Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MDFD01000023 Listeria monocytogenes strain Lm93 contig000023, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDFD01000008 Listeria monocytogenes strain Lm93 contig000008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000003 Listeria monocytogenes strain Lm93 contig000003, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_MDFD01000011 Listeria monocytogenes strain Lm93 contig000011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000013 Listeria monocytogenes strain Lm93 contig000013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000020 Listeria monocytogenes strain Lm93 contig000020, whole genome shotgun sequence 1 crisprs csa3,WYL 0 0 1 0
NZ_MDFD01000021 Listeria monocytogenes strain Lm93 contig000021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000015 Listeria monocytogenes strain Lm93 contig000015, whole genome shotgun sequence 1 crisprs WYL,casR 2 10 1 0
NZ_MDFD01000018 Listeria monocytogenes strain Lm93 contig000018, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDFD01000012 Listeria monocytogenes strain Lm93 contig000012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000007 Listeria monocytogenes strain Lm93 contig000007, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000019 Listeria monocytogenes strain Lm93 contig000019, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 1
NZ_MDFD01000005 Listeria monocytogenes strain Lm93 contig000005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000022 Listeria monocytogenes strain Lm93 contig000022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000006 Listeria monocytogenes strain Lm93 contig000006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000014 Listeria monocytogenes strain Lm93 contig000014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000002 Listeria monocytogenes strain Lm93 contig000002, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_MDFD01000017 Listeria monocytogenes strain Lm93 contig000017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MDFD01000001 Listeria monocytogenes strain Lm93 contig000001, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MDFD01000016 Listeria monocytogenes strain Lm93 contig000016, whole genome shotgun sequence 1 crisprs DinG,csa3 0 0 2 0
NZ_MDFD01000004 Listeria monocytogenes strain Lm93 contig000004, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_MDFD01000010 Listeria monocytogenes strain Lm93 contig000010, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MDFD01000009 Listeria monocytogenes strain Lm93 contig000009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_MDFD01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7653 11 Listeria_phage(62.5%) NA NA
DBSCAN-SWA_2 21002 : 80442 57 Bacillus_virus(16.67%) protease,tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MDFD01000019.1|WP_003731276.1|808_1060_-|hypothetical-protein 808_1060_- 83 aa aa AcrIIA12 NA NA 0-7653 NA
2. NZ_MDFD01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDFD01000004_1 26667-26818 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MDFD01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDFD01000020_1 129423-129579 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120043 : 127887 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_MDFD01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32722 : 85101 53 Streptococcus_phage(30.77%) protease,tRNA,transposase,integrase attL 60029:60045|attR 83095:83111
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_MDFD01000023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 69429 : 133711 71 Listeria_phage(88.0%) protease,tRNA,holin,portal,capsid,terminase,tail,integrase attL 64790:64806|attR 104108:104124
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MDFD01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDFD01000015_1 270379-270856 Orphan I-A
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 NZ_MDFD01000023.1 118579-118614 0 1.0
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 NZ_MDFD01000003.1 66722-66756 0 1.0

1. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to position: 118579-118614, mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

2. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to position: 66722-66756, mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MDFD01000015_1 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT 270408-270442 35 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214645 0 1.0
NZ_MDFD01000015_1 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT 270408-270442 35 MT500540 Listeria phage LP-HM00113468, complete genome 39834-39868 0 1.0
NZ_MDFD01000015_1 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT 270408-270442 35 KJ094023 Listeria phage LP-101, complete genome 5084-5118 0 1.0
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_MDFD01000015_1 1.3|270537|35|NZ_MDFD01000015|PILER-CR,CRT 270537-270571 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_MDFD01000015_1 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT 270664-270698 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_MDFD01000015_1 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT 270664-270698 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_MDFD01000015_1 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder 270408-270443 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214646 1 0.972
NZ_MDFD01000015_1 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder 270408-270443 36 MT500540 Listeria phage LP-HM00113468, complete genome 39833-39868 1 0.972
NZ_MDFD01000015_1 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder 270408-270443 36 KJ094023 Listeria phage LP-101, complete genome 5084-5119 1 0.972
NZ_MDFD01000015_1 1.10|270537|36|NZ_MDFD01000015|CRISPRCasFinder 270537-270572 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
NZ_MDFD01000015_1 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder 270664-270699 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_MDFD01000015_1 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder 270664-270699 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
NZ_MDFD01000015_1 1.14|270793|36|NZ_MDFD01000015|CRISPRCasFinder 270793-270828 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
NZ_MDFD01000015_1 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT 270408-270442 35 NC_009812 Listeria phage B025, complete genome 5044-5078 2 0.943
NZ_MDFD01000015_1 1.3|270537|35|NZ_MDFD01000015|PILER-CR,CRT 270537-270571 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_MDFD01000015_1 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT 270664-270698 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_MDFD01000015_1 1.10|270537|36|NZ_MDFD01000015|CRISPRCasFinder 270537-270572 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
NZ_MDFD01000015_1 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder 270664-270699 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
NZ_MDFD01000015_1 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder 270408-270443 36 NC_009812 Listeria phage B025, complete genome 5044-5079 3 0.917
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
NZ_MDFD01000015_1 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT 270728-270763 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_MDFD01000015_1 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder 270728-270764 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_MDFD01000015_1 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT 270793-270827 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

3. spacer 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

4. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

5. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

6. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

7. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

8. spacer 1.3|270537|35|NZ_MDFD01000015|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

9. spacer 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

10. spacer 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

11. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

12. spacer 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

13. spacer 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

14. spacer 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

15. spacer 1.10|270537|36|NZ_MDFD01000015|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

16. spacer 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

17. spacer 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

18. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

19. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

20. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

21. spacer 1.14|270793|36|NZ_MDFD01000015|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

22. spacer 1.1|270408|35|NZ_MDFD01000015|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggc	Protospacer
.**** *****************************

23. spacer 1.3|270537|35|NZ_MDFD01000015|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

24. spacer 1.5|270664|35|NZ_MDFD01000015|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

25. spacer 1.10|270537|36|NZ_MDFD01000015|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

26. spacer 1.12|270664|36|NZ_MDFD01000015|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

27. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

28. spacer 1.8|270408|36|NZ_MDFD01000015|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.917

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggct	Protospacer
.**** ***************************** 

29. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

30. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

31. spacer 1.6|270728|36|NZ_MDFD01000015|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

32. spacer 1.13|270728|37|NZ_MDFD01000015|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

33. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

34. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

35. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

36. spacer 1.7|270793|35|NZ_MDFD01000015|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 412282 : 442249 42 Listeria_phage(42.86%) protease,head,integrase,capsid,portal,terminase,tail attL 405148:405162|attR 425928:425942
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MDFD01000016
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MDFD01000016_1 337257-337365 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40656 : 51383 17 Listeria_phage(40.0%) tail,holin NA
DBSCAN-SWA_2 273170 : 283202 7 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MDFD01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 268501 : 278054 9 Hokovirus(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_MDFD01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88153 : 96439 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_MDFD01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34586 : 68613 48 Listeria_phage(97.78%) terminase,tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MDFD01000003.1|WP_003733687.1|40196_40391_+|hypothetical-protein 40196_40391_+ 64 aa aa NA HTH_XRE NA 34586-68613 yes
NZ_MDFD01000003.1|WP_012951967.1|38217_38925_-|hypothetical-protein 38217_38925_- 235 aa aa NA HTH_XRE NA 34586-68613 yes