Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MPVI01000060 Pseudomonas aeruginosa strain CLB24405 contig_60, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_MPVI01000023 Pseudomonas aeruginosa strain CLB24405 contig_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000011 Pseudomonas aeruginosa strain CLB24405 contig_11, whole genome shotgun sequence 0 crisprs NA 0 0 0 3
NZ_MPVI01000094 Pseudomonas aeruginosa strain CLB24405 contig_94, whole genome shotgun sequence 1 crisprs NA 2 2 0 0
NZ_MPVI01000051 Pseudomonas aeruginosa strain CLB24405 contig_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000098 Pseudomonas aeruginosa strain CLB24405 contig_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000028 Pseudomonas aeruginosa strain CLB24405 contig_28, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_MPVI01000076 Pseudomonas aeruginosa strain CLB24405 contig_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000116 Pseudomonas aeruginosa strain CLB24405 contig_116, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_MPVI01000083 Pseudomonas aeruginosa strain CLB24405 contig_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000033 Pseudomonas aeruginosa strain CLB24405 contig_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000152 Pseudomonas aeruginosa strain CLB24405 contig_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000052 Pseudomonas aeruginosa strain CLB24405 contig_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000075 Pseudomonas aeruginosa strain CLB24405 contig_75, whole genome shotgun sequence 0 crisprs csa3,PD-DExK 0 0 0 0
NZ_MPVI01000112 Pseudomonas aeruginosa strain CLB24405 contig_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000043 Pseudomonas aeruginosa strain CLB24405 contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000058 Pseudomonas aeruginosa strain CLB24405 contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000133 Pseudomonas aeruginosa strain CLB24405 contig_133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000014 Pseudomonas aeruginosa strain CLB24405 contig_14, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MPVI01000015 Pseudomonas aeruginosa strain CLB24405 contig_15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000077 Pseudomonas aeruginosa strain CLB24405 contig_77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000035 Pseudomonas aeruginosa strain CLB24405 contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000103 Pseudomonas aeruginosa strain CLB24405 contig_103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000079 Pseudomonas aeruginosa strain CLB24405 contig_79, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MPVI01000122 Pseudomonas aeruginosa strain CLB24405 contig_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000153 Pseudomonas aeruginosa strain CLB24405 contig_153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000148 Pseudomonas aeruginosa strain CLB24405 contig_148, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000022 Pseudomonas aeruginosa strain CLB24405 contig_22, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MPVI01000139 Pseudomonas aeruginosa strain CLB24405 contig_139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000114 Pseudomonas aeruginosa strain CLB24405 contig_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000046 Pseudomonas aeruginosa strain CLB24405 contig_46, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MPVI01000070 Pseudomonas aeruginosa strain CLB24405 contig_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000067 Pseudomonas aeruginosa strain CLB24405 contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000056 Pseudomonas aeruginosa strain CLB24405 contig_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000144 Pseudomonas aeruginosa strain CLB24405 contig_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000147 Pseudomonas aeruginosa strain CLB24405 contig_147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000118 Pseudomonas aeruginosa strain CLB24405 contig_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000104 Pseudomonas aeruginosa strain CLB24405 contig_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000041 Pseudomonas aeruginosa strain CLB24405 contig_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000021 Pseudomonas aeruginosa strain CLB24405 contig_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000066 Pseudomonas aeruginosa strain CLB24405 contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000042 Pseudomonas aeruginosa strain CLB24405 contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000053 Pseudomonas aeruginosa strain CLB24405 contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000146 Pseudomonas aeruginosa strain CLB24405 contig_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000009 Pseudomonas aeruginosa strain CLB24405 contig_9, whole genome shotgun sequence 0 crisprs NA 0 0 0 3
NZ_MPVI01000080 Pseudomonas aeruginosa strain CLB24405 contig_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000004 Pseudomonas aeruginosa strain CLB24405 contig_4, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000010 Pseudomonas aeruginosa strain CLB24405 contig_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000151 Pseudomonas aeruginosa strain CLB24405 contig_151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000049 Pseudomonas aeruginosa strain CLB24405 contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000093 Pseudomonas aeruginosa strain CLB24405 contig_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000063 Pseudomonas aeruginosa strain CLB24405 contig_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000131 Pseudomonas aeruginosa strain CLB24405 contig_131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000048 Pseudomonas aeruginosa strain CLB24405 contig_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000124 Pseudomonas aeruginosa strain CLB24405 contig_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000092 Pseudomonas aeruginosa strain CLB24405 contig_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000141 Pseudomonas aeruginosa strain CLB24405 contig_141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000025 Pseudomonas aeruginosa strain CLB24405 contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000137 Pseudomonas aeruginosa strain CLB24405 contig_137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000091 Pseudomonas aeruginosa strain CLB24405 contig_91, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000057 Pseudomonas aeruginosa strain CLB24405 contig_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000044 Pseudomonas aeruginosa strain CLB24405 contig_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000117 Pseudomonas aeruginosa strain CLB24405 contig_117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000071 Pseudomonas aeruginosa strain CLB24405 contig_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000125 Pseudomonas aeruginosa strain CLB24405 contig_125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000017 Pseudomonas aeruginosa strain CLB24405 contig_17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000087 Pseudomonas aeruginosa strain CLB24405 contig_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000001 Pseudomonas aeruginosa strain CLB24405 contig_1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000034 Pseudomonas aeruginosa strain CLB24405 contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000081 Pseudomonas aeruginosa strain CLB24405 contig_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000086 Pseudomonas aeruginosa strain CLB24405 contig_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000006 Pseudomonas aeruginosa strain CLB24405 contig_6, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_MPVI01000129 Pseudomonas aeruginosa strain CLB24405 contig_129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000013 Pseudomonas aeruginosa strain CLB24405 contig_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000099 Pseudomonas aeruginosa strain CLB24405 contig_99, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 1 0
NZ_MPVI01000145 Pseudomonas aeruginosa strain CLB24405 contig_145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000140 Pseudomonas aeruginosa strain CLB24405 contig_140, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000121 Pseudomonas aeruginosa strain CLB24405 contig_121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000128 Pseudomonas aeruginosa strain CLB24405 contig_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000106 Pseudomonas aeruginosa strain CLB24405 contig_106, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_MPVI01000061 Pseudomonas aeruginosa strain CLB24405 contig_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000040 Pseudomonas aeruginosa strain CLB24405 contig_40, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_MPVI01000096 Pseudomonas aeruginosa strain CLB24405 contig_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000088 Pseudomonas aeruginosa strain CLB24405 contig_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000078 Pseudomonas aeruginosa strain CLB24405 contig_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000134 Pseudomonas aeruginosa strain CLB24405 contig_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000097 Pseudomonas aeruginosa strain CLB24405 contig_97, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000039 Pseudomonas aeruginosa strain CLB24405 contig_39, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MPVI01000005 Pseudomonas aeruginosa strain CLB24405 contig_5, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000019 Pseudomonas aeruginosa strain CLB24405 contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000030 Pseudomonas aeruginosa strain CLB24405 contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000105 Pseudomonas aeruginosa strain CLB24405 contig_105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000115 Pseudomonas aeruginosa strain CLB24405 contig_115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000135 Pseudomonas aeruginosa strain CLB24405 contig_135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000072 Pseudomonas aeruginosa strain CLB24405 contig_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000149 Pseudomonas aeruginosa strain CLB24405 contig_149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000154 Pseudomonas aeruginosa strain CLB24405 contig_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000032 Pseudomonas aeruginosa strain CLB24405 contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000108 Pseudomonas aeruginosa strain CLB24405 contig_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000069 Pseudomonas aeruginosa strain CLB24405 contig_69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000109 Pseudomonas aeruginosa strain CLB24405 contig_109, whole genome shotgun sequence 1 crisprs NA 2 10 0 0
NZ_MPVI01000016 Pseudomonas aeruginosa strain CLB24405 contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000143 Pseudomonas aeruginosa strain CLB24405 contig_143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000095 Pseudomonas aeruginosa strain CLB24405 contig_95, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000123 Pseudomonas aeruginosa strain CLB24405 contig_123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000120 Pseudomonas aeruginosa strain CLB24405 contig_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000082 Pseudomonas aeruginosa strain CLB24405 contig_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000100 Pseudomonas aeruginosa strain CLB24405 contig_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000002 Pseudomonas aeruginosa strain CLB24405 contig_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000045 Pseudomonas aeruginosa strain CLB24405 contig_45, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MPVI01000111 Pseudomonas aeruginosa strain CLB24405 contig_111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000024 Pseudomonas aeruginosa strain CLB24405 contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000119 Pseudomonas aeruginosa strain CLB24405 contig_119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000130 Pseudomonas aeruginosa strain CLB24405 contig_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000090 Pseudomonas aeruginosa strain CLB24405 contig_90, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000008 Pseudomonas aeruginosa strain CLB24405 contig_8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000084 Pseudomonas aeruginosa strain CLB24405 contig_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000138 Pseudomonas aeruginosa strain CLB24405 contig_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000107 Pseudomonas aeruginosa strain CLB24405 contig_107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000029 Pseudomonas aeruginosa strain CLB24405 contig_29, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MPVI01000068 Pseudomonas aeruginosa strain CLB24405 contig_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000037 Pseudomonas aeruginosa strain CLB24405 contig_37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000007 Pseudomonas aeruginosa strain CLB24405 contig_7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000136 Pseudomonas aeruginosa strain CLB24405 contig_136, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MPVI01000101 Pseudomonas aeruginosa strain CLB24405 contig_101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000062 Pseudomonas aeruginosa strain CLB24405 contig_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000102 Pseudomonas aeruginosa strain CLB24405 contig_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000047 Pseudomonas aeruginosa strain CLB24405 contig_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000050 Pseudomonas aeruginosa strain CLB24405 contig_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000027 Pseudomonas aeruginosa strain CLB24405 contig_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000055 Pseudomonas aeruginosa strain CLB24405 contig_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000150 Pseudomonas aeruginosa strain CLB24405 contig_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000127 Pseudomonas aeruginosa strain CLB24405 contig_127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000110 Pseudomonas aeruginosa strain CLB24405 contig_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000020 Pseudomonas aeruginosa strain CLB24405 contig_20, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_MPVI01000018 Pseudomonas aeruginosa strain CLB24405 contig_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000038 Pseudomonas aeruginosa strain CLB24405 contig_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000155 Pseudomonas aeruginosa strain CLB24405 contig_155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000074 Pseudomonas aeruginosa strain CLB24405 contig_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000036 Pseudomonas aeruginosa strain CLB24405 contig_36, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000059 Pseudomonas aeruginosa strain CLB24405 contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000054 Pseudomonas aeruginosa strain CLB24405 contig_54, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_MPVI01000031 Pseudomonas aeruginosa strain CLB24405 contig_31, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_MPVI01000113 Pseudomonas aeruginosa strain CLB24405 contig_113, whole genome shotgun sequence 0 crisprs NA 0 0 0 3
NZ_MPVI01000132 Pseudomonas aeruginosa strain CLB24405 contig_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000064 Pseudomonas aeruginosa strain CLB24405 contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_MPVI01000085 Pseudomonas aeruginosa strain CLB24405 contig_85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000089 Pseudomonas aeruginosa strain CLB24405 contig_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000126 Pseudomonas aeruginosa strain CLB24405 contig_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000065 Pseudomonas aeruginosa strain CLB24405 contig_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000142 Pseudomonas aeruginosa strain CLB24405 contig_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000012 Pseudomonas aeruginosa strain CLB24405 contig_12, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_MPVI01000073 Pseudomonas aeruginosa strain CLB24405 contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MPVI01000026 Pseudomonas aeruginosa strain CLB24405 contig_26, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MPVI01000003 Pseudomonas aeruginosa strain CLB24405 contig_3, whole genome shotgun sequence 1 crisprs DEDDh 0 1 0 0

Results visualization

1. NZ_MPVI01000060
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 167354 : 207465 54 Pseudomonas_phage(76.92%) transposase,protease,capsid,terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_MPVI01000042
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4298 : 13244 11 uncultured_Caudovirales_phage(60.0%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MPVI01000094
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000094_1 4-210 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_MPVI01000020.1 192-225 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_MPVI01000020.1 81-114 2 0.941
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_MPVI01000020.1 10-53 0 1.0

1. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to position: 192-225, mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaggcgaa	Protospacer
*************.********************

2. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to position: 81-114, mismatch: 2, identity: 0.941

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaagcgaa	Protospacer
*************.**************.*****

3. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to position: 10-53, mismatch: 0, identity: 1.0

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctagccgacgccaaggcccacaccgatcagacggtggccaccg	Protospacer
********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17139-17172 0 1.0
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17044-17087 0 1.0
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17200-17243 0 1.0
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46849-46892 0 1.0
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47005-47048 0 1.0
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 16794-16827 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 16872-16905 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 35-68 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 113-146 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46920-46953 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47187-47220 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47265-47298 1 0.971
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 16983-17016 2 0.941
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46608-46641 2 0.941
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47076-47109 2 0.941
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46537-46580 2 0.955
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17824-17867 3 0.932
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46381-46424 3 0.932
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17512-17555 4 0.909
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 17668-17711 4 0.909
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 46693-46736 4 0.909
NZ_MPVI01000094_1 1.2|140|44|NZ_MPVI01000094|PILER-CR 140-183 44 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 48873-48916 4 0.909
NZ_MPVI01000094_1 1.1|55|34|NZ_MPVI01000094|PILER-CR 55-88 34 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 45381-45414 8 0.765

1. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcaactggtggacgccgaggcgaa	Protospacer
**********************************

2. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctagccgacgccaaggcccacaccgatcagacggtggccaccg	Protospacer
********************************************

3. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctagccgacgccaaggcccacaccgatcagacggtggccaccg	Protospacer
********************************************

4. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 0, identity: 1.0

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctagccgacgccaaggcccacaccgatcagacggtggccaccg	Protospacer
********************************************

5. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 0, identity: 1.0

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctagccgacgccaaggcccacaccgatcagacggtggccaccg	Protospacer
********************************************

6. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcaactggtggacgccgaagcgaa	Protospacer
****************************.*****

7. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaggcgaa	Protospacer
*************.********************

8. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaggcgaa	Protospacer
*************.********************

9. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcaactggtggacgccgaagcgaa	Protospacer
****************************.*****

10. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaggcgaa	Protospacer
*************.********************

11. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaggcgaa	Protospacer
*************.********************

12. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 1, identity: 0.971

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcaactggtggacgccgaagcgaa	Protospacer
****************************.*****

13. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 2, identity: 0.941

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaagcgaa	Protospacer
*************.**************.*****

14. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 2, identity: 0.941

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaagcgaa	Protospacer
*************.**************.*****

15. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 2, identity: 0.941

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
agcactcgcagcagctggtggacgccgaagcgaa	Protospacer
*************.**************.*****

16. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 2, identity: 0.955

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gctggccgacgccaaggcccacaccgatcagagggtggccaccg	Protospacer
***.**************************** ***********

17. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 3, identity: 0.932

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccgacgccaaggcccacaccgatcagagggtggccaccg	Protospacer
*.*.**************************** ***********

18. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 3, identity: 0.932

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccgacgccaaggcccacaccgatcagagggtggccaccg	Protospacer
*.*.**************************** ***********

19. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 4, identity: 0.909

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccggcgccaaggcccacaccgatcagagggtggccaccg	Protospacer
*.*.****.*********************** ***********

20. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 4, identity: 0.909

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccggcgccaaggcccacaccgatcagagggtggccaccg	Protospacer
*.*.****.*********************** ***********

21. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 4, identity: 0.909

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccgacgccaaggcccacaccgaccaggcggtggccaccg	Protospacer
*.*.***********************.***.************

22. spacer 1.2|140|44|NZ_MPVI01000094|PILER-CR matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 4, identity: 0.909

gctagccgacgccaaggcccacaccgatcagacggtggccaccg	CRISPR spacer
gttggccgacgccaaggcccacaccgaccaggcggtggccaccg	Protospacer
*.*.***********************.***.************

23. spacer 1.1|55|34|NZ_MPVI01000094|PILER-CR matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 8, identity: 0.765

agcactcgcagcaactggtggacgccgaggcgaa	CRISPR spacer
actacaccgggcagcgggtggacgccgaggcgaa	Protospacer
* .** *  .***.* ******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MPVI01000029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000029_1 12147-12260 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_MPVI01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MPVI01000009.1|WP_074202336.1|10569_11001_-|hypothetical-protein 10569_11001_- 143 aa aa AcrIC6 NA NZ_MPVI01000009.1_10345_10561_- No NA
NZ_MPVI01000009.1|WP_074202337.1|11049_11292_-|hypothetical-protein 11049_11292_- 80 aa aa AcrIC8 NA NZ_MPVI01000009.1_10345_10561_- No NA
NZ_MPVI01000009.1|WP_074202338.1|11453_11729_-|hypothetical-protein 11453_11729_- 91 aa aa NA NA NZ_MPVI01000009.1_10345_10561_- No NA
6. NZ_MPVI01000099
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73187 : 80848 10 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MPVI01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6279 11 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MPVI01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000006_1 11147-11292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MPVI01000006_1 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder 11190-11249 60 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 60451-60510 0 1.0
NZ_MPVI01000006_1 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder 11190-11249 60 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11548-11607 3 0.95
NZ_MPVI01000006_1 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder 11190-11249 60 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 11861-11920 3 0.95

1. spacer 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	CRISPR spacer
actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	Protospacer
************************************************************

2. spacer 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 3, identity: 0.95

actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	CRISPR spacer
gctgctcgccggccgtgccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	Protospacer
.**** **********.*******************************************

3. spacer 1.1|11190|60|NZ_MPVI01000006|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 3, identity: 0.95

actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	CRISPR spacer
gctgctcgccggccgtgccggacggatccaccgcaccaggtgctcggcgccgccggcgcc	Protospacer
.**** **********.*******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_MPVI01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000020_1 198-304 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MPVI01000020_1 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder 227-275 49 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 70-118 0 1.0
NZ_MPVI01000020_1 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder 227-275 49 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 16822-16870 0 1.0
NZ_MPVI01000020_1 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder 227-275 49 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 47222-47270 0 1.0

1. spacer 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

2. spacer 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

3. spacer 1.1|227|49|NZ_MPVI01000020|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 0, identity: 1.0

gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	CRISPR spacer
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct	Protospacer
*************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_MPVI01000109
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000109_1 7036-7843 Orphan I-F
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MPVI01000109_1 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7064-7095 32 NZ_MPVI01000064.1 79528-79559 0 1.0
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 NZ_MPVI01000140.1 30080-30111 0 1.0

1. spacer 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to position: 79528-79559, mismatch: 0, identity: 1.0

gcttgcgggttggcgtagagctcgcccatgac	CRISPR spacer
gcttgcgggttggcgtagagctcgcccatgac	Protospacer
********************************

2. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to position: 30080-30111, mismatch: 0, identity: 1.0

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacttgcgggttggccttca	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MPVI01000109_1 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7064-7095 32 KM389226 UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00002 genomic sequence 4670-4701 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510993 Pseudomonas phage BR201, partial genome 36974-37005 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510971 Pseudomonas phage CF79, partial genome 39079-39110 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510970 Pseudomonas phage CF67, partial genome 17581-17612 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510990 Pseudomonas phage BR133, partial genome 20863-20894 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510968 Pseudomonas phage CF55, partial genome 18930-18961 0 1.0
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510969 Pseudomonas phage CF60, partial genome 3751-3782 0 1.0
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 26563-26594 0 1.0
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KU310943 Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome 41862-41893 0 1.0
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NC_016762 Pseudomonas phage phi297, complete genome 14027-14058 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 9917-9948 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 32358-32389 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 KM389324 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000166 genomic sequence 10435-10466 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511012 Pseudomonas phage BR153, partial genome 29238-29269 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 16742-16773 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 17737-17768 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 KU310943 Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome 25076-25107 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NC_016762 Pseudomonas phage phi297, complete genome 30217-30248 0 1.0
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NC_030929 Pseudomonas phage JBD44, complete genome 14079-14110 0 1.0
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 MK034952 Pseudomonas phage Dobby, complete genome 21544-21575 0 1.0
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 15679-15710 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 9242-9273 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 MK511012 Pseudomonas phage BR153, partial genome 16043-16074 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 33421-33452 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 34458-34489 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 KM389322 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000164 genomic sequence 1436-1467 1 0.969
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NC_030929 Pseudomonas phage JBD44, complete genome 46385-46416 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511008 Pseudomonas phage CF124, partial genome 3057-3088 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511013 Pseudomonas phage BR161, partial genome 15762-15793 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511002 Pseudomonas phage CF57, partial genome 15661-15692 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511009 Pseudomonas phage CF136, partial genome 15617-15648 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511003 Pseudomonas phage CF65, partial genome 15648-15679 1 0.969
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 MK511005 Pseudomonas phage CF81, partial genome 15753-15784 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510989 Pseudomonas phage BR322, partial genome 37725-37756 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510966 Pseudomonas phage CF53, partial genome 37726-37757 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510981 Pseudomonas phage BR143, partial genome 37746-37777 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510967 Pseudomonas phage CF54, partial genome 11443-11474 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510991 Pseudomonas phage BR141, partial genome 37707-37738 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510980 Pseudomonas phage BR123, partial genome 37725-37756 1 0.969
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 MK510983 Pseudomonas phage BR178, partial genome 37726-37757 1 0.969
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 NC_003278 Pseudomonas phage phiCTX, complete genome 20774-20805 1 0.969
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 Y13918 Pseudomonas aeruginosa phage phi CTX DNA, complete genome 20774-20805 1 0.969
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 AB008550 Pseudomonas phage phiCTX DNA, complete genome 20774-20805 1 0.969
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 KM389402 UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00002 genomic sequence 833-864 1 0.969
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 MK510965 Pseudomonas phage CF34, partial genome 31551-31582 2 0.938
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP020084 Blastomonas fulva strain T2 plasmid unnamed, complete sequence 2360-2391 5 0.844
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP012701 Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence 144782-144813 6 0.812
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 296551-296582 6 0.812
NZ_MPVI01000109_1 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7604-7635 32 JX128258 Escherichia phage ECML-117, complete genome 44684-44715 6 0.812
NZ_MPVI01000109_1 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7064-7095 32 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 133281-133312 7 0.781
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 MN844877 Sphaerotilus phage vB_SnaP-R1, complete genome 32227-32258 7 0.781
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 505324-505355 7 0.781
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP044073 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence 28588-28619 7 0.781
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NC_011961 Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence 255090-255121 7 0.781
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 802071-802102 7 0.781
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 150306-150337 7 0.781
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_AP017899 Sphingopyxis sp. FD7 plasmid pSFD01, complete sequence 142753-142784 7 0.781
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 487407-487438 7 0.781
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4092024-4092055 7 0.781
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP009431 Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence 118480-118511 7 0.781
NZ_MPVI01000109_1 1.7|7424|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7424-7455 32 NZ_CP040762 Paracoccus sp. 2251 plasmid unnamed2, complete sequence 182931-182962 7 0.781
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1523247-1523278 7 0.781
NZ_MPVI01000109_1 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7544-7575 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1504695-1504726 7 0.781
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 514088-514119 8 0.75
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 24163-24194 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 355723-355754 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 806102-806133 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 473452-473483 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1638414-1638445 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 962070-962101 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 814137-814168 8 0.75
NZ_MPVI01000109_1 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7364-7395 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1170305-1170336 8 0.75
NZ_MPVI01000109_1 1.12|7724|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7724-7755 32 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 37848-37879 8 0.75
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 26876-26907 9 0.719
NZ_MPVI01000109_1 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7124-7155 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 112092-112123 9 0.719
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 49130-49161 9 0.719
NZ_MPVI01000109_1 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7184-7215 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 415146-415177 9 0.719
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 455554-455585 9 0.719
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 288932-288963 9 0.719
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 4955-4986 9 0.719
NZ_MPVI01000109_1 1.7|7424|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7424-7455 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 2072647-2072678 9 0.719
NZ_MPVI01000109_1 1.11|7664|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7664-7695 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 277357-277388 9 0.719
NZ_MPVI01000109_1 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7064-7095 32 NC_015065 Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence 30983-31014 10 0.688
NZ_MPVI01000109_1 1.11|7664|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7664-7695 32 NZ_LR134444 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence 19641-19672 10 0.688
NZ_MPVI01000109_1 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT 7244-7275 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 308973-309004 19 0.406

1. spacer 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389226 (UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00002 genomic sequence) position: , mismatch: 0, identity: 1.0

gcttgcgggttggcgtagagctcgcccatgac	CRISPR spacer
gcttgcgggttggcgtagagctcgcccatgac	Protospacer
********************************

2. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510993 (Pseudomonas phage BR201, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

3. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

4. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

5. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

6. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510968 (Pseudomonas phage CF55, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

7. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 0, identity: 1.0

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctccacgcgcaggggtacaca	Protospacer
********************************

8. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 0, identity: 1.0

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgttcgagttcgaagacct	Protospacer
********************************

9. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KU310943 (Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome) position: , mismatch: 0, identity: 1.0

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgttcgagttcgaagacct	Protospacer
********************************

10. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_016762 (Pseudomonas phage phi297, complete genome) position: , mismatch: 0, identity: 1.0

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgttcgagttcgaagacct	Protospacer
********************************

11. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

12. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

13. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389324 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000166 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

14. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

15. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

16. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

17. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KU310943 (Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

18. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_016762 (Pseudomonas phage phi297, complete genome) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

19. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 0, identity: 1.0

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccggagcccaggttgaccttgat	Protospacer
********************************

20. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK034952 (Pseudomonas phage Dobby, complete genome) position: , mismatch: 0, identity: 1.0

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacttgcgggttggccttca	Protospacer
********************************

21. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

22. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

23. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagcttttcgagttcgaagacct	Protospacer
************** *****************

24. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

25. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

26. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389322 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000164 genomic sequence) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

27. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 1, identity: 0.969

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtttgagttcgaagacct	Protospacer
*****************.**************

28. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511008 (Pseudomonas phage CF124, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

29. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511013 (Pseudomonas phage BR161, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

30. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

31. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511009 (Pseudomonas phage CF136, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

32. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

33. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 1, identity: 0.969

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccagcgccggagcccaggttgaccttgat	Protospacer
*****.**************************

34. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510989 (Pseudomonas phage BR322, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

35. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510966 (Pseudomonas phage CF53, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

36. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510981 (Pseudomonas phage BR143, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

37. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510967 (Pseudomonas phage CF54, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

38. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510991 (Pseudomonas phage BR141, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

39. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510980 (Pseudomonas phage BR123, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

40. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510983 (Pseudomonas phage BR178, partial genome) position: , mismatch: 1, identity: 0.969

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgaggtcttgccggtccgccacgaacct	Protospacer
************* ******************

41. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_003278 (Pseudomonas phage phiCTX, complete genome) position: , mismatch: 1, identity: 0.969

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacctgcgggttggccttca	Protospacer
***************.****************

42. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to Y13918 (Pseudomonas aeruginosa phage phi CTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacctgcgggttggccttca	Protospacer
***************.****************

43. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to AB008550 (Pseudomonas phage phiCTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacctgcgggttggccttca	Protospacer
***************.****************

44. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to KM389402 (UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00002 genomic sequence) position: , mismatch: 1, identity: 0.969

gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
gatgcccttgctgacctgcgggttggccttca	Protospacer
***************.****************

45. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MK510965 (Pseudomonas phage CF34, partial genome) position: , mismatch: 2, identity: 0.938

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
gtcgccccgcgctcaatgcgcaggggtacaca	Protospacer
************** *.***************

46. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020084 (Blastomonas fulva strain T2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tcccggtggcggtgtagacgatctggtcgatc	Protospacer
** ** *********************.*..*

47. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012701 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tgccggtggcggtgtagacgatctggtcgatc	Protospacer
*  ** *********************.*..*

48. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

tcacgttg-gcggtgtagacgatctggttggcc	CRISPR spacer
-caagtggtgcggtgtagatgatctggctggcg	Protospacer
 ** ** * **********.*******.**** 

49. spacer 1.10|7604|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to JX128258 (Escherichia phage ECML-117, complete genome) position: , mismatch: 6, identity: 0.812

-gatgcccttgctgacttgcgggttggccttca	CRISPR spacer
agatgtgc-cgctgccttgcgggttgtccttca	Protospacer
 ****. * .**** *********** ******

50. spacer 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.781

gcttgcgggttggcgtagagctcgcccatgac	CRISPR spacer
gtcttcgggtcggcgtagagctcggccagggc	Protospacer
*..* *****.************* *** *.*

51. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to MN844877 (Sphaerotilus phage vB_SnaP-R1, complete genome) position: , mismatch: 7, identity: 0.781

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
ctgcgcaccaagcagttcgagtacgaagacct	Protospacer
* *. *.* **** ******** *********

52. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
gcgccgccgccgaagcccaggttgaccaggtc	Protospacer
 ***** *****.**************  * .

53. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccgccgccagagcccaggttgaagccggt	Protospacer
****** ****.*************  ..*.*

54. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccggcgccggagcccaggttgaccttgat---	CRISPR spacer
ccgccggagcgggagcccaggtt---ccggatggg	Protospacer
******* ** ************   *. ***   

55. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
cccatgtcgccggcgccctggttgaccttggt	Protospacer
**  .* ****** **** ***********.*

56. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tgccggtcgcggtgtagacgatctggtcgatc	Protospacer
*  ** * *******************.*..*

57. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017899 (Sphingopyxis sp. FD7 plasmid pSFD01, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tgccggtcgcggtgtagacgatctggtcgatc	Protospacer
*  ** * *******************.*..*

58. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
ttggggtggcggtgtaggcgagctggttgggc	Protospacer
*.. * ***********.*** ******** *

59. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tcacgatggcggtgtcgacgatctcccagggc	Protospacer
***** ********* ********  . ** *

60. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009431 (Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
tgccggtcgcggtgtagacgatctggtcgatc	Protospacer
*  ** * *******************.*..*

61. spacer 1.7|7424|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

---atcgaacgcacggcctggaccatcttggtggt	CRISPR spacer
gggatc---ctgacggcctggaccatcgcggtggt	Protospacer
   ***   *  *************** .******

62. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgacgtctttcccgtccgctcggaagca	Protospacer
******* ******** ******.  *** * 

63. spacer 1.9|7544|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

cggttgaggtctttccggtccgccacgaacct	CRISPR spacer
cggttgacgtctttcccgtccgctcggaagca	Protospacer
******* ******** ******.  *** * 

64. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.75

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
cagttcgcgaagctgtgcgaggtcttcggacg	Protospacer
**************** **** **   *. * 

65. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
ctgttcgcgacgctgttcgtgttcgccggttt	Protospacer
* ******** ******** *****  *...*

66. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgtggttggcgatgtagacgatctggtcgtcg	Protospacer
.   *******.***************.* * 

67. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

68. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

69. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

70. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

71. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

72. spacer 1.6|7364|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacgttggcggtgtagacgatctggttggcc	CRISPR spacer
cgatgccggcggcgtagacgatctcgttggcg	Protospacer
. *.*..*****.*********** ****** 

73. spacer 1.12|7724|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaagagaacgcctttcaaggcaatgcgtgcct	CRISPR spacer
gcggagaacgtctttcaaggcaatgggtatac	Protospacer
* .*******.************** **.. .

74. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgccccgcgctccacgcgcag-----gggtacaca	CRISPR spacer
tgcgcgccgcgctccaggcgcagggcccgggt-----	Protospacer
  *** ********** ******     ****     

75. spacer 1.2|7124|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgccccgcgctccacgcgcaggggtacaca	CRISPR spacer
acctcgccgcgctccacgcgcagcggcaccgc	Protospacer
..* * ***************** **.**   

76. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
gcgggcccgaagctgttcgggttcgaggacta	Protospacer
  *  * ************.******.***. 

77. spacer 1.3|7184|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcgcgaagctgttcgagttcgaagacct	CRISPR spacer
gcgttcgcgaagctggtcgcgttcggtcacga	Protospacer
  ************* *** *****.  **  

78. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ccgccggcgccgaagcccaggatggagcgcac	Protospacer
************.******** **.  .  *.

79. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
tcgccggcgccggcgccaaggttgcagccgag	Protospacer
.************ *** ******   ..** 

80. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccggcgccggagcccaggttga--ccttgat	CRISPR spacer
tggccggcgccgcagcccaggtcgaggacccg--	Protospacer
. ********** *********.**   *..*  

81. spacer 1.7|7424|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719

atcgaac--gcacggcctggaccatcttggtggt	CRISPR spacer
--tgggccagcacggcctcgaccatctgggtgcc	Protospacer
  .*..*  ********* ******** **** .

82. spacer 1.11|7664|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719

gtattggagccggaggacggggcatgatcata	CRISPR spacer
gcgctggggcgggaggacggggcatgagcgcc	Protospacer
*...***.** **************** *.. 

83. spacer 1.1|7064|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 10, identity: 0.688

gcttgcgggttggcgtagagctcgcccatgac	CRISPR spacer
ttaagcggggtggtgtagagctcgcccttctg	Protospacer
 .  ***** ***.************* *   

84. spacer 1.11|7664|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134444 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

gtattggagccggaggacggggcatgatcata	CRISPR spacer
tcgccgcagccggcggccggggcatgatcacg	Protospacer
 ....* ****** ** *************..

85. spacer 1.4|7244|32|NZ_MPVI01000109|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 19, identity: 0.406

----------------ccgccggcgccggagcccaggttgaccttgat	CRISPR spacer
ttcggctgcaaccttggcgccggcgccggcga----------------	Protospacer
                 ************ *                 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_MPVI01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 461 : 17628 30 Pseudomonas_phage(70.37%) integrase attL 4440:4455|attR 19590:19605
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_MPVI01000148
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44263 : 82726 33 Agrobacterium_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_MPVI01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2441 : 8627 9 Powai_lake_megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_MPVI01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MPVI01000011.1|WP_044069671.1|686_926_-|anti-CRISPR-protein 686_926_- 79 aa aa AcrIF5 NA NA No NA
NZ_MPVI01000011.1|WP_048909912.1|938_1352_-|anti-CRISPR-protein-AcrF3 938_1352_- 137 aa aa AcrIF3 NA NA No NA
NZ_MPVI01000011.1|WP_023131919.1|1374_1677_-|anti-CRISPR-protein-AcrE1 1374_1677_- 100 aa aa AcrIE1 NA NA No NA
15. NZ_MPVI01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155 : 29904 41 Pseudomonas_phage(78.95%) portal,head,tail,capsid,terminase,protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_MPVI01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79 : 36649 43 uncultured_Caudovirales_phage(25.0%) tail,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_MPVI01000113
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MPVI01000113.1|WP_003158159.1|74558_74882_-|hypothetical-protein 74558_74882_- 107 aa aa AcrIE1 NA NA No NA
NZ_MPVI01000113.1|WP_003158160.1|74900_75293_-|hypothetical-protein 74900_75293_- 130 aa aa AcrIF3 NA NA No NA
NZ_MPVI01000113.1|WP_003158163.1|77034_77409_-|hypothetical-protein 77034_77409_- 124 aa aa AcrIF12 NA NA No NA
18. NZ_MPVI01000064
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51966 : 95437 65 Pseudomonas_phage(85.71%) capsid,tRNA,head,integrase,protease,portal,holin,tail,terminase attL 45938:45953|attR 78789:78804
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MPVI01000064.1|WP_123823009.1|63457_63886_-|hypothetical-protein 63457_63886_- 142 aa aa NA CsgD NA 51966-95437 yes
19. NZ_MPVI01000090
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2885 : 44673 29 Salmonella_phage(42.86%) transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_MPVI01000140
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8403 : 48100 48 Pseudomonas_virus(77.5%) integrase,tail,head,capsid,lysis,portal,terminase,plate,holin attL 13130:13175|attR 49852:49897
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_MPVI01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10638 : 19667 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_MPVI01000106
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10748 : 17642 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
DBSCAN-SWA_2 74718 : 128094 66 Pseudomonas_phage(60.78%) tail,integrase,holin,terminase attL 65963:65980|attR 125038:125055
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_MPVI01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MPVI01000003_1 41516-41618 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MPVI01000003_1 1.1|41542|51|NZ_MPVI01000003|CRISPRCasFinder 41542-41592 51 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63841 0 1.0

1. spacer 1.1|41542|51|NZ_MPVI01000003|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga	CRISPR spacer
aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga	Protospacer
***************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage