

115. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MF788075 (Pseudomonas phage IME180, complete genome) position: , mismatch: 6, identity: 0.812

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aaggaggaagtcgctgaactgcgcgcaaaact	Protospacer
* ************ * ***********.. *

116. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.812

atgaacgcctcgatctcggtgcgg-gacttcca	CRISPR spacer
atgagcggctcgatctcggtgcggtcgcgtcc-	Protospacer
****.** ****************  .* *** 

117. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH450118 (Arthrobacter phage Herb, complete genome) position: , mismatch: 6, identity: 0.818

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
gggcaccgtgccgcttggtggcggtctggtcct	Protospacer
. *** ***** ****************** * 

118. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggcatgcgcgtgaccgagctggccttactgga	CRISPR spacer
ggcatccgcgtgatcgagctggcctgcaacga	Protospacer
***** *******.***********     **

119. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 7, identity: 0.781

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
tctccggggggcggctggacctcgccggggag	Protospacer
.* .*  ************.***********.

120. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 7, identity: 0.781

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
tctccggggggcggctggacctcgccggggag	Protospacer
.* .*  ************.***********.

121. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 7, identity: 0.781

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
tctccggggggcggctggacctcgccggggag	Protospacer
.* .*  ************.***********.

122. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

123. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

124. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

125. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

126. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

127. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

128. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

129. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

130. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

131. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

132. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

133. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

134. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

135. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

136. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

137. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

138. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT498035 (Gordonia Phage Barsten, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

139. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

140. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctgcacatcac	Protospacer
.  ********** *************..**.

141. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MG593802 (Streptomyces phage Omar, complete genome) position: , mismatch: 7, identity: 0.781

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gtgcagccgttcctcgacgcactgatgggcat	Protospacer
.******************  ***   * ***

142. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.781

atgaacgcctcgatctcggtgcgg-gacttcca	CRISPR spacer
ttgatcgcctcgatctcggtccggcggcctgc-	Protospacer
 *** *************** *** *.*.* * 

143. spacer 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 7, identity: 0.781

gagggtcaggactgggccacctacctgggcca	CRISPR spacer
gagacggaggacggggccaccttcctgggcaa	Protospacer
***.   ***** ********* ******* *

144. spacer 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 7, identity: 0.781

gagggtcaggactgggccacctacctgggcca	CRISPR spacer
gagacggaggacggggccaccttcctgggcaa	Protospacer
***.   ***** ********* ******* *

145. spacer 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027519 (Thermus thermophilus isolate TTHNAR1 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

gagggtcaggactgggccacctacctgggcca	CRISPR spacer
gagacggaggacggggccaccttcctgggcaa	Protospacer
***.   ***** ********* ******* *

146. spacer 2.15|10256|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_017767 (Thermus thermophilus HB8 plasmid pVV8, complete sequence) position: , mismatch: 7, identity: 0.781

gagggtcaggactgggccacctacctgggcca	CRISPR spacer
gagacggaggacggggccaccttcctgggcaa	Protospacer
***.   ***** ********* ******* *

147. spacer 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

--ggccaccgccggacccgcgcatggcgcctgct	CRISPR spacer
tcggc--ccgccgggcccgcgcattgcgccggta	Protospacer
  ***  *******.********* ***** *. 

148. spacer 2.20|10557|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

gctctcgatcctcggcaaggtggtaacgatat	CRISPR spacer
gctctcgatcctcggcctggtggtgctgatcg	Protospacer
****************  ******. .***  

149. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020332 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM259, complete sequence) position: , mismatch: 8, identity: 0.75

ggcatgcgcgtgaccgagctggccttactgga------	CRISPR spacer
ggcatgagcgtgaccgagctgtcc------gaggaact	Protospacer
****** ************** **      **      

150. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN850624 (Escherichia phage usur, complete genome) position: , mismatch: 8, identity: 0.75

ggcatgcgcgtgaccgagctggccttactgga	CRISPR spacer
ggcatacgcctgaccgagctggctggccttgg	Protospacer
*****.*** *************.   ** *.

151. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN850583 (Escherichia phage glasur, complete genome) position: , mismatch: 8, identity: 0.75

ggcatgcgcgtgaccgagctggccttactgga	CRISPR spacer
ggcatacgcctgaccgagctggctggccttgg	Protospacer
*****.*** *************.   ** *.

152. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

-ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
gacgt-ctggggcggctgggtctcggcggatgc	Protospacer
  *** *************.***** ***. . 

153. spacer 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccttacggctacgcgccgatctcgccca	CRISPR spacer
ctcgccgtacggatacgcgccgaaccgggcgg	Protospacer
****** ***** ********** *. * * .

154. spacer 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgccttacggctacgcgccgatctcgccca	CRISPR spacer
ctcgccgtacggatacgcgccgaaccgggcgg	Protospacer
****** ***** ********** *. * * .

155. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
atgcagcaggtcctcgacgatctcggcgcgca	Protospacer
******* * *************  .***   

156. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
ggcctgccgtgcctcgaagatctgcacgcccg	Protospacer
.  * ***** ****** ************  

157. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
ctgcagccgttccaccacgatctgcgggtgac	Protospacer
 ************ * *********. *. *.

158. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MH976511 (Gordonia phage Gaea, complete genome) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctacacatcac	Protospacer
.  ********** *********.***..**.

159. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT723937 (Gordonia phage JKSyngboy, complete genome) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gaccagccgttccacgacgatctacacatcac	Protospacer
.  ********** *********.***..**.

160. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cggaggccgttcctcgacgaacggcacgacgt	Protospacer
  * .*************** * ***** *.*

161. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
ctgcagccgttcctggacgaactgatcgaaac	Protospacer
 ************* ***** ***  **  *.

162. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.75

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
atggtcggtttcctcgacgatctgaacggcat	Protospacer
***      *************** *** ***

163. spacer 2.7|9775|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75

acggaggaagtcgcagcactgcgcgcaagggt	CRISPR spacer
aaggcggtagtcgcagcactgcgcgattgcgg	Protospacer
* ** ** *****************   * * 

164. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 8, identity: 0.75

-tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
gccggccct-cggcgatgatgccgccccaggtc	Protospacer
 . *...** ***.****************.**

165. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
ttcaacgcctcgatctcgatgcgcgacgtgac	Protospacer
 * ***************.**** *** *   

166. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
ttcaacgcctcgatctcgatgcgcgacgtgac	Protospacer
 * ***************.**** *** *   

167. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 8, identity: 0.75

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
agcagcgcctcggtctcggcgcgggactgcgc	Protospacer
*  *.*******.******.******** *  

168. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

atgaacgcctcgatctcggtgcgggacttcca----	CRISPR spacer
atgaacgcctctatctcggtacga----tcgagaaa	Protospacer
*********** ********.**.    ** *    

169. spacer 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75

ggccaccgccggacccgcgcatggcgcctgct	CRISPR spacer
ggatgccgccggacccgcggatggtgccctcc	Protospacer
** ..************** ****.***. *.

170. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to GU070616 (Salmonella phage PVP-SE1, complete genome) position: , mismatch: 8, identity: 0.75

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
atcaacaacggctttcaatgcatctttgatag	Protospacer
.**   **********  ************. 

171. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to JX181824 (Salmonella phage SSE-121, complete genome) position: , mismatch: 8, identity: 0.75

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
atcaacaacggctttcaatgcatctttgatag	Protospacer
.**   **********  ************. 

172. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 9, identity: 0.719

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
gcaagcaatggccgctggatctggccggggaa	Protospacer
 *.  * . *** ********* *********

173. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
gcaagcaatggccgctggatctggccggggaa	Protospacer
 *.  * . *** ********* *********

174. spacer 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccttacggctacgcgccgatctcgccca	CRISPR spacer
atgatggaacgcctacgcgccggtctcgccca	Protospacer
 * ..   *** **********.*********

175. spacer 2.5|9655|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038637 (Cupriavidus oxalaticus strain X32 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgccttacggctacgcgccgatctcgccca	CRISPR spacer
agcgatacgcggctacgcgcagatctcgcgca	Protospacer
  ** . ..*********** ******** **

176. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gcgcagccgttccttgccgatctgcccttcga	Protospacer
..************.* ******** * .*. 

177. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
ctgaagccgatcctcgacgatctgatgacccg	Protospacer
 ** ***** **************   .**  

178. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
ggacagccgttcctcgccgatctgaacggtga	Protospacer
. .************* ******* *** .. 

179. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gcacagcggttcgtcgacgatctgcaccctgg	Protospacer
...**** **** ************** *.. 

180. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019949 (Methylocystis bryophila strain S285 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atgcag-ccgttcctcgacgatctgcacgccat	CRISPR spacer
-tacgatccgttcctcgactatctgcgcgcgga	Protospacer
 *.*.. ************ ******.*** . 

181. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgca----cgccat	CRISPR spacer
ggtcagcagttcctggacgatctgcagcagcg----	Protospacer
.  **** ****** ***********    **    

182. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011982 (Agrobacterium vitis S4 plasmid pTiS4, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gtcgagccgttcctcgccgatccgcaccatgt	Protospacer
.*  ************ *****.****  ..*

183. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_011982 (Agrobacterium vitis S4 plasmid pTiS4, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
gtcgagccgttcctcgccgatccgcaccatgt	Protospacer
.*  ************ *****.****  ..*

184. spacer 2.8|9835|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to HQ634156 (Vibrio phage PWH3a-P1 genomic sequence) position: , mismatch: 9, identity: 0.719

agcaagtgtggcgtgaatggtctgaccgcact	CRISPR spacer
cgaaagtgttgcgtgaatggtatgactttaga	Protospacer
 * ****** *********** ****. .*  

185. spacer 2.11|10016|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgtcaatctgcgacaccgtgcagagtca	CRISPR spacer
ctggtggccatctgcgacaccgtgccggagcg	Protospacer
  **** * **************** *.. *.

186. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

187. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

188. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK972697 (Salmonella phage SF10, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

189. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK972696 (Salmonella phage Si3 KFo-2019, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

190. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to X67137 (Salmonella typhimurium bacteriophage ES18 genes 13, 19 and 15) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

191. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK972695 (Salmonella phage SI5, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

192. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK972688 (Salmonella phage SI8, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

193. spacer 2.12|10076|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK972689 (Salmonella phage SF6, complete genome) position: , mismatch: 9, identity: 0.719

gaatgaaccgtcgccgcacagcaatctggcta	CRISPR spacer
aaatgaaccgttgccgcacaggaagtcagccc	Protospacer
.**********.********* ** ...**. 

194. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028971 (Aminobacter sp. MSH1 plasmid pUSP3, complete sequence) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
atgaccgcctcgatctcggcgcgatacgcttc	Protospacer
**** **************.***. ** ... 

195. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
cggatcgcctcgatctcggcgcgggtcaccgg	Protospacer
  ** **************.***** * .* .

196. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaagcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

197. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
gggaacgcctcgaactcgatgcgggtcggaga	Protospacer
. *********** ****.****** *    *

198. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaagcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

199. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaagcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

200. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaggcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

201. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaagcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

202. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtgcgggacttcca----	CRISPR spacer
cggaacgcctcggtttcggtgcggg----cgaagat	Protospacer
  **********.*.**********    * *    

203. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaagcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

204. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 9, identity: 0.719

atgaacgcctcgatctcggtg-----cgggacttcca	CRISPR spacer
cggaaggcctcgatctcggcgcgggtcgggac-----	Protospacer
  *** *************.*     ******     

205. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 9, identity: 0.727

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
tccggacgggcagcttggtggcggtgtggtcga	Protospacer
 *  ..** **************** ****  *

206. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 9, identity: 0.727

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
tccggacgggcagcttggtggcggtgtggtcga	Protospacer
 *  ..** **************** ****  *

207. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 9, identity: 0.727

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
tccggacgggcagcttggtggcggtgtggtcga	Protospacer
 *  ..** **************** ****  *

208. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 9, identity: 0.727

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
gaccggcgtgcagcttgttggtggtctggcccg	Protospacer
.  *.************ ***.*******. *.

209. spacer 2.19|10496|33|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 9, identity: 0.727

acgcagcgtgcagcttggtggcggtctggtgca	CRISPR spacer
gaccggcgtgcagcttgttggtggtctggcccg	Protospacer
.  *.************ ***.*******. *.

210. spacer 2.22|10677|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 9, identity: 0.719

cttgccctcggccaattgctggccgactcggt	CRISPR spacer
cggcccctcggccagtggctggccgaccgaga	Protospacer
*   **********.* **********. .* 

211. spacer 2.23|10737|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to KR052482 (Sinorhizobium phage phiN3, complete genome) position: , mismatch: 9, identity: 0.719

gtcccgaacggctttctctgcatctttgatgt	CRISPR spacer
gcgcttggcggcttcctgtgcatctttgatgc	Protospacer
*. *. ..******.** *************.

212. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcatgcgcgtgaccgagctggccttactgga	CRISPR spacer
ggcatgcgcgtgatcgagctcgcacacatcat	Protospacer
*************.****** ** .   * . 

213. spacer 2.1|9414|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcatgcgcgtgaccgagctggccttactgga	CRISPR spacer
ggcatgcgcgtgatcgagcttgcgcacatcat	Protospacer
*************.****** ** .   * . 

214. spacer 2.3|9535|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018284 (Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome) position: , mismatch: 10, identity: 0.688

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcgtctatcagagttgttgtagaacatcccaa	Protospacer
***** *****.*********** ...   .*

215. spacer 2.4|9595|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 10, identity: 0.688

ccgtcctggggcggctggatctcgccggggaa	CRISPR spacer
ggccccgggggcggctgggtctcgccgcgctt	Protospacer
   .** ***********.******** *   

216. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

217. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcggcacgctcg	Protospacer
   .* ********** ***** ******.  

218. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

219. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

220. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

221. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

222. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

223. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

224. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

225. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

226. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcggcacgctcg	Protospacer
   .* ********** ***** ******.  

227. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcggcacgctcg	Protospacer
   .* ********** ***** ******.  

228. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.688

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgctatccgttcctcgccgatcagcacgctcg	Protospacer
   .* ********** ***** ******.  

229. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 10, identity: 0.688

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
ccacggtcgcggtgatgatggcgcgccagatc	Protospacer
. .   ..************ *** *******

230. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.688

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
cggcgagcacggtgatgatgccgaaccagatc	Protospacer
..*    ..**************  *******

231. spacer 2.14|10196|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 10, identity: 0.688

atgaacgcctcgatctcggtgcgggacttcca	CRISPR spacer
tgcgccgcctcgatatcggtgcgggcctcgaa	Protospacer
   . ********* ********** **.  *

232. spacer 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.688

ggccaccgccggacccgcgcatggcgcctgct	CRISPR spacer
catggccgctggacccgcccatggcgccggac	Protospacer
 .. .****.******** ********* * .

233. spacer 2.18|10436|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688

ggccaccgccggacccgcgcatggcgcctgct	CRISPR spacer
attcaccgccggccccgtgcatggcggatttg	Protospacer
. .********* ****.********  * . 

234. spacer 2.6|9715|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 11, identity: 0.656

atgcagccgttcctcgacgatctgcacgccat	CRISPR spacer
cgagagccgtccctcggcgatctgcacctgca	Protospacer
  . ******.*****.********** .   

235. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
cgctcgttgcggtgatgatcctgccccagaaa	Protospacer
..  . .************ *.********  

236. spacer 2.13|10136|32|NZ_NFFQ01000064|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 11, identity: 0.656

tagattctgcggtgatgatgccgccccagatc	CRISPR spacer
cgatgagcgcggtgatgatccagccccagatg	Protospacer
...    .*********** * ********* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_NFFQ01000060
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000060_1 3119-3255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_NFFQ01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 245794 : 253240 9 Acinetobacter_phage(33.33%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_NFFQ01000002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000002_1 305792-305884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_NFFQ01000068
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 183 : 7064 14 Pseudomonas_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_NFFQ01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000020_1 79480-79743 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NFFQ01000020_1 1.3|79683|43|NZ_NFFQ01000020|PILER-CR 79683-79725 43 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 168287-168329 0 1.0
NZ_NFFQ01000020_1 1.3|79683|43|NZ_NFFQ01000020|PILER-CR 79683-79725 43 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 116299-116341 0 1.0
NZ_NFFQ01000020_1 1.1|79501|67|NZ_NFFQ01000020|PILER-CR 79501-79567 67 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 168108-168174 7 0.896
NZ_NFFQ01000020_1 1.1|79501|67|NZ_NFFQ01000020|PILER-CR 79501-79567 67 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 116120-116186 7 0.896
NZ_NFFQ01000020_1 1.1|79501|67|NZ_NFFQ01000020|PILER-CR 79501-79567 67 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 90688-90754 8 0.881
NZ_NFFQ01000020_1 1.2|79589|73|NZ_NFFQ01000020|PILER-CR 79589-79661 73 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 168193-168265 14 0.808
NZ_NFFQ01000020_1 1.2|79589|73|NZ_NFFQ01000020|PILER-CR 79589-79661 73 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 116205-116277 14 0.808

1. spacer 1.3|79683|43|NZ_NFFQ01000020|PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

cgccccataagttttcacttctcaccccatatatattcaccct	CRISPR spacer
cgccccataagttttcacttctcaccccatatatattcaccct	Protospacer
*******************************************

2. spacer 1.3|79683|43|NZ_NFFQ01000020|PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 0, identity: 1.0

cgccccataagttttcacttctcaccccatatatattcaccct	CRISPR spacer
cgccccataagttttcacttctcaccccatatatattcaccct	Protospacer
*******************************************

3. spacer 1.1|79501|67|NZ_NFFQ01000020|PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 7, identity: 0.896

tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg	CRISPR spacer
tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg	Protospacer
************************************************************

4. spacer 1.1|79501|67|NZ_NFFQ01000020|PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 7, identity: 0.896

tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg	CRISPR spacer
tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg	Protospacer
************************************************************

5. spacer 1.1|79501|67|NZ_NFFQ01000020|PILER-CR matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 8, identity: 0.881

tcccccgatcctggtgctcgaccagtagccttcaaatggccccatatgctttcacctttg	CRISPR spacer
tcccccgatcctggtgctcgaccggtagccttcaaatggccccatatgctttcacctttg	Protospacer
***********************.************************************

6. spacer 1.2|79589|73|NZ_NFFQ01000020|PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 14, identity: 0.808

ttcacgctccccacatccattcacctttcggcccacatccattcacctctcaccccatag	CRISPR spacer
ttcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatag	Protospacer
****************************** *****************************

7. spacer 1.2|79589|73|NZ_NFFQ01000020|PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 14, identity: 0.808

ttcacgctccccacatccattcacctttcggcccacatccattcacctctcaccccatag	CRISPR spacer
ttcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatag	Protospacer
****************************** *****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_NFFQ01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53809 : 61471 10 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_NFFQ01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44165 : 82625 33 Agrobacterium_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_NFFQ01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27729 : 33915 9 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_2 244571 : 253600 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_NFFQ01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14649 : 24915 13 Pseudomonas_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_NFFQ01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 136979 : 154721 23 uncultured_Caudovirales_phage(41.18%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_NFFQ01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 162888 : 171513 10 uncultured_Caudovirales_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_NFFQ01000045
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000045_1 36564-37432 Orphan I-F
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NFFQ01000045_1 1.5|36833|31|NZ_NFFQ01000045|CRISPRCasFinder 36833-36863 31 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 38679-38709 0 1.0
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 NC_031091 Pseudomonas phage MD8, complete genome 29507-29537 0 1.0
NZ_NFFQ01000045_1 1.19|36832|32|NZ_NFFQ01000045|CRT 36832-36863 32 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 38679-38710 0 1.0
NZ_NFFQ01000045_1 1.21|36952|32|NZ_NFFQ01000045|CRT 36952-36983 32 NC_031091 Pseudomonas phage MD8, complete genome 29506-29537 0 1.0
NZ_NFFQ01000045_1 1.35|36952|34|NZ_NFFQ01000045|PILER-CR 36952-36985 34 NC_031091 Pseudomonas phage MD8, complete genome 29506-29539 0 1.0
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 NC_030931 Pseudomonas phage phi2, complete genome 5833-5863 1 0.968
NZ_NFFQ01000045_1 1.9|37073|31|NZ_NFFQ01000045|CRISPRCasFinder 37073-37103 31 MT613935 Pseudomonas phage Persinger, complete genome 10409-10439 1 0.968
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 MT613935 Pseudomonas phage Persinger, complete genome 15440-15470 1 0.968
NZ_NFFQ01000045_1 1.21|36952|32|NZ_NFFQ01000045|CRT 36952-36983 32 NC_030931 Pseudomonas phage phi2, complete genome 5832-5863 1 0.969
NZ_NFFQ01000045_1 1.23|37072|32|NZ_NFFQ01000045|CRT 37072-37103 32 MT613935 Pseudomonas phage Persinger, complete genome 10408-10439 1 0.969
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 MT613935 Pseudomonas phage Persinger, complete genome 15440-15471 1 0.969
NZ_NFFQ01000045_1 1.35|36952|34|NZ_NFFQ01000045|PILER-CR 36952-36985 34 NC_030931 Pseudomonas phage phi2, complete genome 5832-5865 1 0.971
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 MG707188 Pseudomonas phage TC7, partial genome 14901-14931 2 0.935
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 14350-14380 2 0.935
NZ_NFFQ01000045_1 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder 37193-37223 31 MG707188 Pseudomonas phage TC7, partial genome 10188-10218 2 0.935
NZ_NFFQ01000045_1 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder 37193-37223 31 NC_031091 Pseudomonas phage MD8, complete genome 25085-25115 2 0.935
NZ_NFFQ01000045_1 1.14|37373|31|NZ_NFFQ01000045|CRISPRCasFinder 37373-37403 31 KC900378 Pseudomonas phage LKA5, complete genome 62887-62917 2 0.935
NZ_NFFQ01000045_1 1.14|37373|31|NZ_NFFQ01000045|CRISPRCasFinder 37373-37403 31 LT603684 Pseudomonas phage phiC725A genome assembly 62290-62320 2 0.935
NZ_NFFQ01000045_1 1.21|36952|32|NZ_NFFQ01000045|CRT 36952-36983 32 MG707188 Pseudomonas phage TC7, partial genome 14900-14931 2 0.938
NZ_NFFQ01000045_1 1.21|36952|32|NZ_NFFQ01000045|CRT 36952-36983 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 14350-14381 2 0.938
NZ_NFFQ01000045_1 1.25|37192|32|NZ_NFFQ01000045|CRT 37192-37223 32 MG707188 Pseudomonas phage TC7, partial genome 10187-10218 2 0.938
NZ_NFFQ01000045_1 1.25|37192|32|NZ_NFFQ01000045|CRT 37192-37223 32 NC_031091 Pseudomonas phage MD8, complete genome 25084-25115 2 0.938
NZ_NFFQ01000045_1 1.28|37372|32|NZ_NFFQ01000045|CRT 37372-37403 32 KC900378 Pseudomonas phage LKA5, complete genome 62886-62917 2 0.938
NZ_NFFQ01000045_1 1.28|37372|32|NZ_NFFQ01000045|CRT 37372-37403 32 LT603684 Pseudomonas phage phiC725A genome assembly 62289-62320 2 0.938
NZ_NFFQ01000045_1 1.33|36832|34|NZ_NFFQ01000045|PILER-CR 36832-36865 34 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 38677-38710 2 0.941
NZ_NFFQ01000045_1 1.35|36952|34|NZ_NFFQ01000045|PILER-CR 36952-36985 34 MG707188 Pseudomonas phage TC7, partial genome 14900-14933 2 0.941
NZ_NFFQ01000045_1 1.35|36952|34|NZ_NFFQ01000045|PILER-CR 36952-36985 34 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 14348-14381 2 0.941
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 MT613935 Pseudomonas phage Persinger, complete genome 15438-15471 2 0.941
NZ_NFFQ01000045_1 1.37|37072|34|NZ_NFFQ01000045|PILER-CR 37072-37105 34 MT613935 Pseudomonas phage Persinger, complete genome 10408-10441 3 0.912
NZ_NFFQ01000045_1 1.39|37192|34|NZ_NFFQ01000045|PILER-CR 37192-37225 34 MG707188 Pseudomonas phage TC7, partial genome 10187-10220 3 0.912
NZ_NFFQ01000045_1 1.39|37192|34|NZ_NFFQ01000045|PILER-CR 37192-37225 34 NC_031091 Pseudomonas phage MD8, complete genome 25084-25117 3 0.912
NZ_NFFQ01000045_1 1.42|37372|34|NZ_NFFQ01000045|PILER-CR 37372-37405 34 KC900378 Pseudomonas phage LKA5, complete genome 62886-62919 4 0.882
NZ_NFFQ01000045_1 1.42|37372|34|NZ_NFFQ01000045|PILER-CR 37372-37405 34 LT603684 Pseudomonas phage phiC725A genome assembly 62289-62322 4 0.882
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 207706-207736 6 0.806
NZ_NFFQ01000045_1 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder 36893-36923 31 NC_012209 Yersinia enterocolitica plasmid pYe4449-2, complete sequence 7985-8015 6 0.806
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 KC292028 Halovirus HCTV-2, complete genome 25345-25375 6 0.806
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 264308-264338 6 0.806
NZ_NFFQ01000045_1 1.20|36892|32|NZ_NFFQ01000045|CRT 36892-36923 32 NC_012209 Yersinia enterocolitica plasmid pYe4449-2, complete sequence 7985-8016 6 0.812
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 46452-46482 7 0.774
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 KC710998 Shigella phage pSf-1, complete genome 10831-10861 7 0.774
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049853 Escherichia phage Henu8, complete genome 47079-47109 7 0.774
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 207705-207736 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 KC292028 Halovirus HCTV-2, complete genome 25345-25376 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 304446-304477 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 264307-264338 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 304410-304441 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1698094-1698125 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1714799-1714830 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 304236-304267 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 304222-304253 7 0.781
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1679054-1679085 7 0.781
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1119857-1119887 8 0.742
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 AF165214 Bacteriophage D3, complete genome 51521-51551 8 0.742
NZ_NFFQ01000045_1 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder 36893-36923 31 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 424508-424538 8 0.742
NZ_NFFQ01000045_1 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder 36953-36983 31 NZ_LR594663 Variovorax sp. RA8 plasmid 2 68369-68399 8 0.742
NZ_NFFQ01000045_1 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder 37193-37223 31 MT024869 Arthrobacter phage Lego, complete genome 1347-1377 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850572 Escherichia phage aaroes, complete genome 3969-3999 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065657 UNVERIFIED: Campylobacter phage C4, complete genome 24154-24184 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065675 UNVERIFIED: Campylobacter phage A118, complete genome 10589-10619 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065687 UNVERIFIED: Campylobacter phage A136, complete genome 33677-33707 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065649 UNVERIFIED: Campylobacter phage A143, complete genome 32336-32366 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850604 Escherichia phage tunzivis, complete genome 3405-3435 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065667 UNVERIFIED: Campylobacter phage A127, complete genome 34708-34738 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850582 Escherichia phage ityhuna, complete genome 45102-45132 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065671 UNVERIFIED: Campylobacter phage A120, complete genome 42692-42722 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049823 Escherichia phage herni, complete genome 12097-12127 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850591 Escherichia phage aalborv, complete genome 42877-42907 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065679 UNVERIFIED: Campylobacter phage A13a, complete genome 18242-18272 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065665 UNVERIFIED: Campylobacter phage A131, complete genome 33513-33543 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065685 UNVERIFIED: Campylobacter phage A112a, complete genome 13701-13731 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MK373798 Escherichia phage vB_EcoS_G29-2, complete genome 46051-46081 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065663 UNVERIFIED: Campylobacter phage A134, complete genome 33513-33543 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065670 UNVERIFIED: Campylobacter phage A121, complete genome 26940-26970 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065681 UNVERIFIED: Campylobacter phage A139, complete genome 34738-34768 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065638 UNVERIFIED: Campylobacter phage A15a, complete genome 9897-9927 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049817 Escherichia phage tonnikala, complete genome 8832-8862 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 LT841304 Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I 42511-42541 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049830 Escherichia phage PGN590, complete genome 13686-13716 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850607 Escherichia phage egaa, complete genome 6526-6556 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065640 UNVERIFIED: Campylobacter phage A14b, complete genome 2380-2410 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850600 Escherichia phage haarsle, complete genome 43068-43098 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 LR596614 Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 14157-14187 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 28151-28181 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850586 Escherichia phage orkinos, complete genome 38180-38210 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN781674 Escherichia phage vB_EcoS_XY3, complete genome 45484-45514 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 49392-49422 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MK962751 Shigella phage JK16, complete genome 9016-9046 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065673 UNVERIFIED: Campylobacter phage A119, complete genome 26430-26460 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049819 Escherichia phage atuna, complete genome 49058-49088 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850634 Escherichia phage tinuso, complete genome 50705-50735 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065641 UNVERIFIED: Campylobacter phage A14a, complete genome 28830-28860 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065680 UNVERIFIED: Campylobacter phage A113, complete genome 32884-32914 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_047938 Escherichia phage SECphi27 genome assembly, complete genome: monopartite 4973-5003 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065669 UNVERIFIED: Campylobacter phage A123, complete genome 10573-10603 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850638 Escherichia phage tunus, complete genome 38189-38219 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049825 Escherichia phage grams, complete genome 47811-47841 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065643 UNVERIFIED: Campylobacter phage E6, complete genome 47557-47587 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049815 Escherichia phage tonn, complete genome 19175-19205 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_049827 Escherichia phage damhaus, complete genome 29537-29567 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850641 Escherichia phage tonijn, complete genome 30004-30034 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MT360681 Shigella virus 2019SD1, complete genome 37951-37981 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MG065636 UNVERIFIED: Campylobacter phage A16a, complete genome 26399-26429 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 88120-88150 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1652988-1653018 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1611013-1611043 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1389681-1389711 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 87938-87968 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 37193-37223 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1554268-1554298 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1330349-1330379 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 88231-88261 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 88118-88148 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1216520-1216550 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 354208-354238 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1879922-1879952 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 417845-417875 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 340223-340253 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1021367-1021397 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1337293-1337323 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1654480-1654510 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 881850-881880 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 876912-876942 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 926709-926739 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 241430-241460 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1073755-1073785 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 90837-90867 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 180126-180156 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1543597-1543627 8 0.742
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1653004-1653034 8 0.742
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1488014-1488044 8 0.742
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 92256-92286 8 0.742
NZ_NFFQ01000045_1 1.21|36952|32|NZ_NFFQ01000045|CRT 36952-36983 32 NZ_LR594663 Variovorax sp. RA8 plasmid 2 68369-68400 8 0.75
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 KC710998 Shigella phage pSf-1, complete genome 10830-10861 8 0.75
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049853 Escherichia phage Henu8, complete genome 47078-47109 8 0.75
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1488014-1488045 8 0.75
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 92256-92287 8 0.75
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 418821-418852 8 0.75
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 KC292028 Halovirus HCTV-2, complete genome 25343-25376 8 0.765
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1489937-1489967 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1410947-1410977 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 95575-95605 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1482854-1482884 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1409969-1409999 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1410939-1410969 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1410292-1410322 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1410930-1410960 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1490096-1490126 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1490077-1490107 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1618124-1618154 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1490060-1490090 9 0.71
NZ_NFFQ01000045_1 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder 36653-36683 31 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 702020-702050 9 0.71
NZ_NFFQ01000045_1 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder 36893-36923 31 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 87399-87429 9 0.71
NZ_NFFQ01000045_1 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder 36893-36923 31 NC_022042 Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence 83492-83522 9 0.71
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 298272-298302 9 0.71
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850643 Escherichia phage tiwna, complete genome 41000-41030 9 0.71
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MF564201 Escherichia phage vB_EcoS-95, complete genome 9420-9450 9 0.71
NZ_NFFQ01000045_1 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder 37253-37283 31 MN850569 Escherichia phage vojen, complete genome 46678-46708 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP020970 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence 1090-1120 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 31533-31563 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 390547-390577 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 243597-243627 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 318114-318144 9 0.71
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 418822-418852 9 0.71
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1119856-1119887 9 0.719
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 AF165214 Bacteriophage D3, complete genome 51520-51551 9 0.719
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 702019-702050 9 0.719
NZ_NFFQ01000045_1 1.20|36892|32|NZ_NFFQ01000045|CRT 36892-36923 32 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 424508-424539 9 0.719
NZ_NFFQ01000045_1 1.25|37192|32|NZ_NFFQ01000045|CRT 37192-37223 32 MT024869 Arthrobacter phage Lego, complete genome 1347-1378 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850572 Escherichia phage aaroes, complete genome 3968-3999 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065657 UNVERIFIED: Campylobacter phage C4, complete genome 24153-24184 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065675 UNVERIFIED: Campylobacter phage A118, complete genome 10588-10619 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065687 UNVERIFIED: Campylobacter phage A136, complete genome 33676-33707 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065649 UNVERIFIED: Campylobacter phage A143, complete genome 32335-32366 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850604 Escherichia phage tunzivis, complete genome 3404-3435 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065667 UNVERIFIED: Campylobacter phage A127, complete genome 34708-34739 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850582 Escherichia phage ityhuna, complete genome 45101-45132 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065671 UNVERIFIED: Campylobacter phage A120, complete genome 42691-42722 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049823 Escherichia phage herni, complete genome 12096-12127 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850591 Escherichia phage aalborv, complete genome 42877-42908 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065679 UNVERIFIED: Campylobacter phage A13a, complete genome 18241-18272 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065665 UNVERIFIED: Campylobacter phage A131, complete genome 33512-33543 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065685 UNVERIFIED: Campylobacter phage A112a, complete genome 13701-13732 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MK373798 Escherichia phage vB_EcoS_G29-2, complete genome 46050-46081 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065663 UNVERIFIED: Campylobacter phage A134, complete genome 33512-33543 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065670 UNVERIFIED: Campylobacter phage A121, complete genome 26939-26970 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065681 UNVERIFIED: Campylobacter phage A139, complete genome 34738-34769 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065638 UNVERIFIED: Campylobacter phage A15a, complete genome 9896-9927 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049817 Escherichia phage tonnikala, complete genome 8831-8862 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 LT841304 Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I 42511-42542 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049830 Escherichia phage PGN590, complete genome 13686-13717 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850607 Escherichia phage egaa, complete genome 6526-6557 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065640 UNVERIFIED: Campylobacter phage A14b, complete genome 2379-2410 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850600 Escherichia phage haarsle, complete genome 43067-43098 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 LR596614 Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 14157-14188 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 28151-28182 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850586 Escherichia phage orkinos, complete genome 38179-38210 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN781674 Escherichia phage vB_EcoS_XY3, complete genome 45483-45514 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 49392-49423 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MK962751 Shigella phage JK16, complete genome 9015-9046 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065673 UNVERIFIED: Campylobacter phage A119, complete genome 26430-26461 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049819 Escherichia phage atuna, complete genome 49058-49089 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850634 Escherichia phage tinuso, complete genome 50704-50735 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065641 UNVERIFIED: Campylobacter phage A14a, complete genome 28829-28860 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065680 UNVERIFIED: Campylobacter phage A113, complete genome 32883-32914 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_047938 Escherichia phage SECphi27 genome assembly, complete genome: monopartite 4972-5003 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065669 UNVERIFIED: Campylobacter phage A123, complete genome 10572-10603 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850638 Escherichia phage tunus, complete genome 38189-38220 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049825 Escherichia phage grams, complete genome 47810-47841 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065643 UNVERIFIED: Campylobacter phage E6, complete genome 47556-47587 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049815 Escherichia phage tonn, complete genome 19175-19206 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_049827 Escherichia phage damhaus, complete genome 29536-29567 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850641 Escherichia phage tonijn, complete genome 30003-30034 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MT360681 Shigella virus 2019SD1, complete genome 37951-37982 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MG065636 UNVERIFIED: Campylobacter phage A16a, complete genome 26398-26429 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 88119-88150 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1652988-1653019 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1611013-1611044 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1389681-1389712 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 87937-87968 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 37193-37224 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1554268-1554299 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1330348-1330379 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 88230-88261 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 88117-88148 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1216520-1216551 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 354207-354238 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1879921-1879952 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 417844-417875 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 340222-340253 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1021366-1021397 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1337293-1337324 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1654479-1654510 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 881850-881881 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 876911-876942 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 926709-926740 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 241429-241460 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1073754-1073785 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 90836-90867 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 180126-180157 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 298271-298302 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1543597-1543628 9 0.719
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1653004-1653035 9 0.719
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP020970 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence 1089-1120 9 0.719
NZ_NFFQ01000045_1 1.30|36652|34|NZ_NFFQ01000045|PILER-CR 36652-36685 34 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 207705-207738 9 0.735
NZ_NFFQ01000045_1 1.35|36952|34|NZ_NFFQ01000045|PILER-CR 36952-36985 34 NZ_LR594663 Variovorax sp. RA8 plasmid 2 68367-68400 9 0.735
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1488012-1488045 9 0.735
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 92254-92287 9 0.735
NZ_NFFQ01000045_1 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder 37313-37343 31 MN234185 Mycobacterium phage Lemuria, complete genome 25915-25945 10 0.677
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1489937-1489968 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1410947-1410978 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 95574-95605 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1482854-1482885 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1409969-1410000 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1410939-1410970 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1410292-1410323 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1410930-1410961 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1490096-1490127 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1490077-1490108 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1618123-1618154 10 0.688
NZ_NFFQ01000045_1 1.16|36652|32|NZ_NFFQ01000045|CRT 36652-36683 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1490060-1490091 10 0.688
NZ_NFFQ01000045_1 1.20|36892|32|NZ_NFFQ01000045|CRT 36892-36923 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 87398-87429 10 0.688
NZ_NFFQ01000045_1 1.20|36892|32|NZ_NFFQ01000045|CRT 36892-36923 32 NC_022042 Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence 83491-83522 10 0.688
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850643 Escherichia phage tiwna, complete genome 40999-41030 10 0.688
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MF564201 Escherichia phage vB_EcoS-95, complete genome 9419-9450 10 0.688
NZ_NFFQ01000045_1 1.26|37252|32|NZ_NFFQ01000045|CRT 37252-37283 32 MN850569 Escherichia phage vojen, complete genome 46677-46708 10 0.688
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 31533-31564 10 0.688
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 390547-390578 10 0.688
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 243596-243627 10 0.688
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 318113-318144 10 0.688
NZ_NFFQ01000045_1 1.30|36652|34|NZ_NFFQ01000045|PILER-CR 36652-36685 34 AF165214 Bacteriophage D3, complete genome 51520-51553 10 0.706
NZ_NFFQ01000045_1 1.30|36652|34|NZ_NFFQ01000045|PILER-CR 36652-36685 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1119856-1119889 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 KC710998 Shigella phage pSf-1, complete genome 10830-10863 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049853 Escherichia phage Henu8, complete genome 47078-47111 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065657 UNVERIFIED: Campylobacter phage C4, complete genome 24153-24186 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065675 UNVERIFIED: Campylobacter phage A118, complete genome 10588-10621 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065687 UNVERIFIED: Campylobacter phage A136, complete genome 33676-33709 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065649 UNVERIFIED: Campylobacter phage A143, complete genome 32335-32368 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065667 UNVERIFIED: Campylobacter phage A127, complete genome 34706-34739 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065679 UNVERIFIED: Campylobacter phage A13a, complete genome 18241-18274 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065665 UNVERIFIED: Campylobacter phage A131, complete genome 33512-33545 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065685 UNVERIFIED: Campylobacter phage A112a, complete genome 13699-13732 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065663 UNVERIFIED: Campylobacter phage A134, complete genome 33512-33545 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065681 UNVERIFIED: Campylobacter phage A139, complete genome 34736-34769 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065638 UNVERIFIED: Campylobacter phage A15a, complete genome 9896-9929 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065640 UNVERIFIED: Campylobacter phage A14b, complete genome 2379-2412 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065673 UNVERIFIED: Campylobacter phage A119, complete genome 26428-26461 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065641 UNVERIFIED: Campylobacter phage A14a, complete genome 28829-28862 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065680 UNVERIFIED: Campylobacter phage A113, complete genome 32883-32916 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065669 UNVERIFIED: Campylobacter phage A123, complete genome 10572-10605 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065643 UNVERIFIED: Campylobacter phage E6, complete genome 47556-47589 10 0.706
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065636 UNVERIFIED: Campylobacter phage A16a, complete genome 26398-26431 10 0.706
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 NZ_CP020970 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence 1089-1122 10 0.706
NZ_NFFQ01000045_1 1.27|37312|32|NZ_NFFQ01000045|CRT 37312-37343 32 MN234185 Mycobacterium phage Lemuria, complete genome 25915-25946 11 0.656
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850572 Escherichia phage aaroes, complete genome 3968-4001 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850604 Escherichia phage tunzivis, complete genome 3404-3437 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850582 Escherichia phage ityhuna, complete genome 45101-45134 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065671 UNVERIFIED: Campylobacter phage A120, complete genome 42691-42724 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049823 Escherichia phage herni, complete genome 12096-12129 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850591 Escherichia phage aalborv, complete genome 42875-42908 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MK373798 Escherichia phage vB_EcoS_G29-2, complete genome 46050-46083 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MG065670 UNVERIFIED: Campylobacter phage A121, complete genome 26939-26972 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049817 Escherichia phage tonnikala, complete genome 8831-8864 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 LT841304 Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I 42509-42542 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049830 Escherichia phage PGN590, complete genome 13684-13717 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850607 Escherichia phage egaa, complete genome 6524-6557 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850600 Escherichia phage haarsle, complete genome 43067-43100 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 LR596614 Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1 14155-14188 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 28149-28182 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850586 Escherichia phage orkinos, complete genome 38179-38212 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN781674 Escherichia phage vB_EcoS_XY3, complete genome 45483-45516 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 49390-49423 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MK962751 Shigella phage JK16, complete genome 9015-9048 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049819 Escherichia phage atuna, complete genome 49056-49089 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850634 Escherichia phage tinuso, complete genome 50704-50737 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_047938 Escherichia phage SECphi27 genome assembly, complete genome: monopartite 4972-5005 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850638 Escherichia phage tunus, complete genome 38187-38220 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049825 Escherichia phage grams, complete genome 47810-47843 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049815 Escherichia phage tonn, complete genome 19173-19206 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 NC_049827 Escherichia phage damhaus, complete genome 29536-29569 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MN850641 Escherichia phage tonijn, complete genome 30003-30036 11 0.676
NZ_NFFQ01000045_1 1.40|37252|34|NZ_NFFQ01000045|PILER-CR 37252-37285 34 MT360681 Shigella virus 2019SD1, complete genome 37949-37982 11 0.676
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 390545-390578 11 0.676
NZ_NFFQ01000045_1 1.41|37312|34|NZ_NFFQ01000045|PILER-CR 37312-37345 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 243596-243629 11 0.676

1. spacer 1.5|36833|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 0, identity: 1.0

agggaaggctcgcgtttcgcctccccaccga	CRISPR spacer
agggaaggctcgcgtttcgcctccccaccga	Protospacer
*******************************

2. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 0, identity: 1.0

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
ggatgtcgcagtccatcagccgcttgatccc	Protospacer
*******************************

3. spacer 1.19|36832|32|NZ_NFFQ01000045|CRT matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 0, identity: 1.0

aagggaaggctcgcgtttcgcctccccaccga	CRISPR spacer
aagggaaggctcgcgtttcgcctccccaccga	Protospacer
********************************

4. spacer 1.21|36952|32|NZ_NFFQ01000045|CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 0, identity: 1.0

aggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
aggatgtcgcagtccatcagccgcttgatccc	Protospacer
********************************

5. spacer 1.35|36952|34|NZ_NFFQ01000045|PILER-CR matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 0, identity: 1.0

aggatgtcgcagtccatcagccgcttgatcccgt	CRISPR spacer
aggatgtcgcagtccatcagccgcttgatcccgt	Protospacer
**********************************

6. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 1, identity: 0.968

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
gaatgtcgcagtccatcagccgcttgatccc	Protospacer
*.*****************************

7. spacer 1.9|37073|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 1, identity: 0.968

ttgtgggtcgccagctgcagacgttcacgac	CRISPR spacer
tagtgggtcgccagctgcagacgttcacgac	Protospacer
* *****************************

8. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 1, identity: 0.968

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
tcaaagggccgagcgtgccgcgcagcctgct	Protospacer
****.**************************

9. spacer 1.21|36952|32|NZ_NFFQ01000045|CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 1, identity: 0.969

aggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
agaatgtcgcagtccatcagccgcttgatccc	Protospacer
**.*****************************

10. spacer 1.23|37072|32|NZ_NFFQ01000045|CRT matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 1, identity: 0.969

attgtgggtcgccagctgcagacgttcacgac	CRISPR spacer
atagtgggtcgccagctgcagacgttcacgac	Protospacer
** *****************************

11. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 1, identity: 0.969

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcaaagggccgagcgtgccgcgcagcctgct	Protospacer
*****.**************************

12. spacer 1.35|36952|34|NZ_NFFQ01000045|PILER-CR matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 1, identity: 0.971

aggatgtcgcagtccatcagccgcttgatcccgt	CRISPR spacer
agaatgtcgcagtccatcagccgcttgatcccgt	Protospacer
**.*******************************

13. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.935

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
gaatgtcgcagtccatcaaccgcttgatccc	Protospacer
*.****************.************

14. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.935

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
gaatgtcgcagtccatgagccgcttgatccc	Protospacer
*.************** **************

15. spacer 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.935

atcaggctagccatgacgggctccattacgc	CRISPR spacer
atcaggctagccattaccggctccattacgc	Protospacer
************** ** *************

16. spacer 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 2, identity: 0.935

atcaggctagccatgacgggctccattacgc	CRISPR spacer
atcaggctagccattaccggctccattacgc	Protospacer
************** ** *************

17. spacer 1.14|37373|31|NZ_NFFQ01000045|CRISPRCasFinder matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 2, identity: 0.935

ggagtacatgccgagggcgtctgtgaccata	CRISPR spacer
tgagtacatgccgagggcgtcggtgaccata	Protospacer
 ******************** *********

18. spacer 1.14|37373|31|NZ_NFFQ01000045|CRISPRCasFinder matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 2, identity: 0.935

ggagtacatgccgagggcgtctgtgaccata	CRISPR spacer
tgagtacatgccgagggcgtcggtgaccata	Protospacer
 ******************** *********

19. spacer 1.21|36952|32|NZ_NFFQ01000045|CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.938

aggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
agaatgtcgcagtccatcaaccgcttgatccc	Protospacer
**.****************.************

20. spacer 1.21|36952|32|NZ_NFFQ01000045|CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

aggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
agaatgtcgcagtccatgagccgcttgatccc	Protospacer
**.************** **************

21. spacer 1.25|37192|32|NZ_NFFQ01000045|CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.938

gatcaggctagccatgacgggctccattacgc	CRISPR spacer
gatcaggctagccattaccggctccattacgc	Protospacer
*************** ** *************

22. spacer 1.25|37192|32|NZ_NFFQ01000045|CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 2, identity: 0.938

gatcaggctagccatgacgggctccattacgc	CRISPR spacer
gatcaggctagccattaccggctccattacgc	Protospacer
*************** ** *************

23. spacer 1.28|37372|32|NZ_NFFQ01000045|CRT matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 2, identity: 0.938

aggagtacatgccgagggcgtctgtgaccata	CRISPR spacer
atgagtacatgccgagggcgtcggtgaccata	Protospacer
* ******************** *********

24. spacer 1.28|37372|32|NZ_NFFQ01000045|CRT matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 2, identity: 0.938

aggagtacatgccgagggcgtctgtgaccata	CRISPR spacer
atgagtacatgccgagggcgtcggtgaccata	Protospacer
* ******************** *********

25. spacer 1.33|36832|34|NZ_NFFQ01000045|PILER-CR matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 2, identity: 0.941

aagggaaggctcgcgtttcgcctccccaccgagg	CRISPR spacer
aagggaaggctcgcgtttcgcctccccaccgaac	Protospacer
********************************. 

26. spacer 1.35|36952|34|NZ_NFFQ01000045|PILER-CR matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.941

aggatgtcgcagtccatcagccgcttgatcccgt	CRISPR spacer
agaatgtcgcagtccatcaaccgcttgatcccgt	Protospacer
**.****************.**************

27. spacer 1.35|36952|34|NZ_NFFQ01000045|PILER-CR matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.941

aggatgtcgcagtccatcagccgcttgatcccgt	CRISPR spacer
agaatgtcgcagtccatgagccgcttgatcccgt	Protospacer
**.************** ****************

28. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 2, identity: 0.941

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
atcaaagggccgagcgtgccgcgcagcctgctgg	Protospacer
*****.*************************** 

29. spacer 1.37|37072|34|NZ_NFFQ01000045|PILER-CR matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 3, identity: 0.912

attgtgggtcgccagctgcagacgttcacgacgt	CRISPR spacer
atagtgggtcgccagctgcagacgttcacgactg	Protospacer
** *****************************  

30. spacer 1.39|37192|34|NZ_NFFQ01000045|PILER-CR matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 3, identity: 0.912

gatcaggctagccatgacgggctccattacgcgt	CRISPR spacer
gatcaggctagccattaccggctccattacgcgg	Protospacer
*************** ** ************** 

31. spacer 1.39|37192|34|NZ_NFFQ01000045|PILER-CR matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 3, identity: 0.912

gatcaggctagccatgacgggctccattacgcgt	CRISPR spacer
gatcaggctagccattaccggctccattacgcgg	Protospacer
*************** ** ************** 

32. spacer 1.42|37372|34|NZ_NFFQ01000045|PILER-CR matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 4, identity: 0.882

aggagtacatgccgagggcgtctgtgaccatagt	CRISPR spacer
atgagtacatgccgagggcgtcggtgaccatatc	Protospacer
* ******************** ********* .

33. spacer 1.42|37372|34|NZ_NFFQ01000045|PILER-CR matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 4, identity: 0.882

aggagtacatgccgagggcgtctgtgaccatagt	CRISPR spacer
atgagtacatgccgagggcgtcggtgaccatatc	Protospacer
* ******************** ********* .

34. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 6, identity: 0.806

----acggattccgatgcggcgacttccagcccga	CRISPR spacer
tgccgcg----ccgatgcggcgacttccagtccga	Protospacer
    .**    *******************.****

35. spacer 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_012209 (Yersinia enterocolitica plasmid pYe4449-2, complete sequence) position: , mismatch: 6, identity: 0.806

tcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
tcgcggatgccacggcgcgggtcatctgggg	Protospacer
**************.***.****.*.*.* *

36. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to KC292028 (Halovirus HCTV-2, complete genome) position: , mismatch: 6, identity: 0.806

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
acagcaggccgagcgtgccgcccagcctgcc	Protospacer
 **. .*************** ********.

37. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 6, identity: 0.806

tcaaggggccgagcgtgccgcgcagc-ctgct	CRISPR spacer
tgtaggggcccagcgtggcgcgcagcgccgc-	Protospacer
*  ******* ****** ******** *.** 

38. spacer 1.20|36892|32|NZ_NFFQ01000045|CRT matches to NC_012209 (Yersinia enterocolitica plasmid pYe4449-2, complete sequence) position: , mismatch: 6, identity: 0.812

atcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
atcgcggatgccacggcgcgggtcatctgggg	Protospacer
***************.***.****.*.*.* *

39. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 7, identity: 0.774

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
gctcgatgtagtccatcagccgcttcatccc	Protospacer
*  .* .*.**************** *****

40. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 7, identity: 0.774

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcgt	Protospacer
   * ***** ****.************** 

41. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049853 (Escherichia phage Henu8, complete genome) position: , mismatch: 7, identity: 0.774

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcgt	Protospacer
   * ***** ****.************** 

42. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 7, identity: 0.781

----aacggattccgatgcggcgacttccagcccga	CRISPR spacer
ctgccgcg----ccgatgcggcgacttccagtccga	Protospacer
     .**    *******************.****

43. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to KC292028 (Halovirus HCTV-2, complete genome) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
gacagcaggccgagcgtgccgcccagcctgcc	Protospacer
. **. .*************** ********.

44. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

45. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagc-ctgct	CRISPR spacer
gtgtaggggcccagcgtggcgcgcagcgccgc-	Protospacer
.*  ******* ****** ******** *.** 

46. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

47. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

48. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

49. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

50. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

51. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
atcgagcggccgagcgtgccgcgattcaggct	Protospacer
***.** ****************   *  ***

52. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.742

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ctgcgcgccgatgcggcaacctccagcccga	Protospacer
 .* .. **********.**.**********

53. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to AF165214 (Bacteriophage D3, complete genome) position: , mismatch: 8, identity: 0.742

acggattccgatgcggcgacttccagcccga	CRISPR spacer
tcatgcccctacgcggcgacttccagcccga	Protospacer
 *. ...** *.*******************

54. spacer 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 8, identity: 0.742

tcgcggatgccacgacgcaggtcgtttagcg--	CRISPR spacer
ctgcggacgccacgacgcagggcg--tggctgc	Protospacer
..*****.************* **  *.**   

55. spacer 1.7|36953|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 8, identity: 0.742

ggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
ggatgtcgcagtcgatcagcggcgcggcgtc	Protospacer
************* ****** ** .*.. .*

56. spacer 1.11|37193|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 8, identity: 0.742

atcaggctagccatgacgggctccattacgc	CRISPR spacer
ttcaggccagccatgacggcctcctcgtcgg	Protospacer
 ******.*********** **** .  ** 

57. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850572 (Escherichia phage aaroes, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

58. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065657 (UNVERIFIED: Campylobacter phage C4, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

59. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065675 (UNVERIFIED: Campylobacter phage A118, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

60. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065687 (UNVERIFIED: Campylobacter phage A136, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

61. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065649 (UNVERIFIED: Campylobacter phage A143, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

62. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850604 (Escherichia phage tunzivis, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

63. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065667 (UNVERIFIED: Campylobacter phage A127, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

64. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

65. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065671 (UNVERIFIED: Campylobacter phage A120, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

66. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

67. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850591 (Escherichia phage aalborv, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

68. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065679 (UNVERIFIED: Campylobacter phage A13a, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

69. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065665 (UNVERIFIED: Campylobacter phage A131, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

70. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065685 (UNVERIFIED: Campylobacter phage A112a, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

71. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MK373798 (Escherichia phage vB_EcoS_G29-2, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

72. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065663 (UNVERIFIED: Campylobacter phage A134, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

73. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065670 (UNVERIFIED: Campylobacter phage A121, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

74. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065681 (UNVERIFIED: Campylobacter phage A139, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

75. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065638 (UNVERIFIED: Campylobacter phage A15a, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

76. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049817 (Escherichia phage tonnikala, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

77. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to LT841304 (Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

78. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049830 (Escherichia phage PGN590, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

79. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850607 (Escherichia phage egaa, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

80. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065640 (UNVERIFIED: Campylobacter phage A14b, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

81. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850600 (Escherichia phage haarsle, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

82. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to LR596614 (Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

83. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

84. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850586 (Escherichia phage orkinos, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

85. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

86. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

87. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MK962751 (Shigella phage JK16, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

88. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065673 (UNVERIFIED: Campylobacter phage A119, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

89. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049819 (Escherichia phage atuna, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

90. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850634 (Escherichia phage tinuso, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

91. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065641 (UNVERIFIED: Campylobacter phage A14a, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

92. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065680 (UNVERIFIED: Campylobacter phage A113, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

93. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_047938 (Escherichia phage SECphi27 genome assembly, complete genome: monopartite) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

94. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065669 (UNVERIFIED: Campylobacter phage A123, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

95. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850638 (Escherichia phage tunus, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

96. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049825 (Escherichia phage grams, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

97. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065643 (UNVERIFIED: Campylobacter phage E6, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

98. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049815 (Escherichia phage tonn, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

99. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_049827 (Escherichia phage damhaus, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

100. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

101. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MT360681 (Shigella virus 2019SD1, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

102. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MG065636 (UNVERIFIED: Campylobacter phage A16a, complete genome) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttacccatttcagcatcatcaccagcat	Protospacer
   * ***** ****.*************. 

103. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

104. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

105. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

106. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

107. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

108. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

109. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

110. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

111. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

112. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

113. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

114. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

115. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

116. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

117. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

118. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

119. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

120. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

121. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

122. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

123. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

124. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

125. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

126. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

127. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

128. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

129. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
ccttcgaccagttctacatcatgaccagcgg	Protospacer
.* * . ******* ******* *******.

130. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ggtggatgccgaacgtgcggcgcagcctgct	Protospacer
   .*. *****.***** ************

131. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgctgtcgccgagcttgccgcgcaggctgct	Protospacer
.   *  ******* ********** *****

132. spacer 1.21|36952|32|NZ_NFFQ01000045|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 8, identity: 0.75

aggatgtcgcagtccatcagccgcttgatccc	CRISPR spacer
aggatgtcgcagtcgatcagcggcgcggcgtc	Protospacer
************** ****** ** .*.. .*

133. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 8, identity: 0.75

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcgt	Protospacer
    * ***** ****.************** 

134. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049853 (Escherichia phage Henu8, complete genome) position: , mismatch: 8, identity: 0.75

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcgt	Protospacer
    * ***** ****.************** 

135. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
aggtggatgccgaacgtgcggcgcagcctgct	Protospacer
*   .*. *****.***** ************

136. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

-----atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ccgctgtc-----gccgagcttgccgcgcaggctgct	Protospacer
     .**     ******* ********** *****

137. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.75

-----atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
tcgatatc-----gccgagcgtgccgcgcaggatgcg	Protospacer
     ***     ******************  *** 

138. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to KC292028 (Halovirus HCTV-2, complete genome) position: , mismatch: 8, identity: 0.765

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
gacagcaggccgagcgtgccgcccagcctgccgg	Protospacer
. **. .*************** ********.* 

139. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

140. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

141. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
gcatgggtcgatgcggcgacctccagcctga	Protospacer
.*. .  .************.*******.**

142. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

143. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

144. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

145. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

146. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

147. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

148. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

149. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggtgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

150. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
ggcgtccccgatgcggcgatttccagtccgt	Protospacer
.  * ..************.******.*** 

151. spacer 1.2|36653|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.71

acggattccgatgcggcgacttccagcccga	CRISPR spacer
gcctgggtcgatgcggcgacctccagcctga	Protospacer
.*  .  .************.*******.**

152. spacer 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.71

tcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
ccgcggatcccgcgacgcaggtcgggcccct	Protospacer
.******* **.************  .  * 

153. spacer 1.6|36893|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NC_022042 (Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence) position: , mismatch: 9, identity: 0.71

tcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
gcgcggatgccacggcgccggtcgggcaagt	Protospacer
 *************.*** *****  .*.  

154. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 9, identity: 0.71

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gtagttaccagttcatcatcatcaccaacgg	Protospacer
 .*    ******** ***********.**.

155. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 9, identity: 0.71

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttgcccatttcagcatcatcaccagcat	Protospacer
   * .**** ****.*************. 

156. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MF564201 (Escherichia phage vB_EcoS-95, complete genome) position: , mismatch: 9, identity: 0.71

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
aatttgcccatttcagcatcatcaccagcat	Protospacer
   * .**** ****.*************. 

157. spacer 1.12|37253|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN850569 (Escherichia phage vojen, complete genome) position: , mismatch: 9, identity: 0.71

tcatgacccagttcaacatcatcaccagcga	CRISPR spacer
agtttgcccatttcagcatcatcaccagcat	Protospacer
   * .**** ****.*************. 

158. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP020970 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ggaagcggccgaacgtgccgcgcagcgcaag	Protospacer
  *** ******.************* ..  

159. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgatcttgccgagcgtgccgcgccgccggcc	Protospacer
. *    **************** *** **.

160. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgctcgccccgagcttgccgcgcaggctgct	Protospacer
.    *  ****** ********** *****

161. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgctcgccccgagcttgccgcgcaggctgct	Protospacer
.    *  ****** ********** *****

162. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgagcttgcccagcgtgccgcgcaggctgcc	Protospacer
. *.   *** ************** ****.

163. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 9, identity: 0.71

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgatatcgccgagcgtgccgcgcaggatgcg	Protospacer
. * .  ******************  *** 

164. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
gctgcgcgccgatgcggcaacctccagcccga	Protospacer
. .* .. **********.**.**********

165. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to AF165214 (Bacteriophage D3, complete genome) position: , mismatch: 9, identity: 0.719

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
ctcatgcccctacgcggcgacttccagcccga	Protospacer
  *. ...** *.*******************

166. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
agcctgggtcgatgcggcgacctccagcctga	Protospacer
*.*  .  .************.*******.**

167. spacer 1.20|36892|32|NZ_NFFQ01000045|CRT matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 9, identity: 0.719

atcgcggatgccacgacgcaggtcgtttagcg--	CRISPR spacer
gctgcggacgccacgacgcagggcg--tggctgc	Protospacer
...*****.************* **  *.**   

168. spacer 1.25|37192|32|NZ_NFFQ01000045|CRT matches to MT024869 (Arthrobacter phage Lego, complete genome) position: , mismatch: 9, identity: 0.719

gatcaggctagccatgacgggctccattacgc	CRISPR spacer
cttcaggccagccatgacggcctcctcgtcgg	Protospacer
  ******.*********** **** .  ** 

169. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850572 (Escherichia phage aaroes, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

170. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065657 (UNVERIFIED: Campylobacter phage C4, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

171. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065675 (UNVERIFIED: Campylobacter phage A118, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

172. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065687 (UNVERIFIED: Campylobacter phage A136, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

173. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065649 (UNVERIFIED: Campylobacter phage A143, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

174. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850604 (Escherichia phage tunzivis, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

175. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065667 (UNVERIFIED: Campylobacter phage A127, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

176. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

177. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065671 (UNVERIFIED: Campylobacter phage A120, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

178. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

179. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850591 (Escherichia phage aalborv, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

180. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065679 (UNVERIFIED: Campylobacter phage A13a, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

181. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065665 (UNVERIFIED: Campylobacter phage A131, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

182. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065685 (UNVERIFIED: Campylobacter phage A112a, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

183. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MK373798 (Escherichia phage vB_EcoS_G29-2, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

184. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065663 (UNVERIFIED: Campylobacter phage A134, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

185. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065670 (UNVERIFIED: Campylobacter phage A121, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

186. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065681 (UNVERIFIED: Campylobacter phage A139, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

187. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065638 (UNVERIFIED: Campylobacter phage A15a, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

188. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049817 (Escherichia phage tonnikala, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

189. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to LT841304 (Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

190. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049830 (Escherichia phage PGN590, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

191. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850607 (Escherichia phage egaa, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

192. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065640 (UNVERIFIED: Campylobacter phage A14b, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

193. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850600 (Escherichia phage haarsle, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

194. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to LR596614 (Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

195. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

196. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850586 (Escherichia phage orkinos, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

197. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

198. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

199. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MK962751 (Shigella phage JK16, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

200. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065673 (UNVERIFIED: Campylobacter phage A119, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

201. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049819 (Escherichia phage atuna, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

202. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850634 (Escherichia phage tinuso, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

203. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065641 (UNVERIFIED: Campylobacter phage A14a, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

204. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065680 (UNVERIFIED: Campylobacter phage A113, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

205. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_047938 (Escherichia phage SECphi27 genome assembly, complete genome: monopartite) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

206. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065669 (UNVERIFIED: Campylobacter phage A123, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

207. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850638 (Escherichia phage tunus, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

208. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049825 (Escherichia phage grams, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

209. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065643 (UNVERIFIED: Campylobacter phage E6, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

210. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049815 (Escherichia phage tonn, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

211. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_049827 (Escherichia phage damhaus, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

212. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

213. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MT360681 (Shigella virus 2019SD1, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

214. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MG065636 (UNVERIFIED: Campylobacter phage A16a, complete genome) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttacccatttcagcatcatcaccagcat	Protospacer
    * ***** ****.*************. 

215. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

216. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

217. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

218. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

219. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

220. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

221. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

222. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

223. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

224. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

225. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

226. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

227. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

228. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

229. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

230. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

231. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

232. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

233. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

234. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

235. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

236. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

237. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

238. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

239. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

240. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 9, identity: 0.719

----atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tgtagtta----ccagttcatcatcatcaccaacgg	Protospacer
    .*.*    ******** ***********.**.

241. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

242. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
gccttcgaccagttctacatcatgaccagcgg	Protospacer
..* * . ******* ******* *******.

243. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP020970 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
aggaagcggccgaacgtgccgcgcagcgcaag	Protospacer
*  *** ******.************* ..  

244. spacer 1.30|36652|34|NZ_NFFQ01000045|PILER-CR matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.735

----aacggattccgatgcggcgacttccagcccgagg	CRISPR spacer
ctgccgcg----ccgatgcggcgacttccagtccgaca	Protospacer
     .**    *******************.**** .

245. spacer 1.35|36952|34|NZ_NFFQ01000045|PILER-CR matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.735

aggatgtcgcagtccatcagccgcttgatcccgt	CRISPR spacer
aggatgtcgcagtcgatcagcggcgcggcgtcct	Protospacer
************** ****** ** .*.. .* *

246. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
aggtggatgccgaacgtgcggcgcagcctgctgg	Protospacer
*   .*. *****.***** ************* 

247. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

-----atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
ccgctgtc-----gccgagcttgccgcgcaggctgctga	Protospacer
     .**     ******* ********** ****** 

248. spacer 1.13|37313|31|NZ_NFFQ01000045|CRISPRCasFinder matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 10, identity: 0.677

tcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
cgccggggtcgagcgcgccgcgcagccacgg	Protospacer
.   ****.******.***********    

249. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

250. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

251. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cgcatgggtcgatgcggcgacctccagcctga	Protospacer
 .*. .  .************.*******.**

252. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

253. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

254. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

255. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

256. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

257. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

258. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

259. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggtgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

260. spacer 1.16|36652|32|NZ_NFFQ01000045|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aacggattccgatgcggcgacttccagcccga	CRISPR spacer
cggcgtccccgatgcggcgatttccagtccgt	Protospacer
 .  * ..************.******.*** 

261. spacer 1.20|36892|32|NZ_NFFQ01000045|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 10, identity: 0.688

atcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
gccgcggatcccgcgacgcaggtcgggcccct	Protospacer
..******* **.************  .  * 

262. spacer 1.20|36892|32|NZ_NFFQ01000045|CRT matches to NC_022042 (Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence) position: , mismatch: 10, identity: 0.688

atcgcggatgccacgacgcaggtcgtttagcg	CRISPR spacer
cgcgcggatgccacggcgccggtcgggcaagt	Protospacer
  *************.*** *****  .*.  

263. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 10, identity: 0.688

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttgcccatttcagcatcatcaccagcat	Protospacer
    * .**** ****.*************. 

264. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MF564201 (Escherichia phage vB_EcoS-95, complete genome) position: , mismatch: 10, identity: 0.688

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
caatttgcccatttcagcatcatcaccagcat	Protospacer
    * .**** ****.*************. 

265. spacer 1.26|37252|32|NZ_NFFQ01000045|CRT matches to MN850569 (Escherichia phage vojen, complete genome) position: , mismatch: 10, identity: 0.688

atcatgacccagttcaacatcatcaccagcga	CRISPR spacer
tagtttgcccatttcagcatcatcaccagcat	Protospacer
    * .**** ****.*************. 

266. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ccgatcttgccgagcgtgccgcgccgccggcc	Protospacer
 . *    **************** *** **.

267. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ccgctcgccccgagcttgccgcgcaggctgct	Protospacer
 .    *  ****** ********** *****

268. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ccgctcgccccgagcttgccgcgcaggctgct	Protospacer
 .    *  ****** ********** *****

269. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
gcgagcttgcccagcgtgccgcgcaggctgcc	Protospacer
.. *.   *** ************** ****.

270. spacer 1.30|36652|34|NZ_NFFQ01000045|PILER-CR matches to AF165214 (Bacteriophage D3, complete genome) position: , mismatch: 10, identity: 0.706

aacggattccgatgcggcgacttccagcccgagg	CRISPR spacer
ctcatgcccctacgcggcgacttccagcccgagc	Protospacer
  *. ...** *.******************** 

271. spacer 1.30|36652|34|NZ_NFFQ01000045|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706

aacggattccgatgcggcgacttccagcccgagg	CRISPR spacer
gctgcgcgccgatgcggcaacctccagcccgatg	Protospacer
. .* .. **********.**.********** *

272. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to KC710998 (Shigella phage pSf-1, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcgtag	Protospacer
    * ***** ****.************** . 

273. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049853 (Escherichia phage Henu8, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcgtag	Protospacer
    * ***** ****.************** . 

274. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065657 (UNVERIFIED: Campylobacter phage C4, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

275. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065675 (UNVERIFIED: Campylobacter phage A118, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

276. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065687 (UNVERIFIED: Campylobacter phage A136, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

277. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065649 (UNVERIFIED: Campylobacter phage A143, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

278. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065667 (UNVERIFIED: Campylobacter phage A127, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

279. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065679 (UNVERIFIED: Campylobacter phage A13a, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

280. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065665 (UNVERIFIED: Campylobacter phage A131, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

281. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065685 (UNVERIFIED: Campylobacter phage A112a, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

282. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065663 (UNVERIFIED: Campylobacter phage A134, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

283. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065681 (UNVERIFIED: Campylobacter phage A139, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

284. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065638 (UNVERIFIED: Campylobacter phage A15a, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

285. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065640 (UNVERIFIED: Campylobacter phage A14b, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

286. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065673 (UNVERIFIED: Campylobacter phage A119, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

287. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065641 (UNVERIFIED: Campylobacter phage A14a, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

288. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065680 (UNVERIFIED: Campylobacter phage A113, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

289. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065669 (UNVERIFIED: Campylobacter phage A123, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

290. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065643 (UNVERIFIED: Campylobacter phage E6, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

291. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065636 (UNVERIFIED: Campylobacter phage A16a, complete genome) position: , mismatch: 10, identity: 0.706

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatat	Protospacer
    * ***** ****.*************. .*

292. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to NZ_CP020970 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
aggaagcggccgaacgtgccgcgcagcgcaagct	Protospacer
*  *** ******.************* ..   *

293. spacer 1.27|37312|32|NZ_NFFQ01000045|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 11, identity: 0.656

atcaaggggccgagcgtgccgcgcagcctgct	CRISPR spacer
ccgccggggtcgagcgcgccgcgcagccacgg	Protospacer
 .   ****.******.***********    

294. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850572 (Escherichia phage aaroes, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

295. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850604 (Escherichia phage tunzivis, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

296. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

297. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065671 (UNVERIFIED: Campylobacter phage A120, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

298. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

299. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850591 (Escherichia phage aalborv, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

300. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MK373798 (Escherichia phage vB_EcoS_G29-2, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

301. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MG065670 (UNVERIFIED: Campylobacter phage A121, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

302. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049817 (Escherichia phage tonnikala, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

303. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to LT841304 (Escherichia phage vB_Eco_swan01 genome assembly, chromosome: I) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

304. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049830 (Escherichia phage PGN590, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

305. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850607 (Escherichia phage egaa, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

306. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850600 (Escherichia phage haarsle, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

307. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to LR596614 (Escherichia phage vB_Eco_SLUR29 genome assembly, chromosome: 1) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

308. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

309. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850586 (Escherichia phage orkinos, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

310. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN781674 (Escherichia phage vB_EcoS_XY3, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

311. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

312. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MK962751 (Shigella phage JK16, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

313. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049819 (Escherichia phage atuna, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

314. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850634 (Escherichia phage tinuso, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

315. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_047938 (Escherichia phage SECphi27 genome assembly, complete genome: monopartite) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

316. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850638 (Escherichia phage tunus, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

317. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049825 (Escherichia phage grams, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

318. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049815 (Escherichia phage tonn, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

319. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to NC_049827 (Escherichia phage damhaus, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

320. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
caatttacccatttcagcatcatcaccagcataa	Protospacer
    * ***** ****.*************. . 

321. spacer 1.40|37252|34|NZ_NFFQ01000045|PILER-CR matches to MT360681 (Shigella virus 2019SD1, complete genome) position: , mismatch: 11, identity: 0.676

atcatgacccagttcaacatcatcaccagcgagt	CRISPR spacer
tagtttacccatttcagcatcatcaccagcatag	Protospacer
    * ***** ****.*************. . 

322. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 11, identity: 0.676

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
ccgctcgccccgagcttgccgcgcaggctgctga	Protospacer
 .    *  ****** ********** ****** 

323. spacer 1.41|37312|34|NZ_NFFQ01000045|PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 11, identity: 0.676

atcaaggggccgagcgtgccgcgcagcctgctgt	CRISPR spacer
ccgctcgccccgagcttgccgcgcaggctgctga	Protospacer
 .    *  ****** ********** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_NFFQ01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 364 : 36932 43 uncultured_Caudovirales_phage(25.0%) holin,tail,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_NFFQ01000063
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54 : 9662 14 Pseudomonas_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_NFFQ01000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000028_1 12206-12319 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_NFFQ01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113051 : 123100 11 Pseudomonas_phage(50.0%) integrase,tRNA attL 112637:112649|attR 121681:121693
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_NFFQ01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27300 : 71899 42 Pseudomonas_phage(40.91%) transposase,coat,integrase attL 20073:20088|attR 66623:66638
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_NFFQ01000073
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 690 : 5327 8 Pseudomonas_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_NFFQ01000040
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000040_1 492-598 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFQ01000040_2 14840-14993 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_NFFQ01000040.1 14788-14839 0 1.0

1. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to position: 14788-14839, mismatch: 0, identity: 1.0

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	Protospacer
****************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NFFQ01000040_1 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder 521-569 49 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 70-118 0 1.0
NZ_NFFQ01000040_1 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder 521-569 49 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 16822-16870 0 1.0
NZ_NFFQ01000040_1 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder 521-569 49 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47222-47270 0 1.0
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 14228-14279 3 0.942
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 2667-2718 3 0.942
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 62315-62366 3 0.942
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11666-11717 3 0.942
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 14332-14383 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 60445-60496 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11354-11405 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11562-11613 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11875-11926 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 31415-31466 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 31519-31570 4 0.923
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 2460-2511 5 0.904
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 2564-2615 5 0.904
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 31623-31674 5 0.904
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11250-11301 6 0.885
NZ_NFFQ01000040_2 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder 14891-14942 52 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 3258-3309 8 0.846

1. spacer 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

2. spacer 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

3. spacer 1.1|521|49|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

4. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 3, identity: 0.942

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc	Protospacer
. ************************************************* 

5. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 3, identity: 0.942

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc	Protospacer
. ************************************************* 

6. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 3, identity: 0.942

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggc	Protospacer
. ************************************************* 

7. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 3, identity: 0.942

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gcgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggc	Protospacer
*************************** *******************.*** 

8. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc	Protospacer
. *********************************************.*** 

9. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtaccggacggatccaccgcaccaggtgctcggcgccgccggcgccgatggc	Protospacer
*..************************ *********************** 

10. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc	Protospacer
*.************************* * ********************* 

11. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggc	Protospacer
*.************************* *******************.*** 

12. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtgccggacggatccaccgcaccaggtgctcggcgccgccggcgccggtggt	Protospacer
*.************************* *******************.*** 

13. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc	Protospacer
*.************************* * ********************* 

14. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 4, identity: 0.923

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
gtgccggacggatccaccgcaccaggtgcgcggcgccgccggcgccgatggc	Protospacer
*.************************* * ********************* 

15. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 5, identity: 0.904

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccagacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc	Protospacer
. ***.*****************************************.*** 

16. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 5, identity: 0.904

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccagacggatccaccgcaccaggtcctcggcgccgccggcgccggtggc	Protospacer
. ***.*****************************************.*** 

17. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 5, identity: 0.904

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccacggcaccaggtgctcggcgccgccggcgccgatggc	Protospacer
. *************** ********* *********************** 

18. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 6, identity: 0.885

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
aggccggacggatccacggcaccaggtgctcggcgccgccggcgccgatgac	Protospacer
. *************** ********* **********************. 

19. spacer 2.1|14891|52|NZ_NFFQ01000040|CRISPRCasFinder matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 8, identity: 0.846

gcgccggacggatccaccgcaccaggtcctcggcgccgccggcgccgatggg	CRISPR spacer
tcgagtaatggatccaccgcaccaggtcctcggcgccgccggcgccggtggc	Protospacer
 **   .*.**************************************.*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_NFFQ01000040.1|WP_153575361.1|40354_40528_-|hypothetical-protein 40354_40528_- 57 aa aa AcrIC4 NA NA No NA
NZ_NFFQ01000040.1|WP_058130594.1|40530_40833_-|hypothetical-protein 40530_40833_- 100 aa aa AcrIC3 NA NA No NA
NZ_NFFQ01000040.1|WP_058130595.1|40829_41252_-|anti-CRISPR-protein-AcrF3 40829_41252_- 140 aa aa AcrIF3 NA NA No NA
NZ_NFFQ01000040.1|WP_023131919.1|41274_41577_-|anti-CRISPR-protein-AcrE1 41274_41577_- 100 aa aa AcrIE1 NA NA No NA
22. NZ_NFFQ01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 287 : 41876 54 Pseudomonas_phage(60.0%) holin,head,tail,portal,terminase,capsid,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage