Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MCHS01000033 Listeria monocytogenes strain P04-001 343, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000038 Listeria monocytogenes strain P04-001 348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000039 Listeria monocytogenes strain P04-001 349, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_MCHS01000021 Listeria monocytogenes strain P04-001 330, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000017 Listeria monocytogenes strain P04-001 326, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000034 Listeria monocytogenes strain P04-001 344, whole genome shotgun sequence 0 crisprs DinG 0 0 1 1
NZ_MCHS01000031 Listeria monocytogenes strain P04-001 340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000005 Listeria monocytogenes strain P04-001 312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000008 Listeria monocytogenes strain P04-001 316, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MCHS01000016 Listeria monocytogenes strain P04-001 325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000029 Listeria monocytogenes strain P04-001 338, whole genome shotgun sequence 2 crisprs cas6,cas8b2,cas7,cas5,cas3,cas2 6 21 1 0
NZ_MCHS01000035 Listeria monocytogenes strain P04-001 345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000015 Listeria monocytogenes strain P04-001 324, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_MCHS01000023 Listeria monocytogenes strain P04-001 332, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000004 Listeria monocytogenes strain P04-001 311, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000001 Listeria monocytogenes strain P04-001 127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000037 Listeria monocytogenes strain P04-001 347, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 4 14 0 0
NZ_MCHS01000025 Listeria monocytogenes strain P04-001 334, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000013 Listeria monocytogenes strain P04-001 322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000010 Listeria monocytogenes strain P04-001 318, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000009 Listeria monocytogenes strain P04-001 plasmid unnamed 317, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000024 Listeria monocytogenes strain P04-001 333, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000028 Listeria monocytogenes strain P04-001 337, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_MCHS01000011 Listeria monocytogenes strain P04-001 319, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_MCHS01000003 Listeria monocytogenes strain P04-001 299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000007 Listeria monocytogenes strain P04-001 315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000027 Listeria monocytogenes strain P04-001 336, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000026 Listeria monocytogenes strain P04-001 335, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000019 Listeria monocytogenes strain P04-001 328, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000036 Listeria monocytogenes strain P04-001 346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000022 Listeria monocytogenes strain P04-001 331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000030 Listeria monocytogenes strain P04-001 339, whole genome shotgun sequence 1 crisprs WYL,casR 0 0 0 0
NZ_MCHS01000002 Listeria monocytogenes strain P04-001 23, whole genome shotgun sequence 0 crisprs csa3,DinG 0 0 1 0
NZ_MCHS01000020 Listeria monocytogenes strain P04-001 329, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000006 Listeria monocytogenes strain P04-001 314, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000014 Listeria monocytogenes strain P04-001 323, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MCHS01000012 Listeria monocytogenes strain P04-001 321, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 1 0
NZ_MCHS01000018 Listeria monocytogenes strain P04-001 327, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MCHS01000032 Listeria monocytogenes strain P04-001 342, whole genome shotgun sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_MCHS01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3546 8 Listeria_phage(87.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_MCHS01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 89897 : 98183 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MCHS01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 443 : 3741 8 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MCHS01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 490005 : 516667 34 Listeria_phage(91.18%) holin,terminase,tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MCHS01000034.1|WP_061107115.1|490752_491016_+|AcrIIA4-family-anti-CRISPR-protein 490752_491016_+ 87 aa aa AcrIIA4 NA NA 490005-516667 yes
5. NZ_MCHS01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MCHS01000039
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 97557 : 100488 7 Listeria_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MCHS01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1100 : 11978 8 Listeria_phage(100.0%) tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MCHS01000028.1|WP_009931626.1|9972_10134_-|hypothetical-protein 9972_10134_- 53 aa aa NA NA NA 1100-11978 yes
8. NZ_MCHS01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MCHS01000015.1|WP_003731276.1|557_809_+|hypothetical-protein 557_809_+ 83 aa aa AcrIIA12 NA NA No NA
9. NZ_MCHS01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11379 19 Listeria_phage(100.0%) head,capsid,portal,terminase,tail,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_MCHS01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 154 : 23866 30 Listeria_phage(100.0%) portal,capsid,plate,tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_MCHS01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11379 19 Listeria_phage(100.0%) tail,protease,portal,terminase,head,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_MCHS01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14694 18 Listeria_phage(100.0%) capsid,terminase,protease,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_MCHS01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 205 : 6915 14 Listeria_phage(100.0%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_MCHS01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43597 : 52587 10 Cronobacter_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_MCHS01000029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MCHS01000029_1 31815-32165 Unclear I-A
5 spacers
cas6,cas8b2,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MCHS01000029_2 47358-49654 Unclear I-A
35 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MCHS01000029_1 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT 31973-32006 34 NZ_MCHS01000034.1 494235-494268 2 0.941
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 NZ_MCHS01000031.1 2172-2206 1 0.971
NZ_MCHS01000029_1 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder 31972-32006 35 NZ_MCHS01000034.1 494234-494268 2 0.943
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 NZ_MCHS01000031.1 2172-2207 1 0.972
NZ_MCHS01000029_2 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48102-48137 36 NZ_MCHS01000004.1 23055-23090 0 1.0
NZ_MCHS01000029_2 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48359-48392 34 NZ_MCHS01000004.1 23664-23697 0 1.0

1. spacer 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT matches to position: 494235-494268, mismatch: 2, identity: 0.941

tcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
tcgccattacgaaatctagtgcttgtcctactaa	Protospacer
******* ***********.**************

2. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to position: 2172-2206, mismatch: 1, identity: 0.971

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgatttcagggatggggaaaact	Protospacer
*******************.***************

3. spacer 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder matches to position: 494234-494268, mismatch: 2, identity: 0.943

ttcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
ttcgccattacgaaatctagtgcttgtcctactaa	Protospacer
******** ***********.**************

4. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to position: 2172-2207, mismatch: 1, identity: 0.972

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgatttcagggatggggaaaact	Protospacer
********************.***************

5. spacer 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to position: 23055-23090, mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

6. spacer 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to position: 23664-23697, mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MCHS01000029_1 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT 31973-32006 34 MT500540 Listeria phage LP-HM00113468, complete genome 26210-26243 0 1.0
NZ_MCHS01000029_1 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder 31972-32006 35 MT500540 Listeria phage LP-HM00113468, complete genome 26209-26243 0 1.0
NZ_MCHS01000029_2 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48102-48137 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_MCHS01000029_2 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48102-48137 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_MCHS01000029_2 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48359-48392 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_MCHS01000029_2 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48359-48392 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 KP399678 Listeria phage vB_LmoS_293, complete genome 6980-7015 0 1.0
NZ_MCHS01000029_1 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT 31909-31942 34 DQ003642 Listeria phage A006, complete genome 5993-6026 1 0.971
NZ_MCHS01000029_1 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT 31973-32006 34 NC_003216 Listeria phage A118, complete genome 20259-20292 1 0.971
NZ_MCHS01000029_1 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT 31973-32006 34 AJ242593 Bacteriophage A118 complete genome 20259-20292 1 0.971
NZ_MCHS01000029_1 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT 31973-32006 34 X85008 Bacteriophage A118 hol118 and ply118 genes 507-540 1 0.971
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 DQ003642 Listeria phage A006, complete genome 19079-19113 1 0.971
NZ_MCHS01000029_1 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder 31908-31942 35 DQ003642 Listeria phage A006, complete genome 5993-6027 1 0.971
NZ_MCHS01000029_1 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder 31972-32006 35 NC_003216 Listeria phage A118, complete genome 20259-20293 1 0.971
NZ_MCHS01000029_1 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder 31972-32006 35 AJ242593 Bacteriophage A118 complete genome 20259-20293 1 0.971
NZ_MCHS01000029_1 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder 31972-32006 35 X85008 Bacteriophage A118 hol118 and ply118 genes 507-541 1 0.971
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 DQ003642 Listeria phage A006, complete genome 19078-19113 1 0.972
NZ_MCHS01000029_2 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 47712-47747 36 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 60125-60160 1 0.972
NZ_MCHS01000029_2 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 47712-47747 36 NC_009812 Listeria phage B025, complete genome 27503-27538 1 0.972
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 NC_003216 Listeria phage A118, complete genome 6982-7017 1 0.972
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 AJ242593 Bacteriophage A118 complete genome 6982-7017 1 0.972
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 MH341452 Listeria phage PSU-VKH-LP040, complete genome 6993-7028 1 0.972
NZ_MCHS01000029_2 2.31|49331|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49331-49366 36 NC_021539 Listeria phage LP-030-2, complete genome 14044-14079 1 0.972
NZ_MCHS01000029_2 2.31|49331|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49331-49366 36 AJ312240 Bacteriophage PSA complete genome 14022-14057 1 0.972
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KY705255 Streptococcus phage P0095, complete genome 33666-33702 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KY705251 Streptococcus phage P0091, complete genome 32778-32814 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KX879643 Streptococcus phage CHPC1151, complete genome 31697-31733 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 MK202161 Streptococcus phage CHPC1282, complete genome 32484-32520 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KY705252 Streptococcus phage P0092, complete genome 31845-31881 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 MH937506 Streptococcus phage CHPC1148, complete genome 35552-35588 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KY705253 Streptococcus phage P0093, complete genome 32631-32667 1 0.973
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 KY705254 Streptococcus phage P0094, complete genome 31034-31070 1 0.973
NZ_MCHS01000029_1 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT 31909-31942 34 MH341451 Listeria phage PSU-VKH-LP019, complete genome 5984-6017 2 0.941
NZ_MCHS01000029_1 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT 31909-31942 34 KP399677 Listeria phage vB_LmoS_188, complete genome 5993-6026 2 0.941
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 NC_003216 Listeria phage A118, complete genome 20794-20828 2 0.943
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 AJ242593 Bacteriophage A118 complete genome 20794-20828 2 0.943
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 X85008 Bacteriophage A118 hol118 and ply118 genes 1042-1076 2 0.943
NZ_MCHS01000029_1 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT 32037-32071 35 KJ094023 Listeria phage LP-101, complete genome 19818-19852 2 0.943
NZ_MCHS01000029_1 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder 31908-31942 35 MH341451 Listeria phage PSU-VKH-LP019, complete genome 5984-6018 2 0.943
NZ_MCHS01000029_1 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder 31908-31942 35 KP399677 Listeria phage vB_LmoS_188, complete genome 5993-6027 2 0.943
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 NC_003216 Listeria phage A118, complete genome 20793-20828 2 0.944
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 AJ242593 Bacteriophage A118 complete genome 20793-20828 2 0.944
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 X85008 Bacteriophage A118 hol118 and ply118 genes 1041-1076 2 0.944
NZ_MCHS01000029_1 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder 32036-32071 36 KJ094023 Listeria phage LP-101, complete genome 19817-19852 2 0.944
NZ_MCHS01000029_2 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 47712-47747 36 KJ094023 Listeria phage LP-101, complete genome 27001-27036 2 0.944
NZ_MCHS01000029_2 2.11|48037|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48037-48072 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 26132-26167 2 0.944
NZ_MCHS01000029_2 2.17|48422|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48422-48457 36 KJ094022 Listeria phage LP-030-3, complete genome 38302-38337 2 0.944
NZ_MCHS01000029_2 2.19|48552|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48552-48587 36 KP399678 Listeria phage vB_LmoS_293, complete genome 1049-1084 2 0.944
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 DQ003637 Listeria phage A500, complete genome 6959-6994 2 0.944
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 MN689509 Lactococcus phage CHPC1175, complete genome 29544-29580 2 0.946
NZ_MCHS01000029_2 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49396-49432 37 MK448735 Streptococcus phage Javan349, complete genome 11483-11519 2 0.946
NZ_MCHS01000029_2 2.1|47387|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 47387-47422 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 228347-228382 3 0.917
NZ_MCHS01000029_2 2.18|48487|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48487-48522 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_MCHS01000029_2 2.18|48487|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48487-48522 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_MCHS01000029_2 2.15|48296|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48296-48329 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_MCHS01000029_2 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49203-49238 36 KJ094022 Listeria phage LP-030-3, complete genome 15373-15408 6 0.833
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_MCHS01000029_1 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder 31908-31942 35 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 1102881-1102915 9 0.743
NZ_MCHS01000029_2 2.15|48296|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48296-48329 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_MCHS01000029_2 2.20|48617|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 48617-48651 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 491525-491559 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_MCHS01000029_2 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49462-49496 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743
NZ_MCHS01000029_1 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT 31909-31942 34 MK044828 Streptococcus phage 33888, complete genome 5436-5469 10 0.706
NZ_MCHS01000029_2 2.30|49268|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT 49268-49301 34 NZ_CP034816 Paracoccus sp. Arc7-R13 plasmid unnamed6, complete sequence 26153-26186 11 0.676

