Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MDMX01000016 Listeria monocytogenes strain Lm112 contig000016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000017 Listeria monocytogenes strain Lm112 contig000017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000028 Listeria monocytogenes strain Lm112 contig000028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000029 Listeria monocytogenes strain Lm112 contig000029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000024 Listeria monocytogenes strain Lm112 contig000024, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MDMX01000011 Listeria monocytogenes strain Lm112 contig000011, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 0 14 0 0
NZ_MDMX01000031 Listeria monocytogenes strain Lm112 contig000031, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_MDMX01000015 Listeria monocytogenes strain Lm112 contig000015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000014 Listeria monocytogenes strain Lm112 contig000014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000021 Listeria monocytogenes strain Lm112 contig000021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000022 Listeria monocytogenes strain Lm112 contig000022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000010 Listeria monocytogenes strain Lm112 contig000010, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_MDMX01000023 Listeria monocytogenes strain Lm112 contig000023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000030 Listeria monocytogenes strain Lm112 contig000030, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_MDMX01000004 Listeria monocytogenes strain Lm112 contig000004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000019 Listeria monocytogenes strain Lm112 contig000019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000026 Listeria monocytogenes strain Lm112 contig000026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000012 Listeria monocytogenes strain Lm112 contig000012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000013 Listeria monocytogenes strain Lm112 contig000013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000007 Listeria monocytogenes strain Lm112 contig000007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000008 Listeria monocytogenes strain Lm112 contig000008, whole genome shotgun sequence 0 crisprs csa3,WYL 0 0 1 0
NZ_MDMX01000001 Listeria monocytogenes strain Lm112 contig000001, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDMX01000006 Listeria monocytogenes strain Lm112 contig000006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000002 Listeria monocytogenes strain Lm112 contig000002, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_MDMX01000003 Listeria monocytogenes strain Lm112 contig000003, whole genome shotgun sequence 0 crisprs WYL,casR 0 0 0 0
NZ_MDMX01000005 Listeria monocytogenes strain Lm112 contig000005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000018 Listeria monocytogenes strain Lm112 contig000018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000027 Listeria monocytogenes strain Lm112 contig000027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000025 Listeria monocytogenes strain Lm112 contig000025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMX01000009 Listeria monocytogenes strain Lm112 contig000009, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MDMX01000020 Listeria monocytogenes strain Lm112 contig000020, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 0

Results visualization

1. NZ_MDMX01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 96015 : 106744 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_MDMX01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1837 : 21508 22 Streptococcus_phage(55.56%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MDMX01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87018 : 95304 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MDMX01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39851 : 80102 60 Listeria_phage(96.55%) holin,terminase,tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MDMX01000010.1|WP_003731276.1|79053_79305_-|hypothetical-protein 79053_79305_- 83 aa aa AcrIIA12 NA NA 39851-80102 NA
5. NZ_MDMX01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMX01000011_1 5317-6673 TypeII II-A,II-B
20 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 KP399678 Listeria phage vB_LmoS_293, complete genome 1775-1804 0 1.0
NZ_MDMX01000011_1 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6608-6637 30 KJ094028 Listeria phage LP-083-1 contig 2, partial genome 1396-1425 0 1.0
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MN172529 Listeria phage LP-039, complete genome 36996-37025 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MT438761 Listeria virus P61, complete genome 48737-48766 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MT178766 Listeria virus P100plus, complete genome 3982-4011 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 NC_025440 Listeria phage WIL-1, complete genome 128854-128883 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 NC_047872 Listeria phage LMTA-94, complete genome 94435-94464 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 DQ003638 Listeria phage A511, complete genome 37493-37522 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MT178767 Listeria virus P200, complete genome 3982-4011 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 DQ004855 Listeria bacteriophage P100, complete genome 3982-4011 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ591604 Listeria phage LMTA-148, complete genome 44926-44955 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ591605 Listeria phage LMTA-57, complete genome 105204-105233 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ094033 Listeria phage LP-048, complete genome 39453-39482 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ668715 Listeria phage LMTA-34, partial genome 81312-81341 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 NC_042048 Listeria phage LMTA-34, complete genome 52488-52517 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 102697-102726 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 FJ147488 Listeria phage 20422-1 terminase large subunit (terL) gene, partial cds; and unknown gene 1438-1467 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 NC_024360 Listeria phage LMSP-25, complete genome 52488-52517 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 36840-36869 1 0.967
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ535721 Listeria phage List-36, complete genome 91531-91560 1 0.967
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 1822-1851 1 0.967
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 DQ003637 Listeria phage A500, complete genome 1779-1808 1 0.967
NZ_MDMX01000011_1 1.6|5683|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5683-5712 30 KJ094028 Listeria phage LP-083-1 contig 2, partial genome 4152-4181 2 0.933
NZ_MDMX01000011_1 1.6|5683|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5683-5712 30 DQ003641 Listeria phage P35, complete genome 20293-20322 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 38343-38372 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 MN128594 Listeria phage LP-066, complete genome 38445-38474 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 NC_041862 Listeria phage LP-064, complete genome 46957-46986 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ094030 Listeria phage LP-083-2, complete genome 43626-43655 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 JX126918 Listeria phage LP-125, complete genome 46956-46985 2 0.933
NZ_MDMX01000011_1 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5749-5778 30 KJ094031 Listeria phage LP-124, complete genome 5741-5770 2 0.933
NZ_MDMX01000011_1 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6608-6637 30 DQ003641 Listeria phage P35, complete genome 17537-17566 2 0.933
NZ_MDMX01000011_1 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5419-5448 30 DQ003637 Listeria phage A500, complete genome 11342-11371 3 0.9
NZ_MDMX01000011_1 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5419-5448 30 KP399678 Listeria phage vB_LmoS_293, complete genome 11363-11392 3 0.9
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 NC_003216 Listeria phage A118, complete genome 1777-1806 3 0.9
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 AJ242593 Bacteriophage A118 complete genome 1777-1806 3 0.9
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 KJ094022 Listeria phage LP-030-3, complete genome 10201-10230 3 0.9
NZ_MDMX01000011_1 1.17|6410|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6410-6439 30 JB137888 Sequence 7 from Patent WO2012159774 1800-1829 3 0.9
NZ_MDMX01000011_1 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5419-5448 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 11377-11406 4 0.867
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 MK448834 Streptococcus phage Javan91, complete genome 17230-17259 4 0.867
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 MK449009 Streptococcus phage Javan88, complete genome 18934-18963 4 0.867
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 MK448727 Streptococcus phage Javan291, complete genome 17813-17842 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NC_027341 Lactococcus phage WRP3, complete genome 17007-17036 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 KF926093 Lactococcus phage phiL47, complete genome 18163-18192 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 9937-9966 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 20386-20415 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 88820-88849 6 0.8
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 99301-99330 6 0.8
NZ_MDMX01000011_1 1.16|6344|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6344-6373 30 NZ_CP014688 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence 320028-320057 6 0.8
NZ_MDMX01000011_1 1.1|5353|30|NZ_MDMX01000011|CRISPRCasFinder,CRT 5353-5382 30 MN956514 Salmonella phage L6jm, complete genome 35199-35228 7 0.767
NZ_MDMX01000011_1 1.3|5485|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5485-5514 30 MH358458 Escherichia phage phi G17, complete genome 44733-44762 7 0.767
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 CP003671 Staphylococcus warneri SG1 plasmid clone pvSw2 genomic sequence 6166-6195 7 0.767
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 ACSJ01000014 Clostridium phage D-1873 CLG.Contig159, whole genome shotgun sequence 2930-2959 7 0.767
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NC_007581 Clostridium phage c-st, complete genome 26984-27013 7 0.767
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 AP008983 Clostridium phage c-st genomic DNA, complete genome 26984-27013 7 0.767
NZ_MDMX01000011_1 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6278-6307 30 NZ_CP019429 Pseudomonas sp. R76 plasmid p76, complete sequence 6120-6149 7 0.767
NZ_MDMX01000011_1 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6278-6307 30 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 63045-63074 7 0.767
NZ_MDMX01000011_1 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6278-6307 30 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 119931-119960 7 0.767
NZ_MDMX01000011_1 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6608-6637 30 NZ_CP018178 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-2, complete sequence 51326-51355 7 0.767
NZ_MDMX01000011_1 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6608-6637 30 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 218447-218476 7 0.767
NZ_MDMX01000011_1 1.4|5551|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5551-5580 30 NZ_CP044096 Streptococcus pyogenes strain FDAARGOS_668 plasmid unnamed3 439-468 8 0.733
NZ_MDMX01000011_1 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5815-5844 30 JX094500 Cronobacter phage CR5, complete genome 159870-159899 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 89650-89679 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP010578 Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence 26190-26219 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP010579 Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB92, complete sequence 54428-54457 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 142875-142904 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP015177 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence 65799-65828 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 503758-503787 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 422300-422329 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP044980 Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence 51993-52022 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP010111 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence 223589-223618 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP053953 Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence 294907-294936 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 16209-16238 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 395528-395557 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 151358-151387 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 455414-455443 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP009636 Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence 171890-171919 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP016589 Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence 43796-43825 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 406271-406300 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP053962 Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence 236266-236295 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NZ_CP053950 Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence 189154-189183 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 LC494302 Escherichia phage SP27 DNA, complete genome 6031-6060 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 123356-123385 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 NC_027364 Escherichia phage PBECO 4, complete genome 278627-278656 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MH383160 Escherichia phage UB, complete genome 343694-343723 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MK327931 Escherichia phage vB_EcoM_G17, complete genome 148842-148871 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MT325768 Psychrobacillus phage Perkons, complete genome 10133-10162 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 294515-294544 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 KM507819 Escherichia phage 121Q, complete genome 6031-6060 8 0.733
NZ_MDMX01000011_1 1.10|5947|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5947-5976 30 MN693719 Marine virus AFVG_250M1014, complete genome 5373-5402 8 0.733
NZ_MDMX01000011_1 1.10|5947|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5947-5976 30 NZ_CP014361 Methylomonas sp. DH-1 plasmid, complete sequence 82037-82066 8 0.733
NZ_MDMX01000011_1 1.13|6145|31|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6145-6175 31 KP054477 Lactobacillus phage LfeInf, complete genome 32822-32852 8 0.742
NZ_MDMX01000011_1 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6278-6307 30 LC425518 Uncultured phage DNA, contig: NODE577 9459-9488 8 0.733
NZ_MDMX01000011_1 1.16|6344|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 6344-6373 30 KY794642 Staphylococcus phage vB_Sau_Clo6, complete genome 99049-99078 8 0.733
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MK770119 Pantoea phage vB_PagS_AAS21, complete genome 71650-71679 9 0.7
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MG983742 Bacillus phage Anath, complete genome 38218-38247 9 0.7
NZ_MDMX01000011_1 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR 5881-5910 30 MK448884 Streptococcus phage Javan246, complete genome 6318-6347 10 0.667

1. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaggtcatcaaagaagacgatcatacgtgc	Protospacer
******************************

2. spacer 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094028 (Listeria phage LP-083-1 contig 2, partial genome) position: , mismatch: 0, identity: 1.0

tgaaaatgccatccagatttcaaaatacgt	CRISPR spacer
tgaaaatgccatccagatttcaaaatacgt	Protospacer
******************************

3. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

4. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

5. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

6. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

7. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

8. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

9. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

10. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ004855 (Listeria bacteriophage P100, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

11. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

12. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

13. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

14. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ668715 (Listeria phage LMTA-34, partial genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

15. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

16. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

17. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to FJ147488 (Listeria phage 20422-1 terminase large subunit (terL) gene, partial cds; and unknown gene) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

18. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

19. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

20. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 1, identity: 0.967

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatacgtctctcttgatttttataccagta	Protospacer
************************* ****

21. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 1, identity: 0.967

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaggtcatcaaagaagacgatcatacgtgt	Protospacer
*****************************.

22. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 1, identity: 0.967

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaggtcatcaaagaagacgatcatacgtgt	Protospacer
*****************************.

23. spacer 1.6|5683|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094028 (Listeria phage LP-083-1 contig 2, partial genome) position: , mismatch: 2, identity: 0.933

ttacttgatgtcaaacatgtaacgcggaag	CRISPR spacer
tttcttgatgtcaaacatgtaacgcggaat	Protospacer
** ************************** 

24. spacer 1.6|5683|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 2, identity: 0.933

ttacttgatgtcaaacatgtaacgcggaag	CRISPR spacer
tttcttgatgtcaaacatgtaacgcggaat	Protospacer
** ************************** 

25. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

26. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

27. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

28. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

29. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

30. spacer 1.7|5749|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 2, identity: 0.933

aatacgtctctcttgatttttatacgagta	CRISPR spacer
aatatgtctctcttgatttttataccagta	Protospacer
****.******************** ****

31. spacer 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 2, identity: 0.933

tgaaaatgccatccagatttcaaaatacgt	CRISPR spacer
tgaaaatgctatccaaatttcaaaatacgt	Protospacer
*********.*****.**************

32. spacer 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 3, identity: 0.9

actcaatcaaaacaggtataaactctttga	CRISPR spacer
attcaattaaaacaggtataaactctttta	Protospacer
*.*****.******************** *

33. spacer 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 3, identity: 0.9

actcaatcaaaacaggtataaactctttga	CRISPR spacer
attcaattaaaacaggtataaactctttta	Protospacer
*.*****.******************** *

34. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 3, identity: 0.9

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaagtcgtcaaagaagacgatcatacgtgt	Protospacer
**.***.**********************.

35. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 3, identity: 0.9

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaagtcgtcaaagaagacgatcatacgtgt	Protospacer
**.***.**********************.

36. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 3, identity: 0.9

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
gaagtcatcaaagaagatgatcatacgtgt	Protospacer
**.**************.***********.

37. spacer 1.17|6410|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 3, identity: 0.9

aaacagaaatgaaggatggtgaagaagttc	CRISPR spacer
aaacagaaataaaggatggcgaagaagtac	Protospacer
**********.********.******** *

38. spacer 1.2|5419|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 4, identity: 0.867

actcaatcaaaacaggtataaactctttga	CRISPR spacer
attcgattaaaacaggtataaactctttaa	Protospacer
*.**.**.********************.*

39. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK448834 (Streptococcus phage Javan91, complete genome) position: , mismatch: 4, identity: 0.867

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
aatgtcatcaaagaagatgatcatacatgc	Protospacer
.* **************.********.***

40. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK449009 (Streptococcus phage Javan88, complete genome) position: , mismatch: 4, identity: 0.867

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
aatgtcatcaaagaagatgatcatacatgc	Protospacer
.* **************.********.***

41. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK448727 (Streptococcus phage Javan291, complete genome) position: , mismatch: 6, identity: 0.8

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
aaagttgtgaaagaagatgatcatacgtgc	Protospacer
.*.**..* ********.************

42. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_027341 (Lactococcus phage WRP3, complete genome) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
tattttgaattgtttcaagttcttcaattg	Protospacer
*.**** ********* ********* * .

43. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KF926093 (Lactococcus phage phiL47, complete genome) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
tattttgaattgtttcaagttcttcaattg	Protospacer
*.**** ********* ********* * .

44. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ttatttcaattttttctaattcttcaatta	Protospacer
*  ******** ******.******* * *

45. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ttatttcaattttttctaattcttcaatta	Protospacer
*  ******** ******.******* * *

46. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ttatttcaattttttctaattcttcaatta	Protospacer
*  ******** ******.******* * *

47. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.8

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ttatttcaattttttctaattcttcaatta	Protospacer
*  ******** ******.******* * *

48. spacer 1.16|6344|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 6, identity: 0.8

agggcttttattgtggatatagaagtctga	CRISPR spacer
acggctttttttgtggatgtagaagcgtta	Protospacer
* ******* ********.******. * *

49. spacer 1.1|5353|30|NZ_MDMX01000011|CRISPRCasFinder,CRT matches to MN956514 (Salmonella phage L6jm, complete genome) position: , mismatch: 7, identity: 0.767

ccctgttagcgatgggggggaagaatatta	CRISPR spacer
tactgttagtgatgagggggaagaagtttt	Protospacer
. *******.****.**********  ** 

50. spacer 1.3|5485|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MH358458 (Escherichia phage phi G17, complete genome) position: , mismatch: 7, identity: 0.767

gcatcgatagattaattccatcgtatttaa	CRISPR spacer
tattcagtacattaaatccatcgtatttaa	Protospacer
   **..** ***** **************

51. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to CP003671 (Staphylococcus warneri SG1 plasmid clone pvSw2 genomic sequence) position: , mismatch: 7, identity: 0.767

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
caatttcaattttttctaattcttcaatta	Protospacer
.. ******** ******.******* * *

52. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to ACSJ01000014 (Clostridium phage D-1873 CLG.Contig159, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
gtttttcaattttttctaattcttctatca	Protospacer
  ********* ******.******  * *

53. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_007581 (Clostridium phage c-st, complete genome) position: , mismatch: 7, identity: 0.767

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
gtttttcaattttttctaattcttctatca	Protospacer
  ********* ******.******  * *

54. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to AP008983 (Clostridium phage c-st genomic DNA, complete genome) position: , mismatch: 7, identity: 0.767

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
gtttttcaattttttctaattcttctatca	Protospacer
  ********* ******.******  * *

55. spacer 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019429 (Pseudomonas sp. R76 plasmid p76, complete sequence) position: , mismatch: 7, identity: 0.767

tttctgattgggtttgatgaattgactcgc	CRISPR spacer
ccgctgtttgagtttgatgaattgactcat	Protospacer
.. *** ***.*****************..

56. spacer 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 7, identity: 0.767

tttctgattgggtttgatgaattgactcgc	CRISPR spacer
tatcagatagggtttgatgaattgaagaac	Protospacer
* ** *** ****************   .*

57. spacer 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 7, identity: 0.767

tttctgattgggtttgatgaattgactcgc	CRISPR spacer
tatcagatagggtttgatgaattgaagaac	Protospacer
* ** *** ****************   .*

58. spacer 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018178 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgaaaatgccatccagatttcaaaatacgt	CRISPR spacer
agaaaatgctattcagatttcaaaaagggc	Protospacer
 ********.**.************ . *.

59. spacer 1.20|6608|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 7, identity: 0.767

tgaaaatgccatccagatttcaaaatacgt	CRISPR spacer
agcaaatgccatccagctttcagaatttga	Protospacer
 * ************* *****.*** .* 

60. spacer 1.4|5551|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044096 (Streptococcus pyogenes strain FDAARGOS_668 plasmid unnamed3) position: , mismatch: 8, identity: 0.733

acttgtcattggagaaatactttcatcagt	CRISPR spacer
acttgtgataggagaaatacttttgacgaa	Protospacer
****** ** *************.. *.. 

61. spacer 1.8|5815|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to JX094500 (Cronobacter phage CR5, complete genome) position: , mismatch: 8, identity: 0.733

gaggtcatcaaagaagacgatcatacgtgc	CRISPR spacer
cagctcatcaaagaagacggtcatgatacc	Protospacer
 ** ***************.****.    *

62. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

63. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010578 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

64. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010579 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB92, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

65. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

66. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

67. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

68. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

69. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044980 (Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

70. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010111 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

71. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053953 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

72. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

73. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

74. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

75. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

76. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

77. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

78. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

79. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

80. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053950 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
attgttcaagtgcttctagttcttcatctt	Protospacer
  * ***** **.**************.  

81. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

82. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

83. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

84. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

85. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

86. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MT325768 (Psychrobacillus phage Perkons, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ataatataattgtttcaagttgttcattaa	Protospacer
    * .********* **** ********

87. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

88. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 8, identity: 0.733

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
atttttcaattgctgctagttcttcttcgt	Protospacer
  **********.* ********** *.. 

89. spacer 1.10|5947|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MN693719 (Marine virus AFVG_250M1014, complete genome) position: , mismatch: 8, identity: 0.733

agtttaaagatgcggaagaattcgaccaaa	CRISPR spacer
agtttaaagatgcggaagaatctggaacgt	Protospacer
*********************..*.   . 

90. spacer 1.10|5947|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733

agtttaaagatgcggaagaattcgaccaaa	CRISPR spacer
gattaaaagatgcggaaaaattcgatttga	Protospacer
..** ************.*******.. .*

91. spacer 1.13|6145|31|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KP054477 (Lactobacillus phage LfeInf, complete genome) position: , mismatch: 8, identity: 0.742

catatctaaaatttgaccttgacaacgtgag	CRISPR spacer
gttatctaaagtttaaccttgacaacacggt	Protospacer
  ********.***.***********..*. 

92. spacer 1.15|6278|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to LC425518 (Uncultured phage DNA, contig: NODE577) position: , mismatch: 8, identity: 0.733

tttctgattgggtttgatgaattgactcgc	CRISPR spacer
gcgaggataggttttgatgaattgactcac	Protospacer
 .   *** ** ****************.*

93. spacer 1.16|6344|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to KY794642 (Staphylococcus phage vB_Sau_Clo6, complete genome) position: , mismatch: 8, identity: 0.733

agggcttttattgtggatatagaagtctga	CRISPR spacer
attccttttattgtggatacagaagacctg	Protospacer
*   ***************.***** *. .

94. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK770119 (Pantoea phage vB_PagS_AAS21, complete genome) position: , mismatch: 9, identity: 0.7

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
aacccgcaattgtttctaggtcttcaatat	Protospacer
 .... ************* ****** ** 

95. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MG983742 (Bacillus phage Anath, complete genome) position: , mismatch: 9, identity: 0.7

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
ccttttcaattatttcttgttcttccagcc	Protospacer
. *********.***** *******     

96. spacer 1.9|5881|30|NZ_MDMX01000011|CRISPRCasFinder,CRT,PILER-CR matches to MK448884 (Streptococcus phage Javan246, complete genome) position: , mismatch: 10, identity: 0.667

tgttttcaattgtttctagttcttcattaa	CRISPR spacer
gagagataattgtttctagttcttcgtttt	Protospacer
 .    .******************.**  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MDMX01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 126560 : 134402 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MDMX01000024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMX01000024_1 382-966 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MDMX01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 398832 : 457431 57 Streptococcus_phage(15.0%) protease,tRNA NA
DBSCAN-SWA_2 594353 : 601775 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage