Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MDMC01000004 Listeria monocytogenes strain Lm105 contig000004, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDMC01000006 Listeria monocytogenes strain Lm105 contig000006, whole genome shotgun sequence 1 crisprs csa3,DinG 0 0 1 0
NZ_MDMC01000005 Listeria monocytogenes strain Lm105 contig000005, whole genome shotgun sequence 0 crisprs csa3,WYL 0 0 1 1
NZ_MDMC01000011 Listeria monocytogenes strain Lm105 contig000011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMC01000007 Listeria monocytogenes strain Lm105 contig000007, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_MDMC01000012 Listeria monocytogenes strain Lm105 contig000012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMC01000013 Listeria monocytogenes strain Lm105 contig000013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMC01000001 Listeria monocytogenes strain Lm105 contig000001, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDMC01000010 Listeria monocytogenes strain Lm105 contig000010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMC01000003 Listeria monocytogenes strain Lm105 contig000003, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_MDMC01000008 Listeria monocytogenes strain Lm105 contig000008, whole genome shotgun sequence 2 crisprs casR,WYL 0 1 0 0
NZ_MDMC01000009 Listeria monocytogenes strain Lm105 contig000009, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 0
NZ_MDMC01000014 Listeria monocytogenes strain Lm105 contig000014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDMC01000002 Listeria monocytogenes strain Lm105 contig000002, whole genome shotgun sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_MDMC01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMC01000003_1 26870-27021 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_MDMC01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 268541 : 275964 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 408724 : 468215 58 Bacillus_virus(15.79%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MDMC01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMC01000008_1 309759-310047 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMC01000008_2 355012-355596 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MDMC01000008_1 1.2|309854|35|NZ_MDMC01000008|PILER-CR,CRISPRCasFinder,CRT 309854-309888 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_MDMC01000008_1 1.2|309854|35|NZ_MDMC01000008|PILER-CR,CRISPRCasFinder,CRT 309854-309888 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 1.2|309854|35|NZ_MDMC01000008|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

ttgtaacccatcgctgtccctttgacaaaaatcgc	CRISPR spacer
ttgtaacccatcgctgttcctttgacaaaaatcgc	Protospacer
*****************.*****************

2. spacer 1.2|309854|35|NZ_MDMC01000008|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

ttgtaacccatcgctgtccctttgacaaaaatcgc	CRISPR spacer
ttgtaacccatcgccgttcctttgacaaaaatcgc	Protospacer
**************.**.*****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MDMC01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113293 : 172344 81 Listeria_phage(84.62%) integrase,portal,terminase,holin,tail,capsid,plate attL 132732:132751|attR 171789:171808
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MDMC01000005.1|WP_003731276.1|170505_170757_-|hypothetical-protein 170505_170757_- 83 aa aa AcrIIA12 NA NA 113293-172344 NA
5. NZ_MDMC01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDMC01000006_1 114045-114155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 399105 : 409832 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MDMC01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 490415 : 517219 35 Listeria_phage(94.12%) tail,terminase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MDMC01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 90099 : 98385 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MDMC01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34656 : 47780 31 Listeria_phage(91.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_MDMC01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26190 : 35273 9 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage