| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_MPVI01000151 | Pseudomonas aeruginosa strain CLB24405 contig_151, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000114 | Pseudomonas aeruginosa strain CLB24405 contig_114, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000106 | Pseudomonas aeruginosa strain CLB24405 contig_106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_MPVI01000082 | Pseudomonas aeruginosa strain CLB24405 contig_82, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000002 | Pseudomonas aeruginosa strain CLB24405 contig_2, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000104 | Pseudomonas aeruginosa strain CLB24405 contig_104, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000047 | Pseudomonas aeruginosa strain CLB24405 contig_47, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000154 | Pseudomonas aeruginosa strain CLB24405 contig_154, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000119 | Pseudomonas aeruginosa strain CLB24405 contig_119, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000102 | Pseudomonas aeruginosa strain CLB24405 contig_102, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000050 | Pseudomonas aeruginosa strain CLB24405 contig_50, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000019 | Pseudomonas aeruginosa strain CLB24405 contig_19, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000086 | Pseudomonas aeruginosa strain CLB24405 contig_86, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000077 | Pseudomonas aeruginosa strain CLB24405 contig_77, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000141 | Pseudomonas aeruginosa strain CLB24405 contig_141, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000023 | Pseudomonas aeruginosa strain CLB24405 contig_23, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000017 | Pseudomonas aeruginosa strain CLB24405 contig_17, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000022 | Pseudomonas aeruginosa strain CLB24405 contig_22, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000137 | Pseudomonas aeruginosa strain CLB24405 contig_137, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000033 | Pseudomonas aeruginosa strain CLB24405 contig_33, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000045 | Pseudomonas aeruginosa strain CLB24405 contig_45, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000066 | Pseudomonas aeruginosa strain CLB24405 contig_66, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000138 | Pseudomonas aeruginosa strain CLB24405 contig_138, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000146 | Pseudomonas aeruginosa strain CLB24405 contig_146, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000131 | Pseudomonas aeruginosa strain CLB24405 contig_131, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000087 | Pseudomonas aeruginosa strain CLB24405 contig_87, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000052 | Pseudomonas aeruginosa strain CLB24405 contig_52, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000107 | Pseudomonas aeruginosa strain CLB24405 contig_107, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000060 | Pseudomonas aeruginosa strain CLB24405 contig_60, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000005 | Pseudomonas aeruginosa strain CLB24405 contig_5, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000084 | Pseudomonas aeruginosa strain CLB24405 contig_84, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000126 | Pseudomonas aeruginosa strain CLB24405 contig_126, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000088 | Pseudomonas aeruginosa strain CLB24405 contig_88, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000135 | Pseudomonas aeruginosa strain CLB24405 contig_135, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000013 | Pseudomonas aeruginosa strain CLB24405 contig_13, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000125 | Pseudomonas aeruginosa strain CLB24405 contig_125, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000073 | Pseudomonas aeruginosa strain CLB24405 contig_73, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000134 | Pseudomonas aeruginosa strain CLB24405 contig_134, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000080 | Pseudomonas aeruginosa strain CLB24405 contig_80, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000044 | Pseudomonas aeruginosa strain CLB24405 contig_44, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000020 | Pseudomonas aeruginosa strain CLB24405 contig_20, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 0 | 0 | |
| NZ_MPVI01000099 | Pseudomonas aeruginosa strain CLB24405 contig_99, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000127 | Pseudomonas aeruginosa strain CLB24405 contig_127, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000120 | Pseudomonas aeruginosa strain CLB24405 contig_120, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000149 | Pseudomonas aeruginosa strain CLB24405 contig_149, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000113 | Pseudomonas aeruginosa strain CLB24405 contig_113, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 3 | |
| NZ_MPVI01000041 | Pseudomonas aeruginosa strain CLB24405 contig_41, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000038 | Pseudomonas aeruginosa strain CLB24405 contig_38, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000070 | Pseudomonas aeruginosa strain CLB24405 contig_70, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000148 | Pseudomonas aeruginosa strain CLB24405 contig_148, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000132 | Pseudomonas aeruginosa strain CLB24405 contig_132, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000115 | Pseudomonas aeruginosa strain CLB24405 contig_115, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000112 | Pseudomonas aeruginosa strain CLB24405 contig_112, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000076 | Pseudomonas aeruginosa strain CLB24405 contig_76, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000062 | Pseudomonas aeruginosa strain CLB24405 contig_62, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000118 | Pseudomonas aeruginosa strain CLB24405 contig_118, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000074 | Pseudomonas aeruginosa strain CLB24405 contig_74, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000035 | Pseudomonas aeruginosa strain CLB24405 contig_35, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000014 | Pseudomonas aeruginosa strain CLB24405 contig_14, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000089 | Pseudomonas aeruginosa strain CLB24405 contig_89, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000152 | Pseudomonas aeruginosa strain CLB24405 contig_152, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000147 | Pseudomonas aeruginosa strain CLB24405 contig_147, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000028 | Pseudomonas aeruginosa strain CLB24405 contig_28, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000130 | Pseudomonas aeruginosa strain CLB24405 contig_130, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000101 | Pseudomonas aeruginosa strain CLB24405 contig_101, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000046 | Pseudomonas aeruginosa strain CLB24405 contig_46, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000031 | Pseudomonas aeruginosa strain CLB24405 contig_31, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000054 | Pseudomonas aeruginosa strain CLB24405 contig_54, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000029 | Pseudomonas aeruginosa strain CLB24405 contig_29, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000003 | Pseudomonas aeruginosa strain CLB24405 contig_3, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 0 | 0 | |
| NZ_MPVI01000122 | Pseudomonas aeruginosa strain CLB24405 contig_122, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000001 | Pseudomonas aeruginosa strain CLB24405 contig_1, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000150 | Pseudomonas aeruginosa strain CLB24405 contig_150, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000111 | Pseudomonas aeruginosa strain CLB24405 contig_111, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000065 | Pseudomonas aeruginosa strain CLB24405 contig_65, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000025 | Pseudomonas aeruginosa strain CLB24405 contig_25, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000144 | Pseudomonas aeruginosa strain CLB24405 contig_144, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000024 | Pseudomonas aeruginosa strain CLB24405 contig_24, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000155 | Pseudomonas aeruginosa strain CLB24405 contig_155, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000058 | Pseudomonas aeruginosa strain CLB24405 contig_58, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000036 | Pseudomonas aeruginosa strain CLB24405 contig_36, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000067 | Pseudomonas aeruginosa strain CLB24405 contig_67, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000075 | Pseudomonas aeruginosa strain CLB24405 contig_75, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000105 | Pseudomonas aeruginosa strain CLB24405 contig_105, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000039 | Pseudomonas aeruginosa strain CLB24405 contig_39, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000095 | Pseudomonas aeruginosa strain CLB24405 contig_95, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000015 | Pseudomonas aeruginosa strain CLB24405 contig_15, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000012 | Pseudomonas aeruginosa strain CLB24405 contig_12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000136 | Pseudomonas aeruginosa strain CLB24405 contig_136, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000049 | Pseudomonas aeruginosa strain CLB24405 contig_49, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000116 | Pseudomonas aeruginosa strain CLB24405 contig_116, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000128 | Pseudomonas aeruginosa strain CLB24405 contig_128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000124 | Pseudomonas aeruginosa strain CLB24405 contig_124, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000034 | Pseudomonas aeruginosa strain CLB24405 contig_34, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000109 | Pseudomonas aeruginosa strain CLB24405 contig_109, whole genome shotgun sequence | 1 crisprs | 2 | 10 | 0 | 0 | |
| NZ_MPVI01000021 | Pseudomonas aeruginosa strain CLB24405 contig_21, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000091 | Pseudomonas aeruginosa strain CLB24405 contig_91, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000009 | Pseudomonas aeruginosa strain CLB24405 contig_9, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 3 | |
| NZ_MPVI01000071 | Pseudomonas aeruginosa strain CLB24405 contig_71, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000004 | Pseudomonas aeruginosa strain CLB24405 contig_4, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000055 | Pseudomonas aeruginosa strain CLB24405 contig_55, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000121 | Pseudomonas aeruginosa strain CLB24405 contig_121, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000006 | Pseudomonas aeruginosa strain CLB24405 contig_6, whole genome shotgun sequence | 1 crisprs | 0 | 1 | 0 | 0 | |
| NZ_MPVI01000042 | Pseudomonas aeruginosa strain CLB24405 contig_42, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000133 | Pseudomonas aeruginosa strain CLB24405 contig_133, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000085 | Pseudomonas aeruginosa strain CLB24405 contig_85, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000097 | Pseudomonas aeruginosa strain CLB24405 contig_97, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000090 | Pseudomonas aeruginosa strain CLB24405 contig_90, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000096 | Pseudomonas aeruginosa strain CLB24405 contig_96, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000083 | Pseudomonas aeruginosa strain CLB24405 contig_83, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000110 | Pseudomonas aeruginosa strain CLB24405 contig_110, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000007 | Pseudomonas aeruginosa strain CLB24405 contig_7, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000103 | Pseudomonas aeruginosa strain CLB24405 contig_103, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000063 | Pseudomonas aeruginosa strain CLB24405 contig_63, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000100 | Pseudomonas aeruginosa strain CLB24405 contig_100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000027 | Pseudomonas aeruginosa strain CLB24405 contig_27, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000048 | Pseudomonas aeruginosa strain CLB24405 contig_48, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000078 | Pseudomonas aeruginosa strain CLB24405 contig_78, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000068 | Pseudomonas aeruginosa strain CLB24405 contig_68, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000094 | Pseudomonas aeruginosa strain CLB24405 contig_94, whole genome shotgun sequence | 1 crisprs | 2 | 2 | 0 | 0 | |
| NZ_MPVI01000123 | Pseudomonas aeruginosa strain CLB24405 contig_123, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000043 | Pseudomonas aeruginosa strain CLB24405 contig_43, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000053 | Pseudomonas aeruginosa strain CLB24405 contig_53, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000059 | Pseudomonas aeruginosa strain CLB24405 contig_59, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000016 | Pseudomonas aeruginosa strain CLB24405 contig_16, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000129 | Pseudomonas aeruginosa strain CLB24405 contig_129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000010 | Pseudomonas aeruginosa strain CLB24405 contig_10, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000018 | Pseudomonas aeruginosa strain CLB24405 contig_18, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000026 | Pseudomonas aeruginosa strain CLB24405 contig_26, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000032 | Pseudomonas aeruginosa strain CLB24405 contig_32, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000079 | Pseudomonas aeruginosa strain CLB24405 contig_79, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000093 | Pseudomonas aeruginosa strain CLB24405 contig_93, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000030 | Pseudomonas aeruginosa strain CLB24405 contig_30, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000061 | Pseudomonas aeruginosa strain CLB24405 contig_61, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000008 | Pseudomonas aeruginosa strain CLB24405 contig_8, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000098 | Pseudomonas aeruginosa strain CLB24405 contig_98, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000145 | Pseudomonas aeruginosa strain CLB24405 contig_145, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000143 | Pseudomonas aeruginosa strain CLB24405 contig_143, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000011 | Pseudomonas aeruginosa strain CLB24405 contig_11, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 3 | |
| NZ_MPVI01000051 | Pseudomonas aeruginosa strain CLB24405 contig_51, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000117 | Pseudomonas aeruginosa strain CLB24405 contig_117, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000057 | Pseudomonas aeruginosa strain CLB24405 contig_57, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000072 | Pseudomonas aeruginosa strain CLB24405 contig_72, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000139 | Pseudomonas aeruginosa strain CLB24405 contig_139, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000040 | Pseudomonas aeruginosa strain CLB24405 contig_40, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000081 | Pseudomonas aeruginosa strain CLB24405 contig_81, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000037 | Pseudomonas aeruginosa strain CLB24405 contig_37, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000142 | Pseudomonas aeruginosa strain CLB24405 contig_142, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000140 | Pseudomonas aeruginosa strain CLB24405 contig_140, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_MPVI01000064 | Pseudomonas aeruginosa strain CLB24405 contig_64, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 1 | |
| NZ_MPVI01000069 | Pseudomonas aeruginosa strain CLB24405 contig_69, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000108 | Pseudomonas aeruginosa strain CLB24405 contig_108, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000092 | Pseudomonas aeruginosa strain CLB24405 contig_92, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000153 | Pseudomonas aeruginosa strain CLB24405 contig_153, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_MPVI01000056 | Pseudomonas aeruginosa strain CLB24405 contig_56, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 107 aa aa | AcrIE1 | NA | NA | No | NA |
| 130 aa aa | AcrIF3 | NA | NA | No | NA |
| 124 aa aa | AcrIF12 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 10748 : 17642 | 9 | uncultured_Caudovirales_phage(85.71%) | NA | ||
| DBSCAN-SWA_2 | 74718 : 128094 | 66 | Pseudomonas_phage(60.78%) | attL 65963:65980|attR 125038:125055 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 461 : 17628 | 30 | Pseudomonas_phage(70.37%) | attL 4440:4455|attR 19590:19605 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 167354 : 207465 | 54 | Pseudomonas_phage(76.92%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 44263 : 82726 | 33 | Agrobacterium_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 2441 : 8627 | 9 | Powai_lake_megavirus(16.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 10638 : 19667 | 8 | Bacillus_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_MPVI01000006_1 | 11190-11249 | 60 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 60451-60510 | 0 | 1.0 | |
| NZ_MPVI01000006_1 | 11190-11249 | 60 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11548-11607 | 3 | 0.95 | |
| NZ_MPVI01000006_1 | 11190-11249 | 60 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 11861-11920 | 3 | 0.95 |
actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc CRISPR spacer actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc Protospacer ************************************************************
actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc CRISPR spacer gctgctcgccggccgtgccggacggatccaccgcaccaggtgctcggcgccgccggcgcc Protospacer .**** **********.*******************************************
actgcgcgccggccgtaccggacggatccaccgcaccaggtgctcggcgccgccggcgcc CRISPR spacer gctgctcgccggccgtgccggacggatccaccgcaccaggtgctcggcgccgccggcgcc Protospacer .**** **********.*******************************************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 8403 : 48100 | 48 | Pseudomonas_virus(77.5%) | attL 13130:13175|attR 49852:49897 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4298 : 13244 | 11 | uncultured_Caudovirales_phage(60.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 6279 | 11 | Pseudomonas_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 79 aa aa | AcrIF5 | NA | NA | No | NA |
| 137 aa aa | AcrIF3 | NA | NA | No | NA |
| 100 aa aa | AcrIE1 | NA | NA | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 143 aa aa | AcrIC6 | NA | NZ_MPVI01000009.1_10345_10561_- | No | NA |
| 80 aa aa | AcrIC8 | NA | NZ_MPVI01000009.1_10345_10561_- | No | NA |
| 91 aa aa | NA | NA | NZ_MPVI01000009.1_10345_10561_- | No | NA |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_MPVI01000109_1 | 7036-7843 | Orphan |
I-F
|
13 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_MPVI01000109_1 | 7064-7095 | 32 | NZ_MPVI01000064.1 | 79528-79559 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | NZ_MPVI01000140.1 | 30080-30111 | 0 | 1.0 |
gcttgcgggttggcgtagagctcgcccatgac CRISPR spacer gcttgcgggttggcgtagagctcgcccatgac Protospacer ********************************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacttgcgggttggccttca Protospacer ********************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_MPVI01000109_1 | 7064-7095 | 32 | KM389226 | UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00002 genomic sequence | 4670-4701 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510993 | Pseudomonas phage BR201, partial genome | 36974-37005 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510971 | Pseudomonas phage CF79, partial genome | 39079-39110 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510970 | Pseudomonas phage CF67, partial genome | 17581-17612 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510990 | Pseudomonas phage BR133, partial genome | 20863-20894 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510968 | Pseudomonas phage CF55, partial genome | 18930-18961 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510969 | Pseudomonas phage CF60, partial genome | 3751-3782 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | JX403939 | Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome | 26563-26594 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KU310943 | Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome | 41862-41893 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NC_016762 | Pseudomonas phage phi297, complete genome | 14027-14058 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | JX403939 | Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome | 9917-9948 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | KM389212 | UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence | 32358-32389 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | KM389324 | UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000166 genomic sequence | 10435-10466 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511012 | Pseudomonas phage BR153, partial genome | 29238-29269 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | KM389210 | UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence | 16742-16773 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | KM389463 | UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence | 17737-17768 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | KU310943 | Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome | 25076-25107 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NC_016762 | Pseudomonas phage phi297, complete genome | 30217-30248 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NC_030929 | Pseudomonas phage JBD44, complete genome | 14079-14110 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | MK034952 | Pseudomonas phage Dobby, complete genome | 21544-21575 | 0 | 1.0 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KM389212 | UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence | 15679-15710 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KM389229 | UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence | 9242-9273 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | MK511012 | Pseudomonas phage BR153, partial genome | 16043-16074 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KM389210 | UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence | 33421-33452 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KM389463 | UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence | 34458-34489 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | KM389322 | UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000164 genomic sequence | 1436-1467 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NC_030929 | Pseudomonas phage JBD44, complete genome | 46385-46416 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511008 | Pseudomonas phage CF124, partial genome | 3057-3088 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511013 | Pseudomonas phage BR161, partial genome | 15762-15793 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511002 | Pseudomonas phage CF57, partial genome | 15661-15692 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511009 | Pseudomonas phage CF136, partial genome | 15617-15648 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511003 | Pseudomonas phage CF65, partial genome | 15648-15679 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | MK511005 | Pseudomonas phage CF81, partial genome | 15753-15784 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510989 | Pseudomonas phage BR322, partial genome | 37725-37756 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510966 | Pseudomonas phage CF53, partial genome | 37726-37757 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510981 | Pseudomonas phage BR143, partial genome | 37746-37777 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510967 | Pseudomonas phage CF54, partial genome | 11443-11474 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510991 | Pseudomonas phage BR141, partial genome | 37707-37738 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510980 | Pseudomonas phage BR123, partial genome | 37725-37756 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | MK510983 | Pseudomonas phage BR178, partial genome | 37726-37757 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | NC_003278 | Pseudomonas phage phiCTX, complete genome | 20774-20805 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | Y13918 | Pseudomonas aeruginosa phage phi CTX DNA, complete genome | 20774-20805 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | AB008550 | Pseudomonas phage phiCTX DNA, complete genome | 20774-20805 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | KM389402 | UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00002 genomic sequence | 833-864 | 1 | 0.969 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | MK510965 | Pseudomonas phage CF34, partial genome | 31551-31582 | 2 | 0.938 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP020084 | Blastomonas fulva strain T2 plasmid unnamed, complete sequence | 2360-2391 | 5 | 0.844 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP012701 | Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence | 144782-144813 | 6 | 0.812 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP016618 | Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence | 296551-296582 | 6 | 0.812 | |
| NZ_MPVI01000109_1 | 7604-7635 | 32 | JX128258 | Escherichia phage ECML-117, complete genome | 44684-44715 | 6 | 0.812 | |
| NZ_MPVI01000109_1 | 7064-7095 | 32 | NZ_CP029358 | Azospirillum sp. CFH 70021 plasmid unnamed3 | 133281-133312 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | MN844877 | Sphaerotilus phage vB_SnaP-R1, complete genome | 32227-32258 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP016083 | Streptomyces sp. SAT1 plasmid unnamed3, complete sequence | 505324-505355 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP044073 | Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence | 28588-28619 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NC_011961 | Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence | 255090-255121 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP023000 | Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence | 802071-802102 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP016462 | Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence | 150306-150337 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_AP017899 | Sphingopyxis sp. FD7 plasmid pSFD01, complete sequence | 142753-142784 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP020040 | Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence | 487407-487438 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_AP022593 | Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence | 4092024-4092055 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP009431 | Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence | 118480-118511 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7424-7455 | 32 | NZ_CP040762 | Paracoccus sp. 2251 plasmid unnamed2, complete sequence | 182931-182962 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | NZ_CP029452 | Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence | 1523247-1523278 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7544-7575 | 32 | NZ_CP023071 | Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence | 1504695-1504726 | 7 | 0.781 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NZ_LR594668 | Variovorax sp. SRS16 plasmid 3 | 514088-514119 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NC_020548 | Azoarcus sp. KH32C plasmid pAZKH, complete sequence | 24163-24194 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP015203 | Rhodococcus sp. 008 plasmid pR8L1, complete sequence | 355723-355754 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP032322 | Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence | 806102-806133 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP022367 | Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence | 473452-473483 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP007794 | Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence | 1638414-1638445 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP032340 | Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence | 962070-962101 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP032346 | Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence | 814137-814168 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7364-7395 | 32 | NZ_CP012915 | Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence | 1170305-1170336 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7724-7755 | 32 | NZ_CP022118 | Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence | 37848-37879 | 8 | 0.75 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | NZ_CP026306 | Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence | 26876-26907 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7124-7155 | 32 | NZ_CP010410 | Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence | 112092-112123 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NZ_CP032325 | Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence | 49130-49161 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7184-7215 | 32 | NZ_CP017563 | Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence | 415146-415177 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP029830 | Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence | 455554-455585 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP015882 | Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence | 288932-288963 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP042268 | Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence | 4955-4986 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7424-7455 | 32 | NZ_CP016452 | Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence | 2072647-2072678 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7664-7695 | 32 | NZ_CP040819 | Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence | 277357-277388 | 9 | 0.719 | |
| NZ_MPVI01000109_1 | 7064-7095 | 32 | NC_015065 | Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence | 30983-31014 | 10 | 0.688 | |
| NZ_MPVI01000109_1 | 7664-7695 | 32 | NZ_LR134444 | Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence | 19641-19672 | 10 | 0.688 | |
| NZ_MPVI01000109_1 | 7244-7275 | 32 | NZ_CP030264 | Ensifer adhaerens strain Corn53 plasmid AB, complete sequence | 308973-309004 | 19 | 0.406 |
gcttgcgggttggcgtagagctcgcccatgac CRISPR spacer gcttgcgggttggcgtagagctcgcccatgac Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctccacgcgcaggggtacaca Protospacer ********************************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgttcgagttcgaagacct Protospacer ********************************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgttcgagttcgaagacct Protospacer ********************************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgttcgagttcgaagacct Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccggagcccaggttgaccttgat Protospacer ********************************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacttgcgggttggccttca Protospacer ********************************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagcttttcgagttcgaagacct Protospacer ************** *****************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtttgagttcgaagacct Protospacer *****************.**************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccagcgccggagcccaggttgaccttgat Protospacer *****.**************************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgaggtcttgccggtccgccacgaacct Protospacer ************* ******************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacctgcgggttggccttca Protospacer ***************.****************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacctgcgggttggccttca Protospacer ***************.****************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacctgcgggttggccttca Protospacer ***************.****************
gatgcccttgctgacttgcgggttggccttca CRISPR spacer gatgcccttgctgacctgcgggttggccttca Protospacer ***************.****************
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer gtcgccccgcgctcaatgcgcaggggtacaca Protospacer ************** *.***************
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tcccggtggcggtgtagacgatctggtcgatc Protospacer ** ** *********************.*..*
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tgccggtggcggtgtagacgatctggtcgatc Protospacer * ** *********************.*..*
tcacgttg-gcggtgtagacgatctggttggcc CRISPR spacer -caagtggtgcggtgtagatgatctggctggcg Protospacer ** ** * **********.*******.****
-gatgcccttgctgacttgcgggttggccttca CRISPR spacer agatgtgc-cgctgccttgcgggttgtccttca Protospacer ****. * .**** *********** ******
gcttgcgggttggcgtagagctcgcccatgac CRISPR spacer gtcttcgggtcggcgtagagctcggccagggc Protospacer *..* *****.************* *** *.*
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer ctgcgcaccaagcagttcgagtacgaagacct Protospacer * *. *.* **** ******** *********
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer gcgccgccgccgaagcccaggttgaccaggtc Protospacer ***** *****.************** * .
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccgccgccagagcccaggttgaagccggt Protospacer ****** ****.************* ..*.*
ccgccggcgccggagcccaggttgaccttgat--- CRISPR spacer ccgccggagcgggagcccaggtt---ccggatggg Protospacer ******* ** ************ *. ***
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer cccatgtcgccggcgccctggttgaccttggt Protospacer ** .* ****** **** ***********.*
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tgccggtcgcggtgtagacgatctggtcgatc Protospacer * ** * *******************.*..*
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tgccggtcgcggtgtagacgatctggtcgatc Protospacer * ** * *******************.*..*
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer ttggggtggcggtgtaggcgagctggttgggc Protospacer *.. * ***********.*** ******** *
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tcacgatggcggtgtcgacgatctcccagggc Protospacer ***** ********* ******** . ** *
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer tgccggtcgcggtgtagacgatctggtcgatc Protospacer * ** * *******************.*..*
---atcgaacgcacggcctggaccatcttggtggt CRISPR spacer gggatc---ctgacggcctggaccatcgcggtggt Protospacer *** * *************** .******
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgacgtctttcccgtccgctcggaagca Protospacer ******* ******** ******. *** *
cggttgaggtctttccggtccgccacgaacct CRISPR spacer cggttgacgtctttcccgtccgctcggaagca Protospacer ******* ******** ******. *** *
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer cagttcgcgaagctgtgcgaggtcttcggacg Protospacer **************** **** ** *. *
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer ctgttcgcgacgctgttcgtgttcgccggttt Protospacer * ******** ******** ***** *...*
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgtggttggcgatgtagacgatctggtcgtcg Protospacer . *******.***************.* *
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
tcacgttggcggtgtagacgatctggttggcc CRISPR spacer cgatgccggcggcgtagacgatctcgttggcg Protospacer . *.*..*****.*********** ******
gaagagaacgcctttcaaggcaatgcgtgcct CRISPR spacer gcggagaacgtctttcaaggcaatgggtatac Protospacer * .*******.************** **.. .
gtcgccccgcgctccacgcgcag-----gggtacaca CRISPR spacer tgcgcgccgcgctccaggcgcagggcccgggt----- Protospacer *** ********** ****** ****
gtcgccccgcgctccacgcgcaggggtacaca CRISPR spacer acctcgccgcgctccacgcgcagcggcaccgc Protospacer ..* * ***************** **.**
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer gcgggcccgaagctgttcgggttcgaggacta Protospacer * * ************.******.***.
cagttcgcgaagctgttcgagttcgaagacct CRISPR spacer gcgttcgcgaagctggtcgcgttcggtcacga Protospacer ************* *** *****. **
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer ccgccggcgccgaagcccaggatggagcgcac Protospacer ************.******** **. . *.
ccgccggcgccggagcccaggttgaccttgat CRISPR spacer tcgccggcgccggcgccaaggttgcagccgag Protospacer .************ *** ****** ..**
ccgccggcgccggagcccaggttga--ccttgat CRISPR spacer tggccggcgccgcagcccaggtcgaggacccg-- Protospacer . ********** *********.** *..*
atcgaac--gcacggcctggaccatcttggtggt CRISPR spacer --tgggccagcacggcctcgaccatctgggtgcc Protospacer .*..* ********* ******** **** .
gtattggagccggaggacggggcatgatcata CRISPR spacer gcgctggggcgggaggacggggcatgagcgcc Protospacer *...***.** **************** *..
gcttgcgggttggcgtagagctcgcccatgac CRISPR spacer ttaagcggggtggtgtagagctcgcccttctg Protospacer . ***** ***.************* *
gtattggagccggaggacggggcatgatcata CRISPR spacer tcgccgcagccggcggccggggcatgatcacg Protospacer ....* ****** ** *************..
----------------ccgccggcgccggagcccaggttgaccttgat CRISPR spacer
ttcggctgcaaccttggcgccggcgccggcga---------------- Protospacer
************ *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 79 : 36649 | 43 | uncultured_Caudovirales_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 73187 : 80848 | 10 | uncultured_Caudovirales_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_MPVI01000020.1 | 192-225 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_MPVI01000020.1 | 81-114 | 2 | 0.941 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_MPVI01000020.1 | 10-53 | 0 | 1.0 |
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaggcgaa Protospacer *************.********************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaagcgaa Protospacer *************.**************.*****
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctagccgacgccaaggcccacaccgatcagacggtggccaccg Protospacer ********************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17139-17172 | 0 | 1.0 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17044-17087 | 0 | 1.0 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17200-17243 | 0 | 1.0 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46849-46892 | 0 | 1.0 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47005-47048 | 0 | 1.0 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 16794-16827 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 16872-16905 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 35-68 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 113-146 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46920-46953 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47187-47220 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47265-47298 | 1 | 0.971 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 16983-17016 | 2 | 0.941 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46608-46641 | 2 | 0.941 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47076-47109 | 2 | 0.941 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46537-46580 | 2 | 0.955 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17824-17867 | 3 | 0.932 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46381-46424 | 3 | 0.932 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17512-17555 | 4 | 0.909 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 17668-17711 | 4 | 0.909 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 46693-46736 | 4 | 0.909 | |
| NZ_MPVI01000094_1 | 140-183 | 44 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 48873-48916 | 4 | 0.909 | |
| NZ_MPVI01000094_1 | 55-88 | 34 | NZ_CP025052 | Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence | 45381-45414 | 8 | 0.765 |
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcaactggtggacgccgaggcgaa Protospacer **********************************
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctagccgacgccaaggcccacaccgatcagacggtggccaccg Protospacer ********************************************
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctagccgacgccaaggcccacaccgatcagacggtggccaccg Protospacer ********************************************
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctagccgacgccaaggcccacaccgatcagacggtggccaccg Protospacer ********************************************
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctagccgacgccaaggcccacaccgatcagacggtggccaccg Protospacer ********************************************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcaactggtggacgccgaagcgaa Protospacer ****************************.*****
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaggcgaa Protospacer *************.********************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaggcgaa Protospacer *************.********************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcaactggtggacgccgaagcgaa Protospacer ****************************.*****
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaggcgaa Protospacer *************.********************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaggcgaa Protospacer *************.********************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcaactggtggacgccgaagcgaa Protospacer ****************************.*****
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaagcgaa Protospacer *************.**************.*****
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaagcgaa Protospacer *************.**************.*****
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer agcactcgcagcagctggtggacgccgaagcgaa Protospacer *************.**************.*****
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gctggccgacgccaaggcccacaccgatcagagggtggccaccg Protospacer ***.**************************** ***********
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccgacgccaaggcccacaccgatcagagggtggccaccg Protospacer *.*.**************************** ***********
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccgacgccaaggcccacaccgatcagagggtggccaccg Protospacer *.*.**************************** ***********
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccggcgccaaggcccacaccgatcagagggtggccaccg Protospacer *.*.****.*********************** ***********
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccggcgccaaggcccacaccgatcagagggtggccaccg Protospacer *.*.****.*********************** ***********
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccgacgccaaggcccacaccgaccaggcggtggccaccg Protospacer *.*.***********************.***.************
gctagccgacgccaaggcccacaccgatcagacggtggccaccg CRISPR spacer gttggccgacgccaaggcccacaccgaccaggcggtggccaccg Protospacer *.*.***********************.***.************
agcactcgcagcaactggtggacgccgaggcgaa CRISPR spacer actacaccgggcagcgggtggacgccgaggcgaa Protospacer * .** * .***.* ******************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 155 : 29904 | 41 | Pseudomonas_phage(78.95%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 2885 : 44673 | 29 | Salmonella_phage(42.86%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 51966 : 95437 | 65 | Pseudomonas_phage(85.71%) | attL 45938:45953|attR 78789:78804 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_MPVI01000020_1 | 227-275 | 49 | NZ_CP015000 | Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence | 70-118 | 0 | 1.0 | |
| NZ_MPVI01000020_1 | 227-275 | 49 | NZ_CP027175 | Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 | 16822-16870 | 0 | 1.0 | |
| NZ_MPVI01000020_1 | 227-275 | 49 | NZ_CP049162 | Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence | 47222-47270 | 0 | 1.0 |
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct CRISPR spacer gttcgcgctggccagtgttgccgcgtcgccatcggcgcgggctttcgct Protospacer *************************************************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_MPVI01000003_1 | 41542-41592 | 51 | NZ_CP042268 | Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence | 63791-63841 | 0 | 1.0 |
aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga CRISPR spacer aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga Protospacer ***************************************************
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|