1. spacer 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

tcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
tcgccatgacgaaatctagcgcttgtcctactaa	Protospacer
**********************************

2. spacer 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

ttcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
ttcgccatgacgaaatctagcgcttgtcctactaa	Protospacer
***********************************

3. spacer 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

4. spacer 2.12|48102|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

5. spacer 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

6. spacer 2.16|48359|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

7. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
cacgtactttaatcggcatcaaaccacctcgatttc	Protospacer
************************************

8. spacer 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.971

ctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
ctgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
***************************.******

9. spacer 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.971

tcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
tcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
*******************************.**

10. spacer 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.971

tcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
tcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
*******************************.**

11. spacer 1.3|31973|34|NZ_MCHS01000029|PILER-CR,CRT matches to X85008 (Bacteriophage A118 hol118 and ply118 genes) position: , mismatch: 1, identity: 0.971

tcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
tcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
*******************************.**

12. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.971

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgatttcggggatggggaaaacg	Protospacer
********************************** 

13. spacer 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.971

tctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
tctgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
****************************.******

14. spacer 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.971

ttcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
ttcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
********************************.**

15. spacer 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.971

ttcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
ttcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
********************************.**

16. spacer 1.8|31972|35|NZ_MCHS01000029|CRISPRCasFinder matches to X85008 (Bacteriophage A118 hol118 and ply118 genes) position: , mismatch: 1, identity: 0.971

ttcgccatgacgaaatctagcgcttgtcctactaa	CRISPR spacer
ttcgccatgacgaaatctagcgcttgtcctaccaa	Protospacer
********************************.**

17. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgatttcggggatggggaaaacg	Protospacer
*********************************** 

18. spacer 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

19. spacer 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

20. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.972

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
cacgtactttaatcggcatcaaatcacctcgatttc	Protospacer
***********************.************

21. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.972

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
cacgtactttaatcggcatcaaatcacctcgatttc	Protospacer
***********************.************

22. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 1, identity: 0.972

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
cacgtactttaatcggcattaaaccacctcgatttc	Protospacer
*******************.****************

23. spacer 2.31|49331|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

24. spacer 2.31|49331|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

25. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

26. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

27. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KX879643 (Streptococcus phage CHPC1151, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

28. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MK202161 (Streptococcus phage CHPC1282, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

29. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KY705252 (Streptococcus phage P0092, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

30. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MH937506 (Streptococcus phage CHPC1148, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

31. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KY705253 (Streptococcus phage P0093, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

32. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KY705254 (Streptococcus phage P0094, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

33. spacer 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 2, identity: 0.941

ctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
ccgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
*.*************************.******

34. spacer 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 2, identity: 0.941

ctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
ccgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
*.*************************.******

35. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 2, identity: 0.943

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgatttcagggatggggaaaacg	Protospacer
*******************.************** 

36. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 2, identity: 0.943

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgatttcagggatggggaaaacg	Protospacer
*******************.************** 

37. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to X85008 (Bacteriophage A118 hol118 and ply118 genes) position: , mismatch: 2, identity: 0.943

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgatttcagggatggggaaaacg	Protospacer
*******************.************** 

38. spacer 1.4|32037|35|NZ_MCHS01000029|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.943

gcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
gcacagtcttcacgattgcggggatggggaaaacg	Protospacer
***************** **************** 

39. spacer 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 2, identity: 0.943

tctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
tccgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
**.*************************.******

40. spacer 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 2, identity: 0.943

tctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
tccgtaaaatcaaaagtatcatagaaacgatcttc	Protospacer
**.*************************.******

41. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 2, identity: 0.944

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgatttcagggatggggaaaacg	Protospacer
********************.************** 

42. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 2, identity: 0.944

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgatttcagggatggggaaaacg	Protospacer
********************.************** 

43. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to X85008 (Bacteriophage A118 hol118 and ply118 genes) position: , mismatch: 2, identity: 0.944

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgatttcagggatggggaaaacg	Protospacer
********************.************** 

44. spacer 1.9|32036|36|NZ_MCHS01000029|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.944

ggcacagtcttcacgatttcggggatggggaaaact	CRISPR spacer
ggcacagtcttcacgattgcggggatggggaaaacg	Protospacer
****************** **************** 

45. spacer 2.6|47712|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.944

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgattttttgtagcccaattgctaaa	Protospacer
************.*****.*****************

46. spacer 2.11|48037|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 2, identity: 0.944

gtccacatcgacaataaaaaacacattgtatcactt	CRISPR spacer
gtccacattgacaacaaaaaacacattgtatcactt	Protospacer
********.*****.*********************

47. spacer 2.17|48422|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.944

ttgttcgacggcttagacaaccatcacgcttcttta	CRISPR spacer
cttttcgacggcttagacaaccatcacgcttcttta	Protospacer
.* *********************************

48. spacer 2.19|48552|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.944

ctcataaggatttcgaggcgggttaaacgacatgta	CRISPR spacer
ctcataaggattgcgaggcgggttaaatgacatgta	Protospacer
************ **************.********

49. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 2, identity: 0.944

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
cacgtactttaatcggcatcaaatcacctctatttc	Protospacer
***********************.****** *****

50. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MN689509 (Lactococcus phage CHPC1175, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaaccgagaacgtgtgttcattatcggacatctta	Protospacer
****** *******.**********************

51. spacer 2.32|49396|37|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MK448735 (Streptococcus phage Javan349, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgggtgttcattgtcggacatctta	Protospacer
************** *********.************

52. spacer 2.1|47387|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.917

aaagaccttcgatttcattctcactttccagttaat	CRISPR spacer
gaaaaccttcgatttcattcttactttccagttaat	Protospacer
.**.*****************.**************

53. spacer 2.18|48487|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

54. spacer 2.18|48487|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

55. spacer 2.15|48296|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

56. spacer 2.29|49203|36|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 6, identity: 0.833

cacgtactttaatcggcatcaaaccacctcgatttc	CRISPR spacer
tattaactttaatcggcatcaaaccacctctatctc	Protospacer
.*.  ************************* **.**

57. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

58. spacer 1.7|31908|35|NZ_MCHS01000029|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.743

tctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
tccgtaaaatcaaaagtatcatcgattttatgata	Protospacer
**.******************* **  . **  * 

59. spacer 2.15|48296|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

60. spacer 2.20|48617|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 9, identity: 0.743

gcttttttcaacaattttatcaccagatgtcatta	CRISPR spacer
agttttttcaacaattttatgaacagataattttt	Protospacer
. ****************** * *****. . ** 

61. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

62. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

63. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

64. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

65. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

66. spacer 2.33|49462|35|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

67. spacer 1.2|31909|34|NZ_MCHS01000029|PILER-CR,CRT matches to MK044828 (Streptococcus phage 33888, complete genome) position: , mismatch: 10, identity: 0.706

ctgtaaaatcaaaagtatcatagaaacaatcttc	CRISPR spacer
tgggaaaatcaaaagtatcaaagtaacagatgta	Protospacer
. * **************** ** ****. . * 

68. spacer 2.30|49268|34|NZ_MCHS01000029|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034816 (Paracoccus sp. Arc7-R13 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.676

caagatatgctagaaatggcgcaaatagcgcgcg	CRISPR spacer
gtccggctgcttgaaatggcgcagatagcgcgtc	Protospacer
    .  **** ***********.********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 174734 : 204274 41 Listeria_phage(44.83%) integrase,tail,terminase,capsid,head,protease,portal attL 178922:178936|attR 193278:193292
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_MCHS01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3542 8 Listeria_phage(87.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_MCHS01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1100 : 11978 8 Listeria_phage(100.0%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_MCHS01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47 : 13907 25 Listeria_phage(90.91%) integrase attL 3849:3862|attR 12337:12350
DBSCAN-SWA_2 17823 : 25667 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_MCHS01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 205 : 7165 14 Listeria_phage(100.0%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_MCHS01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14761 18 Listeria_phage(100.0%) portal,terminase,capsid,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_MCHS01000030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MCHS01000030_1 123766-124350 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_MCHS01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35520 : 53588 23 Listeria_phage(30.77%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_MCHS01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 449516 : 456939 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_MCHS01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19295 : 78777 58 Bacillus_virus(15.79%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_MCHS01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47 : 12069 21 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_MCHS01000037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MCHS01000037_1 7065-8485 TypeII II-A,II-B
21 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 NZ_MCHS01000039.1 99122-99152 0 1.0
NZ_MCHS01000037_1 1.11|7760|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7760-7789 30 NZ_MCHS01000034.1 497547-497576 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 NZ_MCHS01000034.1 492222-492251 1 0.967
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 NZ_MCHS01000027.1 2119-2148 2 0.933
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 NZ_MCHS01000028.1 2119-2148 2 0.933

1. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to position: 99122-99152, mismatch: 0, identity: 1.0

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
ttgttaatgtcatttttcatcatcctttatg	Protospacer
*******************************

2. spacer 1.11|7760|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to position: 497547-497576, mismatch: 1, identity: 0.967

gatgccgcagcatatatatttaattgagct	CRISPR spacer
gatgccgcagcgtatatatttaattgagct	Protospacer
***********.******************

3. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to position: 492222-492251, mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacctcaccgttagggctttttttatgcaa	Protospacer
******* **********************

4. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to position: 2119-2148, mismatch: 2, identity: 0.933

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tcattatttattttctcccaaataaaatca	Protospacer
*****.*****.******************

5. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to position: 2119-2148, mismatch: 2, identity: 0.933

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tcattatttattttctcccaaataaaatca	Protospacer
*****.*****.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MCHS01000037_1 1.9|7628|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7628-7657 30 AJ312240 Bacteriophage PSA complete genome 9843-9872 0 1.0
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 NC_042048 Listeria phage LMTA-34, complete genome 74603-74632 0 1.0
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 NC_024360 Listeria phage LMSP-25, complete genome 74603-74632 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 4400-4429 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 2528-2557 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 HI504184 Sequence 26 from Patent EP2147092 2528-2557 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 AJ417489 bacteriophage U153 int gene for U153 integrase 2528-2557 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KJ094022 Listeria phage LP-030-3, complete genome 30296-30325 0 1.0
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 AJ312240 Bacteriophage PSA complete genome 18523-18552 0 1.0
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 225302-225331 0 1.0
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 KJ094023 Listeria phage LP-101, complete genome 15775-15804 0 1.0
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 209277-209306 1 0.967
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 NC_009812 Listeria phage B025, complete genome 196-225 1 0.967
NZ_MCHS01000037_1 1.11|7760|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7760-7789 30 DQ003642 Listeria phage A006, complete genome 15360-15389 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 4442-4471 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 2486-2515 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 HI504184 Sequence 26 from Patent EP2147092 2486-2515 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 AJ417489 bacteriophage U153 int gene for U153 integrase 2486-2515 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 229925-229954 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MN172529 Listeria phage LP-039, complete genome 59048-59077 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MT178766 Listeria virus P100plus, complete genome 26020-26049 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 NC_025440 Listeria phage WIL-1, complete genome 106789-106818 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 NC_047872 Listeria phage LMTA-94, complete genome 72338-72367 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MT178767 Listeria virus P200, complete genome 26020-26049 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 DQ004855 Listeria bacteriophage P100, complete genome 26019-26048 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ591605 Listeria phage LMTA-57, complete genome 83087-83116 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ094033 Listeria phage LP-048, complete genome 61505-61534 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ668715 Listeria phage LMTA-34, partial genome 59201-59230 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MN128594 Listeria phage LP-066, complete genome 60544-60573 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ094030 Listeria phage LP-083-2, complete genome 65710-65739 1 0.967
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ094031 Listeria phage LP-124, complete genome 27825-27854 1 0.967
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NC_021539 Listeria phage LP-030-2, complete genome 18331-18360 1 0.967
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 NC_021539 Listeria phage LP-030-2, complete genome 18372-18401 2 0.933
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 KJ094022 Listeria phage LP-030-3, complete genome 30338-30367 2 0.933
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 MT500540 Listeria phage LP-HM00113468, complete genome 24311-24340 2 0.933
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 KP399678 Listeria phage vB_LmoS_293, complete genome 21903-21932 2 0.933
NZ_MCHS01000037_1 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8024-8053 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213868-213897 2 0.933
NZ_MCHS01000037_1 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8024-8053 30 KJ094023 Listeria phage LP-101, complete genome 4341-4370 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MT438761 Listeria virus P61, complete genome 70795-70824 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 60394-60423 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 DQ003638 Listeria phage A511, complete genome 59585-59614 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ591604 Listeria phage LMTA-148, complete genome 66986-67015 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 80589-80618 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 NC_041862 Listeria phage LP-064, complete genome 69005-69034 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 JX126918 Listeria phage LP-125, complete genome 69007-69036 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 58894-58923 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 KJ535721 Listeria phage List-36, complete genome 69453-69482 2 0.933
NZ_MCHS01000037_1 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8222-8251 30 FJ147490 Listeria phage 20422-1 unknown genes 607-636 2 0.933
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 KJ094023 Listeria phage LP-101, complete genome 188-217 3 0.9
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 AJ312240 Bacteriophage PSA complete genome 18565-18594 3 0.9
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 MT500540 Listeria phage LP-HM00113468, complete genome 29150-29179 3 0.9
NZ_MCHS01000037_1 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8024-8053 30 MT500540 Listeria phage LP-HM00113468, complete genome 284-313 4 0.867
NZ_MCHS01000037_1 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7562-7591 30 NC_003216 Listeria phage A118, complete genome 19234-19263 5 0.833
NZ_MCHS01000037_1 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7562-7591 30 AJ242593 Bacteriophage A118 complete genome 19234-19263 5 0.833
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 NC_003216 Listeria phage A118, complete genome 21913-21942 5 0.833
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 AJ242593 Bacteriophage A118 complete genome 21913-21942 5 0.833
NZ_MCHS01000037_1 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8090-8119 30 KJ094028 Listeria phage LP-083-1 contig 2, partial genome 14832-14861 5 0.833
NZ_MCHS01000037_1 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8090-8119 30 DQ003641 Listeria phage P35, complete genome 30954-30983 5 0.833
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP026684 Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM2, complete sequence 95843-95872 5 0.833
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 MH823906 Citrobacter phage Maroon, complete genome 170657-170686 6 0.8
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 LC589952 Enterobacter phage vB_EkoM5VN DNA, complete genome 40506-40535 6 0.8
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 KX431560 Cronobacter phage vB_CsaM_leN, complete genome 171110-171139 6 0.8
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 KT381880 Citrobacter phage Margaery, complete genome 169990-170019 6 0.8
NZ_MCHS01000037_1 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7165-7194 30 NC_048645 Cronobacter phage vB_CsaM_leB, complete genome 169501-169530 6 0.8
NZ_MCHS01000037_1 1.9|7628|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7628-7657 30 CP021182 Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence 192736-192765 6 0.8
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 X85009 Bacteriophage A500 hol500 and ply500 genes 2291-2320 6 0.8
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 DQ003637 Listeria phage A500, complete genome 21938-21967 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KT207918 Bacillus phage Eyuki, complete genome 116456-116485 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NC_031054 Bacillus phage DirtyBetty, complete genome 116445-116474 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 44141-44170 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MH538193 Bacillus phage Saddex, complete genome 117316-117345 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MF288919 Bacillus phage AaronPhadgers, complete genome 115968-115997 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MG763894 Bacillus phage HonestAbe, complete genome 116215-116244 6 0.8
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NC_031116 Bacillus phage Zuko, complete genome 117017-117046 6 0.8
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP031445 Acinetobacter baumannii strain MDR-UNC plasmid unnamed1, complete sequence 66833-66862 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP040426 Acinetobacter baumannii strain PB364 plasmid pPB364_1, complete sequence 15361-15390 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP029570 Acinetobacter baumannii strain DA33098 plasmid pDA33098-108, complete sequence 60796-60825 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP027122 Acinetobacter baumannii strain AR_0056 plasmid unnamed1, complete sequence 50797-50826 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP027608 Acinetobacter baumannii strain AR_0102 plasmid unnamed1, complete sequence 44202-44231 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP026705 Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence 30996-31025 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP035046 Acinetobacter baumannii strain ABUH793 plasmid p107.0Kbp, complete sequence 45158-45187 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 MK504446 Lactobacillus phage SAC12B, complete genome 116668-116697 7 0.767
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NC_021559 Prochlorococcus phage P-SSM3 genomic sequence 94742-94771 7 0.767
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 67648-67678 7 0.774
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 30800-30830 7 0.774
NZ_MCHS01000037_1 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7562-7591 30 NC_019274 Psychrobacter sp. DAB_AL62B plasmid pP62BP1, complete sequence 30251-30280 7 0.767
NZ_MCHS01000037_1 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7562-7591 30 NZ_AP018257 Calothrix sp. NIES-4071 plasmid plasmid2 DNA, complete genome 212124-212153 7 0.767
NZ_MCHS01000037_1 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7562-7591 30 MT254578 Bacillus phage Izhevsk, complete genome 9172-9201 7 0.767
NZ_MCHS01000037_1 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8090-8119 30 NZ_MH113855 Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence 138833-138862 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KX961629 Bacillus phage BJ4, complete genome 115259-115288 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NC_031070 Bacillus phage Nemo, complete genome 116990-117019 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MF288920 Bacillus phage Zainny, complete genome 116438-116467 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KJ489399 Bacillus phage Hakuna, complete genome 114490-114519 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NC_031027 Bacillus phage SageFayge, complete genome 115953-115982 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KX349902 Bacillus phage Kida, complete genome 116180-116209 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KX156152 Bacillus phage Smudge, complete genome 116059-116088 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KJ489401 Bacillus phage Megatron, complete genome 115838-115867 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MN038179 Bacillus phage ALPS, complete genome 116242-116271 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MH638311 Bacillus phage OmnioDeoPrimus, complete genome 115905-115934 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 MF288918 Bacillus phage Bubs, complete genome 117020-117049 7 0.767
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 KX961632 Bacillus phage SBP8a, complete genome 115649-115678 7 0.767
NZ_MCHS01000037_1 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8420-8449 30 MG592459 Vibrio phage 1.084.O._10N.261.49.F5, partial genome 30611-30640 7 0.767
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 795158-795187 8 0.733
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NC_015156 Vibrio nigripulchritudo plasmid VIBNI_pA, complete genome 135244-135273 8 0.733
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 155373-155403 8 0.742
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 AP013449 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C66A-MedDCM-OCT-S35-C82 13642-13672 8 0.742
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP016726 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08A, complete sequence 53675-53704 8 0.733
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP023393 Lactococcus raffinolactis strain WiKim0068 plasmid pWiKim0068-1, complete sequence 30092-30121 8 0.733
NZ_MCHS01000037_1 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7297-7326 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 281290-281319 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_KX426232 Acinetobacter lwoffii strain VS15 plasmid pALWVS1.1, complete sequence 22389-22418 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_AP019742 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence 70745-70774 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 74538-74567 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP026416 Acinetobacter sp. ACNIH2 plasmid pACI-3569, complete sequence 109524-109553 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 72832-72861 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP015616 Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence 85394-85423 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP026426 Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence 105891-105920 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP051209 Acinetobacter sp. NEB149 plasmid pMsp179, complete sequence 83988-84017 9 0.7
NZ_MCHS01000037_1 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7363-7392 30 NZ_CP032102 Acinetobacter lwoffii strain EK30A plasmid pALWEK1.1, complete sequence 23402-23431 9 0.7
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 129665-129695 9 0.71
NZ_MCHS01000037_1 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7429-7459 31 HM144387 Bacillus phage W.Ph., complete genome 65600-65630 9 0.71
NZ_MCHS01000037_1 1.13|7892|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7892-7921 30 NZ_CP034542 Brevibacillus sp. SCSIO 07484 plasmid unnamed, complete sequence 14311-14340 9 0.7
NZ_MCHS01000037_1 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 7958-7987 30 JF270478 Psychrobacter phage Psymv2, complete genome 10914-10943 9 0.7
NZ_MCHS01000037_1 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR 8288-8317 30 NZ_CP034167 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence 117743-117772 9 0.7

1. spacer 1.9|7628|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 0, identity: 1.0

caaccatttgaatccaacgactaatatagc	CRISPR spacer
caaccatttgaatccaacgactaatatagc	Protospacer
******************************

2. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 0, identity: 1.0

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatacaggttaggaagtaaactccttgta	Protospacer
******************************

3. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 0, identity: 1.0

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatacaggttaggaagtaaactccttgta	Protospacer
******************************

4. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

5. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

6. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

7. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

8. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

9. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 0, identity: 1.0

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cttaaagttgtcaacttctattttttatat	Protospacer
******************************

10. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tcattgtttatcttctcccaaataaaatca	Protospacer
******************************

11. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tcattgtttatcttctcccaaataaaatca	Protospacer
******************************

12. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagtgacaacaacagcaccatccatt	Protospacer
***********************.******

13. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.967

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagtgacaacaacagcaccatccatt	Protospacer
***********************.******

14. spacer 1.11|7760|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.967

gatgccgcagcatatatatttaattgagct	CRISPR spacer
gatgccgcagcgtatatatttaattgagct	Protospacer
***********.******************

15. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacttcaacgttagggctttttttatgcaa	Protospacer
***.**************************

16. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacttcaacgttagggctttttttatgcaa	Protospacer
***.**************************

17. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacttcaacgttagggctttttttatgcaa	Protospacer
***.**************************

18. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacttcaacgttagggctttttttatgcaa	Protospacer
***.**************************

19. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

aacctcaacgttagggctttttttatgcaa-	CRISPR spacer
aacctcaacgttagggc-ttttttatgcaaa	Protospacer
***************** ************ 

20. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

21. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

22. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

23. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

24. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

25. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to DQ004855 (Listeria bacteriophage P100, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

26. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

27. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

28. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ668715 (Listeria phage LMTA-34, partial genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

29. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

30. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

31. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 1, identity: 0.967

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtatataggttaggaagtaaactccttgta	Protospacer
*****.************************

32. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.967

cttaaagttgtcaacttctattttttatat-	CRISPR spacer
cttaaagttgtcaacttcta-tttttatata	Protospacer
******************** ********* 

33. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 2, identity: 0.933

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacctcactgttagggctttttttatgcaa	Protospacer
******* .*********************

34. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.933

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
aacctcgccgttagggctttttttatgcaa	Protospacer
******. **********************

35. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.933

-aacctcaacgttagggctttttttatgcaa	CRISPR spacer
taaccac-acgttagggctttttttatgcaa	Protospacer
 **** * ***********************

36. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.933

aacctcaacgttagggctttttttatgcaa-	CRISPR spacer
aacctcaccgttagggc-ttttttatgcaaa	Protospacer
******* ********* ************ 

37. spacer 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.933

acacagcaagcccactagtttcggatttta	CRISPR spacer
atacagcaaggccactagtttcggatttta	Protospacer
*.******** *******************

38. spacer 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.933

acacagcaagcccactagtttcggatttta	CRISPR spacer
atacagcaagaccactagtttcggatttta	Protospacer
*.******** *******************

39. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

40. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

41. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

42. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

43. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

44. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

45. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

46. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

47. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

48. spacer 1.18|8222|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to FJ147490 (Listeria phage 20422-1 unknown genes) position: , mismatch: 2, identity: 0.933

gtatacaggttaggaagtaaactccttgta	CRISPR spacer
gtgtataggttaggaagtaaactccttgta	Protospacer
**.**.************************

49. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 3, identity: 0.9

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcggtgacaacaacagcaccatccact	Protospacer
*****.*****************.****.*

50. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 3, identity: 0.9

aacctcaacgttagggc-tttttttatgcaa	CRISPR spacer
aacctcgccgttagggcttttttttatgca-	Protospacer
******. ********* ************ 

51. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 3, identity: 0.9

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tcattgtttattttctcccagataaaatcg	Protospacer
***********.********.********.

52. spacer 1.15|8024|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 4, identity: 0.867

acacagcaagcccactagtttcggatttta	CRISPR spacer
atacagcaagaccactagtttctgatttca	Protospacer
*.******** *********** *****.*

53. spacer 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 5, identity: 0.833

atttatgtgaatttagtgatgaatggcaga	CRISPR spacer
atttacgtgaatttagtgatgaataatcga	Protospacer
*****.******************... **

54. spacer 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 5, identity: 0.833

atttatgtgaatttagtgatgaatggcaga	CRISPR spacer
atttacgtgaatttagtgatgaataatcga	Protospacer
*****.******************... **

55. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 5, identity: 0.833

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
taacccaccgttagggctttttttatgaaa	Protospacer
 * *.** ******************* **

56. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 5, identity: 0.833

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
taacccaccgttagggctttttttatgaaa	Protospacer
 * *.** ******************* **

57. spacer 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ094028 (Listeria phage LP-083-1 contig 2, partial genome) position: , mismatch: 5, identity: 0.833

atgaaagagcattcagactttggaaaaacg	CRISPR spacer
accatcgagcgttcagactttggaaaaacg	Protospacer
*. *  ****.*******************

58. spacer 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 5, identity: 0.833

atgaaagagcattcagactttggaaaaacg	CRISPR spacer
accatcgagcgttcagactttggaaaaacg	Protospacer
*. *  ****.*******************

59. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026684 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM2, complete sequence) position: , mismatch: 5, identity: 0.833

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaaattttcaacttctattttttctct	Protospacer
 *****.** **************** * *

60. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MH823906 (Citrobacter phage Maroon, complete genome) position: , mismatch: 6, identity: 0.8

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagttacaacagcagcaccgaaactt	Protospacer
******** ******.********    **

61. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to LC589952 (Enterobacter phage vB_EkoM5VN DNA, complete genome) position: , mismatch: 6, identity: 0.8

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagttacaacagcagcaccgaaactt	Protospacer
******** ******.********    **

62. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KX431560 (Cronobacter phage vB_CsaM_leN, complete genome) position: , mismatch: 6, identity: 0.8

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagttacaacagcagcaccgaaactt	Protospacer
******** ******.********    **

63. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KT381880 (Citrobacter phage Margaery, complete genome) position: , mismatch: 6, identity: 0.8

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagttacaacagcagcaccgaaactt	Protospacer
******** ******.********    **

64. spacer 1.2|7165|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_048645 (Cronobacter phage vB_CsaM_leB, complete genome) position: , mismatch: 6, identity: 0.8

ttttcagtgacaacaacagcaccgtccatt	CRISPR spacer
ttttcagttacaacagcagcaccgaaactt	Protospacer
******** ******.********    **

65. spacer 1.9|7628|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to CP021182 (Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence) position: , mismatch: 6, identity: 0.8

caaccatttgaatccaacgactaatatagc	CRISPR spacer
caatcatttcaatccaacgactattgtgac	Protospacer
***.***** ************* *.*..*

66. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to X85009 (Bacteriophage A500 hol500 and ply500 genes) position: , mismatch: 6, identity: 0.8

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
tttataaacattagggctttttttatgcaa	Protospacer
  . * ***.********************

67. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 6, identity: 0.8

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
tttataaacattagggctttttttatgcaa	Protospacer
  . * ***.********************

68. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KT207918 (Bacillus phage Eyuki, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactattttttaagg	Protospacer
 ***** ********* ********** . 

69. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_031054 (Bacillus phage DirtyBetty, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactattttttaagg	Protospacer
 ***** ********* ********** . 

70. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
cctcattatgtcaatttctattttttatat	Protospacer
*.* *   ******.***************

71. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MH538193 (Bacillus phage Saddex, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaaggt	Protospacer
 ***** ********* ******** * .*

72. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MF288919 (Bacillus phage AaronPhadgers, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaaggt	Protospacer
 ***** ********* ******** * .*

73. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MG763894 (Bacillus phage HonestAbe, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaaggt	Protospacer
 ***** ********* ******** * .*

74. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_031116 (Bacillus phage Zuko, complete genome) position: , mismatch: 6, identity: 0.8

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaaggt	Protospacer
 ***** ********* ******** * .*

75. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031445 (Acinetobacter baumannii strain MDR-UNC plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

76. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040426 (Acinetobacter baumannii strain PB364 plasmid pPB364_1, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

77. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029570 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-108, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

78. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027122 (Acinetobacter baumannii strain AR_0056 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

79. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027608 (Acinetobacter baumannii strain AR_0102 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

80. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026705 (Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

81. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035046 (Acinetobacter baumannii strain ABUH793 plasmid p107.0Kbp, complete sequence) position: , mismatch: 7, identity: 0.767

----caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ttgctaaa----ggaactgatcttccttgtcggc	Protospacer
    .***    ***** *************** 

82. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MK504446 (Lactobacillus phage SAC12B, complete genome) position: , mismatch: 7, identity: 0.767

caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
cagcacagggaacgtatcttcattgtcgga	Protospacer
**. .. ******* ****** ********

83. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_021559 (Prochlorococcus phage P-SSM3 genomic sequence) position: , mismatch: 7, identity: 0.767

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
gaactttttctttgtgtaggtgattttggc	Protospacer
*  .******** *************.*..

84. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
gtgcttctgccatctttcatcatcctttatt	Protospacer
 **.*  **.***.**************** 

85. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
gtgcttctgccatctttcatcatcctttatt	Protospacer
 **.*  **.***.**************** 

86. spacer 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_019274 (Psychrobacter sp. DAB_AL62B plasmid pP62BP1, complete sequence) position: , mismatch: 7, identity: 0.767

atttatgtgaatttagtgatgaatggcaga	CRISPR spacer
atttatgtaaatttagtgatgaagattatg	Protospacer
********.************** . .* .

87. spacer 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018257 (Calothrix sp. NIES-4071 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.767

atttatgtgaatttagtgatgaatggcaga	CRISPR spacer
atttatctgaatttattgatgaaatatagt	Protospacer
****** ******** *******  ..** 

88. spacer 1.8|7562|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MT254578 (Bacillus phage Izhevsk, complete genome) position: , mismatch: 7, identity: 0.767

atttatgtgaatttagtgatgaatggcaga	CRISPR spacer
atttaggtgaatttagagatgaaagtttca	Protospacer
***** ********** ****** * .  *

89. spacer 1.16|8090|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 7, identity: 0.767

atgaaagagcattcagactttggaaaaacg	CRISPR spacer
aagcaagagcattcagactttgaaagagtt	Protospacer
* * ******************.**.*.. 

90. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KX961629 (Bacillus phage BJ4, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

91. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_031070 (Bacillus phage Nemo, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

92. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MF288920 (Bacillus phage Zainny, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

93. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ489399 (Bacillus phage Hakuna, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

94. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_031027 (Bacillus phage SageFayge, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

95. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KX349902 (Bacillus phage Kida, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

96. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KX156152 (Bacillus phage Smudge, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

97. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KJ489401 (Bacillus phage Megatron, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

98. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MN038179 (Bacillus phage ALPS, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

99. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MH638311 (Bacillus phage OmnioDeoPrimus, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

100. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MF288918 (Bacillus phage Bubs, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

101. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to KX961632 (Bacillus phage SBP8a, complete genome) position: , mismatch: 7, identity: 0.767

cttaaagttgtcaacttctattttttatat	CRISPR spacer
attaaatttgtcaactactatttttaagga	Protospacer
 ***** ********* ******** * . 

102. spacer 1.21|8420|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to MG592459 (Vibrio phage 1.084.O._10N.261.49.F5, partial genome) position: , mismatch: 7, identity: 0.767

tcattgtttatcttctcccaaataaaatca	CRISPR spacer
tattcatttatctcctcctaaataaaatcc	Protospacer
*  *..*******.****.********** 

103. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.733

caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ggtaatcgggaaccgatcttccttggcgat	Protospacer
 . *.******** *********** **. 

104. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NC_015156 (Vibrio nigripulchritudo plasmid VIBNI_pA, complete genome) position: , mismatch: 8, identity: 0.733

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
acggcaattcttggtgcaggtgattttgat	Protospacer
.*  .  *********.*********.***

105. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 8, identity: 0.742

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
tctctaatttcatttttcatcatccttgtaa	Protospacer
*. .**** ******************   .

106. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to AP013449 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C66A-MedDCM-OCT-S35-C82) position: , mismatch: 8, identity: 0.742

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
ttattaatgtcttttttcatcatgccgctcg	Protospacer
**.******** *********** *. . .*

107. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016726 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08A, complete sequence) position: , mismatch: 8, identity: 0.733

cttaaagttgtcaacttctattttttatat	CRISPR spacer
tatcttgttctcaccttctattttttataa	Protospacer
. *   *** *** *************** 

108. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023393 (Lactococcus raffinolactis strain WiKim0068 plasmid pWiKim0068-1, complete sequence) position: , mismatch: 8, identity: 0.733

cttaaagttgtcaacttctattttttatat	CRISPR spacer
tatcttgttctcaccttctattttttataa	Protospacer
. *   *** *** *************** 

109. spacer 1.4|7297|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 9, identity: 0.7

caaagtcgggaacggatcttccttgtcgga	CRISPR spacer
ggtgatcgggaaccgatcttccttggcgat	Protospacer
 . ..******** *********** **. 

110. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX426232 (Acinetobacter lwoffii strain VS15 plasmid pALWVS1.1, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

111. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019742 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA2, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

112. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

113. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026416 (Acinetobacter sp. ACNIH2 plasmid pACI-3569, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

114. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

115. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015616 (Acinetobacter schindleri strain ACE plasmid p1AsACE, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

116. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026426 (Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

117. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051209 (Acinetobacter sp. NEB149 plasmid pMsp179, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

118. spacer 1.5|7363|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032102 (Acinetobacter lwoffii strain EK30A plasmid pALWEK1.1, complete sequence) position: , mismatch: 9, identity: 0.7

gctttttttcttggtgtaggtgatttcgat	CRISPR spacer
aattattttcttggtgttggtgattcatgg	Protospacer
. ** ************ *******.  . 

119. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 9, identity: 0.71

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
ctgttaatgtcctttttcatcgtctgcttct	Protospacer
.********** *********.**. .* . 

120. spacer 1.6|7429|31|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to HM144387 (Bacillus phage W.Ph., complete genome) position: , mismatch: 9, identity: 0.71

ttgttaatgtcatttttcatcatcctttatg	CRISPR spacer
cttgacttgccattattcatcatcctttatc	Protospacer
.*     **.**** *************** 

121. spacer 1.13|7892|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034542 (Brevibacillus sp. SCSIO 07484 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

aatggtgaatgcgttgaagaaggaggaact	CRISPR spacer
ggccgtgaatgcgttgatgaaggaggcggc	Protospacer
... ************* ******** . .

122. spacer 1.14|7958|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to JF270478 (Psychrobacter phage Psymv2, complete genome) position: , mismatch: 9, identity: 0.7

aacctcaacgttagggctttttttatgcaa	CRISPR spacer
ttatctaacgatagggctttttttatgcct	Protospacer
   ...**** *****************  

123. spacer 1.19|8288|30|NZ_MCHS01000037|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034167 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence) position: , mismatch: 9, identity: 0.7

cttaaagttgtcaacttctattttttatat	CRISPR spacer
agaggagttgtcaaattctatttttttatt	Protospacer
   ..********* ***********   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage