Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_MADQ01000191 Xanthomonas translucens pv. translucens strain SIMT-07 contig_191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000682 Xanthomonas translucens pv. translucens strain SIMT-07 contig_682, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000128 Xanthomonas translucens pv. translucens strain SIMT-07 contig_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000462 Xanthomonas translucens pv. translucens strain SIMT-07 contig_462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000151 Xanthomonas translucens pv. translucens strain SIMT-07 contig_151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000386 Xanthomonas translucens pv. translucens strain SIMT-07 contig_386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000178 Xanthomonas translucens pv. translucens strain SIMT-07 contig_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000453 Xanthomonas translucens pv. translucens strain SIMT-07 contig_453, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000023 Xanthomonas translucens pv. translucens strain SIMT-07 contig_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000044 Xanthomonas translucens pv. translucens strain SIMT-07 contig_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000602 Xanthomonas translucens pv. translucens strain SIMT-07 contig_602, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000228 Xanthomonas translucens pv. translucens strain SIMT-07 contig_228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000208 Xanthomonas translucens pv. translucens strain SIMT-07 contig_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000496 Xanthomonas translucens pv. translucens strain SIMT-07 contig_496, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000514 Xanthomonas translucens pv. translucens strain SIMT-07 contig_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000229 Xanthomonas translucens pv. translucens strain SIMT-07 contig_229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000616 Xanthomonas translucens pv. translucens strain SIMT-07 contig_616, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000242 Xanthomonas translucens pv. translucens strain SIMT-07 contig_242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000474 Xanthomonas translucens pv. translucens strain SIMT-07 contig_474, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000347 Xanthomonas translucens pv. translucens strain SIMT-07 contig_347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000008 Xanthomonas translucens pv. translucens strain SIMT-07 contig_8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000703 Xanthomonas translucens pv. translucens strain SIMT-07 contig_704, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000267 Xanthomonas translucens pv. translucens strain SIMT-07 contig_267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000460 Xanthomonas translucens pv. translucens strain SIMT-07 contig_460, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000261 Xanthomonas translucens pv. translucens strain SIMT-07 contig_261, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000092 Xanthomonas translucens pv. translucens strain SIMT-07 contig_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000157 Xanthomonas translucens pv. translucens strain SIMT-07 contig_157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000371 Xanthomonas translucens pv. translucens strain SIMT-07 contig_371, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000295 Xanthomonas translucens pv. translucens strain SIMT-07 contig_295, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000059 Xanthomonas translucens pv. translucens strain SIMT-07 contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000702 Xanthomonas translucens pv. translucens strain SIMT-07 contig_703, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000262 Xanthomonas translucens pv. translucens strain SIMT-07 contig_262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000546 Xanthomonas translucens pv. translucens strain SIMT-07 contig_546, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000369 Xanthomonas translucens pv. translucens strain SIMT-07 contig_369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000694 Xanthomonas translucens pv. translucens strain SIMT-07 contig_694, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000181 Xanthomonas translucens pv. translucens strain SIMT-07 contig_181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000233 Xanthomonas translucens pv. translucens strain SIMT-07 contig_233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000037 Xanthomonas translucens pv. translucens strain SIMT-07 contig_37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000594 Xanthomonas translucens pv. translucens strain SIMT-07 contig_594, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000091 Xanthomonas translucens pv. translucens strain SIMT-07 contig_91, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000431 Xanthomonas translucens pv. translucens strain SIMT-07 contig_431, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000146 Xanthomonas translucens pv. translucens strain SIMT-07 contig_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000456 Xanthomonas translucens pv. translucens strain SIMT-07 contig_456, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000533 Xanthomonas translucens pv. translucens strain SIMT-07 contig_533, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000327 Xanthomonas translucens pv. translucens strain SIMT-07 contig_327, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000109 Xanthomonas translucens pv. translucens strain SIMT-07 contig_109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000404 Xanthomonas translucens pv. translucens strain SIMT-07 contig_404, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000291 Xanthomonas translucens pv. translucens strain SIMT-07 contig_291, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000326 Xanthomonas translucens pv. translucens strain SIMT-07 contig_326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000352 Xanthomonas translucens pv. translucens strain SIMT-07 contig_352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000620 Xanthomonas translucens pv. translucens strain SIMT-07 contig_620, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000088 Xanthomonas translucens pv. translucens strain SIMT-07 contig_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000640 Xanthomonas translucens pv. translucens strain SIMT-07 contig_640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000705 Xanthomonas translucens pv. translucens strain SIMT-07 contig_706, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000414 Xanthomonas translucens pv. translucens strain SIMT-07 contig_414, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000197 Xanthomonas translucens pv. translucens strain SIMT-07 contig_197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000207 Xanthomonas translucens pv. translucens strain SIMT-07 contig_207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000215 Xanthomonas translucens pv. translucens strain SIMT-07 contig_215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000443 Xanthomonas translucens pv. translucens strain SIMT-07 contig_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000251 Xanthomonas translucens pv. translucens strain SIMT-07 contig_251, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000093 Xanthomonas translucens pv. translucens strain SIMT-07 contig_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000001 Xanthomonas translucens pv. translucens strain SIMT-07 contig_1, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_MADQ01000480 Xanthomonas translucens pv. translucens strain SIMT-07 contig_480, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000536 Xanthomonas translucens pv. translucens strain SIMT-07 contig_536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000379 Xanthomonas translucens pv. translucens strain SIMT-07 contig_379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000045 Xanthomonas translucens pv. translucens strain SIMT-07 contig_45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000360 Xanthomonas translucens pv. translucens strain SIMT-07 contig_360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000160 Xanthomonas translucens pv. translucens strain SIMT-07 contig_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000353 Xanthomonas translucens pv. translucens strain SIMT-07 contig_353, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000605 Xanthomonas translucens pv. translucens strain SIMT-07 contig_605, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000490 Xanthomonas translucens pv. translucens strain SIMT-07 contig_490, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000308 Xanthomonas translucens pv. translucens strain SIMT-07 contig_308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000300 Xanthomonas translucens pv. translucens strain SIMT-07 contig_300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000009 Xanthomonas translucens pv. translucens strain SIMT-07 contig_9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000613 Xanthomonas translucens pv. translucens strain SIMT-07 contig_613, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000120 Xanthomonas translucens pv. translucens strain SIMT-07 contig_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000686 Xanthomonas translucens pv. translucens strain SIMT-07 contig_686, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000544 Xanthomonas translucens pv. translucens strain SIMT-07 contig_544, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000664 Xanthomonas translucens pv. translucens strain SIMT-07 contig_664, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000383 Xanthomonas translucens pv. translucens strain SIMT-07 contig_383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000062 Xanthomonas translucens pv. translucens strain SIMT-07 contig_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000180 Xanthomonas translucens pv. translucens strain SIMT-07 contig_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000505 Xanthomonas translucens pv. translucens strain SIMT-07 contig_505, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000034 Xanthomonas translucens pv. translucens strain SIMT-07 contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000420 Xanthomonas translucens pv. translucens strain SIMT-07 contig_420, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000356 Xanthomonas translucens pv. translucens strain SIMT-07 contig_356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000074 Xanthomonas translucens pv. translucens strain SIMT-07 contig_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000455 Xanthomonas translucens pv. translucens strain SIMT-07 contig_455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000252 Xanthomonas translucens pv. translucens strain SIMT-07 contig_252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000635 Xanthomonas translucens pv. translucens strain SIMT-07 contig_635, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000168 Xanthomonas translucens pv. translucens strain SIMT-07 contig_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000532 Xanthomonas translucens pv. translucens strain SIMT-07 contig_532, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000489 Xanthomonas translucens pv. translucens strain SIMT-07 contig_489, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000071 Xanthomonas translucens pv. translucens strain SIMT-07 contig_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000428 Xanthomonas translucens pv. translucens strain SIMT-07 contig_428, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000232 Xanthomonas translucens pv. translucens strain SIMT-07 contig_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000119 Xanthomonas translucens pv. translucens strain SIMT-07 contig_119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000573 Xanthomonas translucens pv. translucens strain SIMT-07 contig_573, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000624 Xanthomonas translucens pv. translucens strain SIMT-07 contig_624, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000234 Xanthomonas translucens pv. translucens strain SIMT-07 contig_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000205 Xanthomonas translucens pv. translucens strain SIMT-07 contig_205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000493 Xanthomonas translucens pv. translucens strain SIMT-07 contig_493, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000675 Xanthomonas translucens pv. translucens strain SIMT-07 contig_675, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000597 Xanthomonas translucens pv. translucens strain SIMT-07 contig_597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000413 Xanthomonas translucens pv. translucens strain SIMT-07 contig_413, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000107 Xanthomonas translucens pv. translucens strain SIMT-07 contig_107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000530 Xanthomonas translucens pv. translucens strain SIMT-07 contig_530, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000491 Xanthomonas translucens pv. translucens strain SIMT-07 contig_491, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000655 Xanthomonas translucens pv. translucens strain SIMT-07 contig_655, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000186 Xanthomonas translucens pv. translucens strain SIMT-07 contig_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000644 Xanthomonas translucens pv. translucens strain SIMT-07 contig_644, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000108 Xanthomonas translucens pv. translucens strain SIMT-07 contig_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000376 Xanthomonas translucens pv. translucens strain SIMT-07 contig_376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000032 Xanthomonas translucens pv. translucens strain SIMT-07 contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000281 Xanthomonas translucens pv. translucens strain SIMT-07 contig_281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000230 Xanthomonas translucens pv. translucens strain SIMT-07 contig_230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000629 Xanthomonas translucens pv. translucens strain SIMT-07 contig_629, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000357 Xanthomonas translucens pv. translucens strain SIMT-07 contig_357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000378 Xanthomonas translucens pv. translucens strain SIMT-07 contig_378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000222 Xanthomonas translucens pv. translucens strain SIMT-07 contig_222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000203 Xanthomonas translucens pv. translucens strain SIMT-07 contig_203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000318 Xanthomonas translucens pv. translucens strain SIMT-07 contig_318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000167 Xanthomonas translucens pv. translucens strain SIMT-07 contig_167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000339 Xanthomonas translucens pv. translucens strain SIMT-07 contig_339, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000084 Xanthomonas translucens pv. translucens strain SIMT-07 contig_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000169 Xanthomonas translucens pv. translucens strain SIMT-07 contig_169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000448 Xanthomonas translucens pv. translucens strain SIMT-07 contig_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000523 Xanthomonas translucens pv. translucens strain SIMT-07 contig_523, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000571 Xanthomonas translucens pv. translucens strain SIMT-07 contig_571, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000028 Xanthomonas translucens pv. translucens strain SIMT-07 contig_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000442 Xanthomonas translucens pv. translucens strain SIMT-07 contig_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000395 Xanthomonas translucens pv. translucens strain SIMT-07 contig_395, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000522 Xanthomonas translucens pv. translucens strain SIMT-07 contig_522, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000641 Xanthomonas translucens pv. translucens strain SIMT-07 contig_641, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000449 Xanthomonas translucens pv. translucens strain SIMT-07 contig_449, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000372 Xanthomonas translucens pv. translucens strain SIMT-07 contig_372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000501 Xanthomonas translucens pv. translucens strain SIMT-07 contig_501, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000247 Xanthomonas translucens pv. translucens strain SIMT-07 contig_247, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000440 Xanthomonas translucens pv. translucens strain SIMT-07 contig_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000567 Xanthomonas translucens pv. translucens strain SIMT-07 contig_567, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000292 Xanthomonas translucens pv. translucens strain SIMT-07 contig_292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000515 Xanthomonas translucens pv. translucens strain SIMT-07 contig_515, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000576 Xanthomonas translucens pv. translucens strain SIMT-07 contig_576, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000290 Xanthomonas translucens pv. translucens strain SIMT-07 contig_290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000486 Xanthomonas translucens pv. translucens strain SIMT-07 contig_486, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000202 Xanthomonas translucens pv. translucens strain SIMT-07 contig_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000699 Xanthomonas translucens pv. translucens strain SIMT-07 contig_700, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000025 Xanthomonas translucens pv. translucens strain SIMT-07 contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000058 Xanthomonas translucens pv. translucens strain SIMT-07 contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000432 Xanthomonas translucens pv. translucens strain SIMT-07 contig_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000173 Xanthomonas translucens pv. translucens strain SIMT-07 contig_173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000475 Xanthomonas translucens pv. translucens strain SIMT-07 contig_475, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000512 Xanthomonas translucens pv. translucens strain SIMT-07 contig_512, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000272 Xanthomonas translucens pv. translucens strain SIMT-07 contig_272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000006 Xanthomonas translucens pv. translucens strain SIMT-07 contig_6, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_MADQ01000011 Xanthomonas translucens pv. translucens strain SIMT-07 contig_11, whole genome shotgun sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2 9 42 0 0
NZ_MADQ01000542 Xanthomonas translucens pv. translucens strain SIMT-07 contig_542, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000693 Xanthomonas translucens pv. translucens strain SIMT-07 contig_693, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000582 Xanthomonas translucens pv. translucens strain SIMT-07 contig_582, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000236 Xanthomonas translucens pv. translucens strain SIMT-07 contig_236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000458 Xanthomonas translucens pv. translucens strain SIMT-07 contig_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000102 Xanthomonas translucens pv. translucens strain SIMT-07 contig_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000076 Xanthomonas translucens pv. translucens strain SIMT-07 contig_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000550 Xanthomonas translucens pv. translucens strain SIMT-07 contig_550, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000275 Xanthomonas translucens pv. translucens strain SIMT-07 contig_275, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000075 Xanthomonas translucens pv. translucens strain SIMT-07 contig_75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000608 Xanthomonas translucens pv. translucens strain SIMT-07 contig_608, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000537 Xanthomonas translucens pv. translucens strain SIMT-07 contig_537, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000637 Xanthomonas translucens pv. translucens strain SIMT-07 contig_637, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000081 Xanthomonas translucens pv. translucens strain SIMT-07 contig_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000388 Xanthomonas translucens pv. translucens strain SIMT-07 contig_388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000328 Xanthomonas translucens pv. translucens strain SIMT-07 contig_328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000430 Xanthomonas translucens pv. translucens strain SIMT-07 contig_430, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000022 Xanthomonas translucens pv. translucens strain SIMT-07 contig_22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000194 Xanthomonas translucens pv. translucens strain SIMT-07 contig_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000017 Xanthomonas translucens pv. translucens strain SIMT-07 contig_17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000280 Xanthomonas translucens pv. translucens strain SIMT-07 contig_280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000416 Xanthomonas translucens pv. translucens strain SIMT-07 contig_416, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000035 Xanthomonas translucens pv. translucens strain SIMT-07 contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000346 Xanthomonas translucens pv. translucens strain SIMT-07 contig_346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000078 Xanthomonas translucens pv. translucens strain SIMT-07 contig_78, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_MADQ01000380 Xanthomonas translucens pv. translucens strain SIMT-07 contig_380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000121 Xanthomonas translucens pv. translucens strain SIMT-07 contig_121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000111 Xanthomonas translucens pv. translucens strain SIMT-07 contig_111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000206 Xanthomonas translucens pv. translucens strain SIMT-07 contig_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000241 Xanthomonas translucens pv. translucens strain SIMT-07 contig_241, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000633 Xanthomonas translucens pv. translucens strain SIMT-07 contig_633, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000660 Xanthomonas translucens pv. translucens strain SIMT-07 contig_660, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000316 Xanthomonas translucens pv. translucens strain SIMT-07 contig_316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000553 Xanthomonas translucens pv. translucens strain SIMT-07 contig_553, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000355 Xanthomonas translucens pv. translucens strain SIMT-07 contig_355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000659 Xanthomonas translucens pv. translucens strain SIMT-07 contig_659, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000139 Xanthomonas translucens pv. translucens strain SIMT-07 contig_139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000509 Xanthomonas translucens pv. translucens strain SIMT-07 contig_509, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000297 Xanthomonas translucens pv. translucens strain SIMT-07 contig_297, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000663 Xanthomonas translucens pv. translucens strain SIMT-07 contig_663, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000632 Xanthomonas translucens pv. translucens strain SIMT-07 contig_632, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000591 Xanthomonas translucens pv. translucens strain SIMT-07 contig_591, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000097 Xanthomonas translucens pv. translucens strain SIMT-07 contig_97, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000279 Xanthomonas translucens pv. translucens strain SIMT-07 contig_279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000610 Xanthomonas translucens pv. translucens strain SIMT-07 contig_610, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000464 Xanthomonas translucens pv. translucens strain SIMT-07 contig_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000488 Xanthomonas translucens pv. translucens strain SIMT-07 contig_488, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000696 Xanthomonas translucens pv. translucens strain SIMT-07 contig_697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000349 Xanthomonas translucens pv. translucens strain SIMT-07 contig_349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000152 Xanthomonas translucens pv. translucens strain SIMT-07 contig_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000569 Xanthomonas translucens pv. translucens strain SIMT-07 contig_569, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000586 Xanthomonas translucens pv. translucens strain SIMT-07 contig_586, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000668 Xanthomonas translucens pv. translucens strain SIMT-07 contig_668, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000350 Xanthomonas translucens pv. translucens strain SIMT-07 contig_350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000259 Xanthomonas translucens pv. translucens strain SIMT-07 contig_259, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000561 Xanthomonas translucens pv. translucens strain SIMT-07 contig_561, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000590 Xanthomonas translucens pv. translucens strain SIMT-07 contig_590, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000354 Xanthomonas translucens pv. translucens strain SIMT-07 contig_354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000334 Xanthomonas translucens pv. translucens strain SIMT-07 contig_334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000061 Xanthomonas translucens pv. translucens strain SIMT-07 contig_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000625 Xanthomonas translucens pv. translucens strain SIMT-07 contig_625, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000513 Xanthomonas translucens pv. translucens strain SIMT-07 contig_513, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000617 Xanthomonas translucens pv. translucens strain SIMT-07 contig_617, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000589 Xanthomonas translucens pv. translucens strain SIMT-07 contig_589, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000142 Xanthomonas translucens pv. translucens strain SIMT-07 contig_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000584 Xanthomonas translucens pv. translucens strain SIMT-07 contig_584, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000040 Xanthomonas translucens pv. translucens strain SIMT-07 contig_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000066 Xanthomonas translucens pv. translucens strain SIMT-07 contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000103 Xanthomonas translucens pv. translucens strain SIMT-07 contig_103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000577 Xanthomonas translucens pv. translucens strain SIMT-07 contig_577, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000117 Xanthomonas translucens pv. translucens strain SIMT-07 contig_117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000487 Xanthomonas translucens pv. translucens strain SIMT-07 contig_487, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000401 Xanthomonas translucens pv. translucens strain SIMT-07 contig_401, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000406 Xanthomonas translucens pv. translucens strain SIMT-07 contig_406, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000358 Xanthomonas translucens pv. translucens strain SIMT-07 contig_358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000161 Xanthomonas translucens pv. translucens strain SIMT-07 contig_161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000680 Xanthomonas translucens pv. translucens strain SIMT-07 contig_680, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000033 Xanthomonas translucens pv. translucens strain SIMT-07 contig_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000564 Xanthomonas translucens pv. translucens strain SIMT-07 contig_564, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000132 Xanthomonas translucens pv. translucens strain SIMT-07 contig_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000266 Xanthomonas translucens pv. translucens strain SIMT-07 contig_266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000672 Xanthomonas translucens pv. translucens strain SIMT-07 contig_672, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000226 Xanthomonas translucens pv. translucens strain SIMT-07 contig_226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000502 Xanthomonas translucens pv. translucens strain SIMT-07 contig_502, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000459 Xanthomonas translucens pv. translucens strain SIMT-07 contig_459, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000402 Xanthomonas translucens pv. translucens strain SIMT-07 contig_402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000147 Xanthomonas translucens pv. translucens strain SIMT-07 contig_147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000563 Xanthomonas translucens pv. translucens strain SIMT-07 contig_563, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000476 Xanthomonas translucens pv. translucens strain SIMT-07 contig_476, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000063 Xanthomonas translucens pv. translucens strain SIMT-07 contig_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000531 Xanthomonas translucens pv. translucens strain SIMT-07 contig_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000684 Xanthomonas translucens pv. translucens strain SIMT-07 contig_684, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000607 Xanthomonas translucens pv. translucens strain SIMT-07 contig_607, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000341 Xanthomonas translucens pv. translucens strain SIMT-07 contig_341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000051 Xanthomonas translucens pv. translucens strain SIMT-07 contig_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000623 Xanthomonas translucens pv. translucens strain SIMT-07 contig_623, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000525 Xanthomonas translucens pv. translucens strain SIMT-07 contig_525, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000342 Xanthomonas translucens pv. translucens strain SIMT-07 contig_342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000368 Xanthomonas translucens pv. translucens strain SIMT-07 contig_368, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000014 Xanthomonas translucens pv. translucens strain SIMT-07 contig_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000136 Xanthomonas translucens pv. translucens strain SIMT-07 contig_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000473 Xanthomonas translucens pv. translucens strain SIMT-07 contig_473, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000124 Xanthomonas translucens pv. translucens strain SIMT-07 contig_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000231 Xanthomonas translucens pv. translucens strain SIMT-07 contig_231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000677 Xanthomonas translucens pv. translucens strain SIMT-07 contig_677, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000172 Xanthomonas translucens pv. translucens strain SIMT-07 contig_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000127 Xanthomonas translucens pv. translucens strain SIMT-07 contig_127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000468 Xanthomonas translucens pv. translucens strain SIMT-07 contig_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000072 Xanthomonas translucens pv. translucens strain SIMT-07 contig_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000560 Xanthomonas translucens pv. translucens strain SIMT-07 contig_560, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000528 Xanthomonas translucens pv. translucens strain SIMT-07 contig_528, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000477 Xanthomonas translucens pv. translucens strain SIMT-07 contig_477, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000469 Xanthomonas translucens pv. translucens strain SIMT-07 contig_469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000313 Xanthomonas translucens pv. translucens strain SIMT-07 contig_313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000437 Xanthomonas translucens pv. translucens strain SIMT-07 contig_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000470 Xanthomonas translucens pv. translucens strain SIMT-07 contig_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000105 Xanthomonas translucens pv. translucens strain SIMT-07 contig_105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000484 Xanthomonas translucens pv. translucens strain SIMT-07 contig_484, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000005 Xanthomonas translucens pv. translucens strain SIMT-07 contig_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000003 Xanthomonas translucens pv. translucens strain SIMT-07 contig_3, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MADQ01000118 Xanthomonas translucens pv. translucens strain SIMT-07 contig_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000218 Xanthomonas translucens pv. translucens strain SIMT-07 contig_218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000255 Xanthomonas translucens pv. translucens strain SIMT-07 contig_255, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000100 Xanthomonas translucens pv. translucens strain SIMT-07 contig_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000548 Xanthomonas translucens pv. translucens strain SIMT-07 contig_548, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000454 Xanthomonas translucens pv. translucens strain SIMT-07 contig_454, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000409 Xanthomonas translucens pv. translucens strain SIMT-07 contig_409, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000461 Xanthomonas translucens pv. translucens strain SIMT-07 contig_461, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000277 Xanthomonas translucens pv. translucens strain SIMT-07 contig_277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000622 Xanthomonas translucens pv. translucens strain SIMT-07 contig_622, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000691 Xanthomonas translucens pv. translucens strain SIMT-07 contig_691, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000331 Xanthomonas translucens pv. translucens strain SIMT-07 contig_331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000085 Xanthomonas translucens pv. translucens strain SIMT-07 contig_85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000235 Xanthomonas translucens pv. translucens strain SIMT-07 contig_235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000305 Xanthomonas translucens pv. translucens strain SIMT-07 contig_305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000688 Xanthomonas translucens pv. translucens strain SIMT-07 contig_688, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000188 Xanthomonas translucens pv. translucens strain SIMT-07 contig_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000016 Xanthomonas translucens pv. translucens strain SIMT-07 contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000243 Xanthomonas translucens pv. translucens strain SIMT-07 contig_243, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000392 Xanthomonas translucens pv. translucens strain SIMT-07 contig_392, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000177 Xanthomonas translucens pv. translucens strain SIMT-07 contig_177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000626 Xanthomonas translucens pv. translucens strain SIMT-07 contig_626, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000337 Xanthomonas translucens pv. translucens strain SIMT-07 contig_337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000027 Xanthomonas translucens pv. translucens strain SIMT-07 contig_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000612 Xanthomonas translucens pv. translucens strain SIMT-07 contig_612, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000520 Xanthomonas translucens pv. translucens strain SIMT-07 contig_520, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000110 Xanthomonas translucens pv. translucens strain SIMT-07 contig_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000651 Xanthomonas translucens pv. translucens strain SIMT-07 contig_651, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000439 Xanthomonas translucens pv. translucens strain SIMT-07 contig_439, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000511 Xanthomonas translucens pv. translucens strain SIMT-07 contig_511, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000064 Xanthomonas translucens pv. translucens strain SIMT-07 contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000239 Xanthomonas translucens pv. translucens strain SIMT-07 contig_239, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000451 Xanthomonas translucens pv. translucens strain SIMT-07 contig_451, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000621 Xanthomonas translucens pv. translucens strain SIMT-07 contig_621, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000619 Xanthomonas translucens pv. translucens strain SIMT-07 contig_619, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000541 Xanthomonas translucens pv. translucens strain SIMT-07 contig_541, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000538 Xanthomonas translucens pv. translucens strain SIMT-07 contig_538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000397 Xanthomonas translucens pv. translucens strain SIMT-07 contig_397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000483 Xanthomonas translucens pv. translucens strain SIMT-07 contig_483, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000545 Xanthomonas translucens pv. translucens strain SIMT-07 contig_545, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000666 Xanthomonas translucens pv. translucens strain SIMT-07 contig_666, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000042 Xanthomonas translucens pv. translucens strain SIMT-07 contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000209 Xanthomonas translucens pv. translucens strain SIMT-07 contig_209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000145 Xanthomonas translucens pv. translucens strain SIMT-07 contig_145, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MADQ01000309 Xanthomonas translucens pv. translucens strain SIMT-07 contig_309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000351 Xanthomonas translucens pv. translucens strain SIMT-07 contig_351, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MADQ01000494 Xanthomonas translucens pv. translucens strain SIMT-07 contig_494, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000638 Xanthomonas translucens pv. translucens strain SIMT-07 contig_638, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000609 Xanthomonas translucens pv. translucens strain SIMT-07 contig_609, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000495 Xanthomonas translucens pv. translucens strain SIMT-07 contig_495, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000276 Xanthomonas translucens pv. translucens strain SIMT-07 contig_276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000391 Xanthomonas translucens pv. translucens strain SIMT-07 contig_391, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000424 Xanthomonas translucens pv. translucens strain SIMT-07 contig_424, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000598 Xanthomonas translucens pv. translucens strain SIMT-07 contig_598, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000048 Xanthomonas translucens pv. translucens strain SIMT-07 contig_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000020 Xanthomonas translucens pv. translucens strain SIMT-07 contig_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000140 Xanthomonas translucens pv. translucens strain SIMT-07 contig_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000678 Xanthomonas translucens pv. translucens strain SIMT-07 contig_678, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000647 Xanthomonas translucens pv. translucens strain SIMT-07 contig_647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000187 Xanthomonas translucens pv. translucens strain SIMT-07 contig_187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000246 Xanthomonas translucens pv. translucens strain SIMT-07 contig_246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000265 Xanthomonas translucens pv. translucens strain SIMT-07 contig_265, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000570 Xanthomonas translucens pv. translucens strain SIMT-07 contig_570, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000585 Xanthomonas translucens pv. translucens strain SIMT-07 contig_585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000344 Xanthomonas translucens pv. translucens strain SIMT-07 contig_344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000047 Xanthomonas translucens pv. translucens strain SIMT-07 contig_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000213 Xanthomonas translucens pv. translucens strain SIMT-07 contig_213, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MADQ01000557 Xanthomonas translucens pv. translucens strain SIMT-07 contig_557, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000587 Xanthomonas translucens pv. translucens strain SIMT-07 contig_587, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000604 Xanthomonas translucens pv. translucens strain SIMT-07 contig_604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000106 Xanthomonas translucens pv. translucens strain SIMT-07 contig_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000196 Xanthomonas translucens pv. translucens strain SIMT-07 contig_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000248 Xanthomonas translucens pv. translucens strain SIMT-07 contig_248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000481 Xanthomonas translucens pv. translucens strain SIMT-07 contig_481, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000171 Xanthomonas translucens pv. translucens strain SIMT-07 contig_171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000396 Xanthomonas translucens pv. translucens strain SIMT-07 contig_396, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000384 Xanthomonas translucens pv. translucens strain SIMT-07 contig_384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000204 Xanthomonas translucens pv. translucens strain SIMT-07 contig_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000603 Xanthomonas translucens pv. translucens strain SIMT-07 contig_603, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000010 Xanthomonas translucens pv. translucens strain SIMT-07 contig_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000611 Xanthomonas translucens pv. translucens strain SIMT-07 contig_611, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000137 Xanthomonas translucens pv. translucens strain SIMT-07 contig_137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000701 Xanthomonas translucens pv. translucens strain SIMT-07 contig_702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000176 Xanthomonas translucens pv. translucens strain SIMT-07 contig_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000031 Xanthomonas translucens pv. translucens strain SIMT-07 contig_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000302 Xanthomonas translucens pv. translucens strain SIMT-07 contig_302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000323 Xanthomonas translucens pv. translucens strain SIMT-07 contig_323, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000670 Xanthomonas translucens pv. translucens strain SIMT-07 contig_670, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000060 Xanthomonas translucens pv. translucens strain SIMT-07 contig_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000551 Xanthomonas translucens pv. translucens strain SIMT-07 contig_551, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000673 Xanthomonas translucens pv. translucens strain SIMT-07 contig_673, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000429 Xanthomonas translucens pv. translucens strain SIMT-07 contig_429, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000264 Xanthomonas translucens pv. translucens strain SIMT-07 contig_264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000521 Xanthomonas translucens pv. translucens strain SIMT-07 contig_521, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000220 Xanthomonas translucens pv. translucens strain SIMT-07 contig_220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000427 Xanthomonas translucens pv. translucens strain SIMT-07 contig_427, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000421 Xanthomonas translucens pv. translucens strain SIMT-07 contig_421, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000260 Xanthomonas translucens pv. translucens strain SIMT-07 contig_260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000238 Xanthomonas translucens pv. translucens strain SIMT-07 contig_238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000446 Xanthomonas translucens pv. translucens strain SIMT-07 contig_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000435 Xanthomonas translucens pv. translucens strain SIMT-07 contig_435, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000362 Xanthomonas translucens pv. translucens strain SIMT-07 contig_362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000123 Xanthomonas translucens pv. translucens strain SIMT-07 contig_123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000565 Xanthomonas translucens pv. translucens strain SIMT-07 contig_565, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000375 Xanthomonas translucens pv. translucens strain SIMT-07 contig_375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000067 Xanthomonas translucens pv. translucens strain SIMT-07 contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000245 Xanthomonas translucens pv. translucens strain SIMT-07 contig_245, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000307 Xanthomonas translucens pv. translucens strain SIMT-07 contig_307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000374 Xanthomonas translucens pv. translucens strain SIMT-07 contig_374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000452 Xanthomonas translucens pv. translucens strain SIMT-07 contig_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000271 Xanthomonas translucens pv. translucens strain SIMT-07 contig_271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000089 Xanthomonas translucens pv. translucens strain SIMT-07 contig_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000299 Xanthomonas translucens pv. translucens strain SIMT-07 contig_299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000274 Xanthomonas translucens pv. translucens strain SIMT-07 contig_274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000631 Xanthomonas translucens pv. translucens strain SIMT-07 contig_631, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000517 Xanthomonas translucens pv. translucens strain SIMT-07 contig_517, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000221 Xanthomonas translucens pv. translucens strain SIMT-07 contig_221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000400 Xanthomonas translucens pv. translucens strain SIMT-07 contig_400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000095 Xanthomonas translucens pv. translucens strain SIMT-07 contig_95, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000690 Xanthomonas translucens pv. translucens strain SIMT-07 contig_690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000556 Xanthomonas translucens pv. translucens strain SIMT-07 contig_556, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000301 Xanthomonas translucens pv. translucens strain SIMT-07 contig_301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000200 Xanthomonas translucens pv. translucens strain SIMT-07 contig_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000195 Xanthomonas translucens pv. translucens strain SIMT-07 contig_195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000390 Xanthomonas translucens pv. translucens strain SIMT-07 contig_390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000162 Xanthomonas translucens pv. translucens strain SIMT-07 contig_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000253 Xanthomonas translucens pv. translucens strain SIMT-07 contig_253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000116 Xanthomonas translucens pv. translucens strain SIMT-07 contig_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000159 Xanthomonas translucens pv. translucens strain SIMT-07 contig_159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000361 Xanthomonas translucens pv. translucens strain SIMT-07 contig_361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000050 Xanthomonas translucens pv. translucens strain SIMT-07 contig_50, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_MADQ01000695 Xanthomonas translucens pv. translucens strain SIMT-07 contig_696, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000193 Xanthomonas translucens pv. translucens strain SIMT-07 contig_193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000315 Xanthomonas translucens pv. translucens strain SIMT-07 contig_315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000163 Xanthomonas translucens pv. translucens strain SIMT-07 contig_163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000634 Xanthomonas translucens pv. translucens strain SIMT-07 contig_634, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000471 Xanthomonas translucens pv. translucens strain SIMT-07 contig_471, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000219 Xanthomonas translucens pv. translucens strain SIMT-07 contig_219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000465 Xanthomonas translucens pv. translucens strain SIMT-07 contig_465, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000165 Xanthomonas translucens pv. translucens strain SIMT-07 contig_165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000407 Xanthomonas translucens pv. translucens strain SIMT-07 contig_407, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000535 Xanthomonas translucens pv. translucens strain SIMT-07 contig_535, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000087 Xanthomonas translucens pv. translucens strain SIMT-07 contig_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000263 Xanthomonas translucens pv. translucens strain SIMT-07 contig_263, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000237 Xanthomonas translucens pv. translucens strain SIMT-07 contig_237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000056 Xanthomonas translucens pv. translucens strain SIMT-07 contig_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000268 Xanthomonas translucens pv. translucens strain SIMT-07 contig_268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000552 Xanthomonas translucens pv. translucens strain SIMT-07 contig_552, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000082 Xanthomonas translucens pv. translucens strain SIMT-07 contig_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000423 Xanthomonas translucens pv. translucens strain SIMT-07 contig_423, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000135 Xanthomonas translucens pv. translucens strain SIMT-07 contig_135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000332 Xanthomonas translucens pv. translucens strain SIMT-07 contig_332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000403 Xanthomonas translucens pv. translucens strain SIMT-07 contig_403, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000418 Xanthomonas translucens pv. translucens strain SIMT-07 contig_418, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000287 Xanthomonas translucens pv. translucens strain SIMT-07 contig_287, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000134 Xanthomonas translucens pv. translucens strain SIMT-07 contig_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000214 Xanthomonas translucens pv. translucens strain SIMT-07 contig_214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000628 Xanthomonas translucens pv. translucens strain SIMT-07 contig_628, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000500 Xanthomonas translucens pv. translucens strain SIMT-07 contig_500, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000114 Xanthomonas translucens pv. translucens strain SIMT-07 contig_114, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MADQ01000478 Xanthomonas translucens pv. translucens strain SIMT-07 contig_478, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000179 Xanthomonas translucens pv. translucens strain SIMT-07 contig_179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000595 Xanthomonas translucens pv. translucens strain SIMT-07 contig_595, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000131 Xanthomonas translucens pv. translucens strain SIMT-07 contig_131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000019 Xanthomonas translucens pv. translucens strain SIMT-07 contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000381 Xanthomonas translucens pv. translucens strain SIMT-07 contig_381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000642 Xanthomonas translucens pv. translucens strain SIMT-07 contig_642, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MADQ01000130 Xanthomonas translucens pv. translucens strain SIMT-07 contig_130, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_MADQ01000382 Xanthomonas translucens pv. translucens strain SIMT-07 contig_382, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000698 Xanthomonas translucens pv. translucens strain SIMT-07 contig_699, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000189 Xanthomonas translucens pv. translucens strain SIMT-07 contig_189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000257 Xanthomonas translucens pv. translucens strain SIMT-07 contig_257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000606 Xanthomonas translucens pv. translucens strain SIMT-07 contig_606, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000578 Xanthomonas translucens pv. translucens strain SIMT-07 contig_578, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000627 Xanthomonas translucens pv. translucens strain SIMT-07 contig_627, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000593 Xanthomonas translucens pv. translucens strain SIMT-07 contig_593, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000466 Xanthomonas translucens pv. translucens strain SIMT-07 contig_466, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000311 Xanthomonas translucens pv. translucens strain SIMT-07 contig_311, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000492 Xanthomonas translucens pv. translucens strain SIMT-07 contig_492, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000073 Xanthomonas translucens pv. translucens strain SIMT-07 contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000129 Xanthomonas translucens pv. translucens strain SIMT-07 contig_129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000294 Xanthomonas translucens pv. translucens strain SIMT-07 contig_294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000618 Xanthomonas translucens pv. translucens strain SIMT-07 contig_618, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000662 Xanthomonas translucens pv. translucens strain SIMT-07 contig_662, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000497 Xanthomonas translucens pv. translucens strain SIMT-07 contig_497, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000324 Xanthomonas translucens pv. translucens strain SIMT-07 contig_324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000669 Xanthomonas translucens pv. translucens strain SIMT-07 contig_669, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000333 Xanthomonas translucens pv. translucens strain SIMT-07 contig_333, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000516 Xanthomonas translucens pv. translucens strain SIMT-07 contig_516, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000296 Xanthomonas translucens pv. translucens strain SIMT-07 contig_296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000549 Xanthomonas translucens pv. translucens strain SIMT-07 contig_549, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000527 Xanthomonas translucens pv. translucens strain SIMT-07 contig_527, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000018 Xanthomonas translucens pv. translucens strain SIMT-07 contig_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000348 Xanthomonas translucens pv. translucens strain SIMT-07 contig_348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000508 Xanthomonas translucens pv. translucens strain SIMT-07 contig_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000013 Xanthomonas translucens pv. translucens strain SIMT-07 contig_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000679 Xanthomonas translucens pv. translucens strain SIMT-07 contig_679, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000412 Xanthomonas translucens pv. translucens strain SIMT-07 contig_412, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000104 Xanthomonas translucens pv. translucens strain SIMT-07 contig_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000070 Xanthomonas translucens pv. translucens strain SIMT-07 contig_70, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MADQ01000304 Xanthomonas translucens pv. translucens strain SIMT-07 contig_304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000387 Xanthomonas translucens pv. translucens strain SIMT-07 contig_387, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000518 Xanthomonas translucens pv. translucens strain SIMT-07 contig_518, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000166 Xanthomonas translucens pv. translucens strain SIMT-07 contig_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000499 Xanthomonas translucens pv. translucens strain SIMT-07 contig_499, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000098 Xanthomonas translucens pv. translucens strain SIMT-07 contig_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000112 Xanthomonas translucens pv. translucens strain SIMT-07 contig_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000504 Xanthomonas translucens pv. translucens strain SIMT-07 contig_504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000080 Xanthomonas translucens pv. translucens strain SIMT-07 contig_80, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MADQ01000330 Xanthomonas translucens pv. translucens strain SIMT-07 contig_330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000554 Xanthomonas translucens pv. translucens strain SIMT-07 contig_554, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000164 Xanthomonas translucens pv. translucens strain SIMT-07 contig_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000574 Xanthomonas translucens pv. translucens strain SIMT-07 contig_574, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000039 Xanthomonas translucens pv. translucens strain SIMT-07 contig_39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000158 Xanthomonas translucens pv. translucens strain SIMT-07 contig_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000320 Xanthomonas translucens pv. translucens strain SIMT-07 contig_320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000055 Xanthomonas translucens pv. translucens strain SIMT-07 contig_55, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MADQ01000153 Xanthomonas translucens pv. translucens strain SIMT-07 contig_153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000201 Xanthomonas translucens pv. translucens strain SIMT-07 contig_201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000646 Xanthomonas translucens pv. translucens strain SIMT-07 contig_646, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000434 Xanthomonas translucens pv. translucens strain SIMT-07 contig_434, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000657 Xanthomonas translucens pv. translucens strain SIMT-07 contig_657, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000457 Xanthomonas translucens pv. translucens strain SIMT-07 contig_457, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000482 Xanthomonas translucens pv. translucens strain SIMT-07 contig_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000270 Xanthomonas translucens pv. translucens strain SIMT-07 contig_270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000547 Xanthomonas translucens pv. translucens strain SIMT-07 contig_547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000312 Xanthomonas translucens pv. translucens strain SIMT-07 contig_312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000069 Xanthomonas translucens pv. translucens strain SIMT-07 contig_69, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_MADQ01000389 Xanthomonas translucens pv. translucens strain SIMT-07 contig_389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000113 Xanthomonas translucens pv. translucens strain SIMT-07 contig_113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000057 Xanthomonas translucens pv. translucens strain SIMT-07 contig_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000144 Xanthomonas translucens pv. translucens strain SIMT-07 contig_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000526 Xanthomonas translucens pv. translucens strain SIMT-07 contig_526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000183 Xanthomonas translucens pv. translucens strain SIMT-07 contig_183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000329 Xanthomonas translucens pv. translucens strain SIMT-07 contig_329, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MADQ01000425 Xanthomonas translucens pv. translucens strain SIMT-07 contig_425, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000681 Xanthomonas translucens pv. translucens strain SIMT-07 contig_681, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000322 Xanthomonas translucens pv. translucens strain SIMT-07 contig_322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000083 Xanthomonas translucens pv. translucens strain SIMT-07 contig_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000336 Xanthomonas translucens pv. translucens strain SIMT-07 contig_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000293 Xanthomonas translucens pv. translucens strain SIMT-07 contig_293, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000385 Xanthomonas translucens pv. translucens strain SIMT-07 contig_385, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000170 Xanthomonas translucens pv. translucens strain SIMT-07 contig_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000417 Xanthomonas translucens pv. translucens strain SIMT-07 contig_417, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000575 Xanthomonas translucens pv. translucens strain SIMT-07 contig_575, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000288 Xanthomonas translucens pv. translucens strain SIMT-07 contig_288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000310 Xanthomonas translucens pv. translucens strain SIMT-07 contig_310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000656 Xanthomonas translucens pv. translucens strain SIMT-07 contig_656, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000615 Xanthomonas translucens pv. translucens strain SIMT-07 contig_615, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000258 Xanthomonas translucens pv. translucens strain SIMT-07 contig_258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000697 Xanthomonas translucens pv. translucens strain SIMT-07 contig_698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000467 Xanthomonas translucens pv. translucens strain SIMT-07 contig_467, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000174 Xanthomonas translucens pv. translucens strain SIMT-07 contig_174, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_MADQ01000601 Xanthomonas translucens pv. translucens strain SIMT-07 contig_601, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000325 Xanthomonas translucens pv. translucens strain SIMT-07 contig_325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000244 Xanthomonas translucens pv. translucens strain SIMT-07 contig_244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000367 Xanthomonas translucens pv. translucens strain SIMT-07 contig_367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000154 Xanthomonas translucens pv. translucens strain SIMT-07 contig_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000285 Xanthomonas translucens pv. translucens strain SIMT-07 contig_285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000185 Xanthomonas translucens pv. translucens strain SIMT-07 contig_185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000648 Xanthomonas translucens pv. translucens strain SIMT-07 contig_648, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000043 Xanthomonas translucens pv. translucens strain SIMT-07 contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000433 Xanthomonas translucens pv. translucens strain SIMT-07 contig_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000141 Xanthomonas translucens pv. translucens strain SIMT-07 contig_141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000094 Xanthomonas translucens pv. translucens strain SIMT-07 contig_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000479 Xanthomonas translucens pv. translucens strain SIMT-07 contig_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000399 Xanthomonas translucens pv. translucens strain SIMT-07 contig_399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000148 Xanthomonas translucens pv. translucens strain SIMT-07 contig_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000101 Xanthomonas translucens pv. translucens strain SIMT-07 contig_101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000068 Xanthomonas translucens pv. translucens strain SIMT-07 contig_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000422 Xanthomonas translucens pv. translucens strain SIMT-07 contig_422, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000529 Xanthomonas translucens pv. translucens strain SIMT-07 contig_529, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000065 Xanthomonas translucens pv. translucens strain SIMT-07 contig_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000415 Xanthomonas translucens pv. translucens strain SIMT-07 contig_415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000444 Xanthomonas translucens pv. translucens strain SIMT-07 contig_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000212 Xanthomonas translucens pv. translucens strain SIMT-07 contig_212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000338 Xanthomonas translucens pv. translucens strain SIMT-07 contig_338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000269 Xanthomonas translucens pv. translucens strain SIMT-07 contig_269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000038 Xanthomonas translucens pv. translucens strain SIMT-07 contig_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000079 Xanthomonas translucens pv. translucens strain SIMT-07 contig_79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000665 Xanthomonas translucens pv. translucens strain SIMT-07 contig_665, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000363 Xanthomonas translucens pv. translucens strain SIMT-07 contig_363, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000524 Xanthomonas translucens pv. translucens strain SIMT-07 contig_524, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000438 Xanthomonas translucens pv. translucens strain SIMT-07 contig_438, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000398 Xanthomonas translucens pv. translucens strain SIMT-07 contig_398, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000581 Xanthomonas translucens pv. translucens strain SIMT-07 contig_581, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000689 Xanthomonas translucens pv. translucens strain SIMT-07 contig_689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000645 Xanthomonas translucens pv. translucens strain SIMT-07 contig_645, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000278 Xanthomonas translucens pv. translucens strain SIMT-07 contig_278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000692 Xanthomonas translucens pv. translucens strain SIMT-07 contig_692, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000314 Xanthomonas translucens pv. translucens strain SIMT-07 contig_314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000700 Xanthomonas translucens pv. translucens strain SIMT-07 contig_701, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000225 Xanthomonas translucens pv. translucens strain SIMT-07 contig_225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000224 Xanthomonas translucens pv. translucens strain SIMT-07 contig_224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000199 Xanthomonas translucens pv. translucens strain SIMT-07 contig_199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000472 Xanthomonas translucens pv. translucens strain SIMT-07 contig_472, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000588 Xanthomonas translucens pv. translucens strain SIMT-07 contig_588, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000436 Xanthomonas translucens pv. translucens strain SIMT-07 contig_436, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000319 Xanthomonas translucens pv. translucens strain SIMT-07 contig_319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000359 Xanthomonas translucens pv. translucens strain SIMT-07 contig_359, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000377 Xanthomonas translucens pv. translucens strain SIMT-07 contig_377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000463 Xanthomonas translucens pv. translucens strain SIMT-07 contig_463, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000426 Xanthomonas translucens pv. translucens strain SIMT-07 contig_426, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000580 Xanthomonas translucens pv. translucens strain SIMT-07 contig_580, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000217 Xanthomonas translucens pv. translucens strain SIMT-07 contig_217, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_MADQ01000250 Xanthomonas translucens pv. translucens strain SIMT-07 contig_250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000343 Xanthomonas translucens pv. translucens strain SIMT-07 contig_343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000211 Xanthomonas translucens pv. translucens strain SIMT-07 contig_211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000447 Xanthomonas translucens pv. translucens strain SIMT-07 contig_447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000125 Xanthomonas translucens pv. translucens strain SIMT-07 contig_125, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_MADQ01000562 Xanthomonas translucens pv. translucens strain SIMT-07 contig_562, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000284 Xanthomonas translucens pv. translucens strain SIMT-07 contig_284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000671 Xanthomonas translucens pv. translucens strain SIMT-07 contig_671, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000667 Xanthomonas translucens pv. translucens strain SIMT-07 contig_667, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000184 Xanthomonas translucens pv. translucens strain SIMT-07 contig_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000450 Xanthomonas translucens pv. translucens strain SIMT-07 contig_450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000090 Xanthomonas translucens pv. translucens strain SIMT-07 contig_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000636 Xanthomonas translucens pv. translucens strain SIMT-07 contig_636, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000077 Xanthomonas translucens pv. translucens strain SIMT-07 contig_77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000004 Xanthomonas translucens pv. translucens strain SIMT-07 contig_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000096 Xanthomonas translucens pv. translucens strain SIMT-07 contig_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000256 Xanthomonas translucens pv. translucens strain SIMT-07 contig_256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000303 Xanthomonas translucens pv. translucens strain SIMT-07 contig_303, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000566 Xanthomonas translucens pv. translucens strain SIMT-07 contig_566, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000366 Xanthomonas translucens pv. translucens strain SIMT-07 contig_366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000126 Xanthomonas translucens pv. translucens strain SIMT-07 contig_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000317 Xanthomonas translucens pv. translucens strain SIMT-07 contig_317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000498 Xanthomonas translucens pv. translucens strain SIMT-07 contig_498, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000345 Xanthomonas translucens pv. translucens strain SIMT-07 contig_345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000122 Xanthomonas translucens pv. translucens strain SIMT-07 contig_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000156 Xanthomonas translucens pv. translucens strain SIMT-07 contig_156, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_MADQ01000240 Xanthomonas translucens pv. translucens strain SIMT-07 contig_240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000321 Xanthomonas translucens pv. translucens strain SIMT-07 contig_321, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000143 Xanthomonas translucens pv. translucens strain SIMT-07 contig_143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000227 Xanthomonas translucens pv. translucens strain SIMT-07 contig_227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000370 Xanthomonas translucens pv. translucens strain SIMT-07 contig_370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000373 Xanthomonas translucens pv. translucens strain SIMT-07 contig_373, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000015 Xanthomonas translucens pv. translucens strain SIMT-07 contig_15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000192 Xanthomonas translucens pv. translucens strain SIMT-07 contig_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000086 Xanthomonas translucens pv. translucens strain SIMT-07 contig_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000410 Xanthomonas translucens pv. translucens strain SIMT-07 contig_410, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000052 Xanthomonas translucens pv. translucens strain SIMT-07 contig_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000150 Xanthomonas translucens pv. translucens strain SIMT-07 contig_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000650 Xanthomonas translucens pv. translucens strain SIMT-07 contig_650, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000583 Xanthomonas translucens pv. translucens strain SIMT-07 contig_583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000254 Xanthomonas translucens pv. translucens strain SIMT-07 contig_254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000639 Xanthomonas translucens pv. translucens strain SIMT-07 contig_639, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000568 Xanthomonas translucens pv. translucens strain SIMT-07 contig_568, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000365 Xanthomonas translucens pv. translucens strain SIMT-07 contig_365, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000273 Xanthomonas translucens pv. translucens strain SIMT-07 contig_273, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000046 Xanthomonas translucens pv. translucens strain SIMT-07 contig_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000558 Xanthomonas translucens pv. translucens strain SIMT-07 contig_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000021 Xanthomonas translucens pv. translucens strain SIMT-07 contig_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000555 Xanthomonas translucens pv. translucens strain SIMT-07 contig_555, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000643 Xanthomonas translucens pv. translucens strain SIMT-07 contig_643, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000036 Xanthomonas translucens pv. translucens strain SIMT-07 contig_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000687 Xanthomonas translucens pv. translucens strain SIMT-07 contig_687, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000411 Xanthomonas translucens pv. translucens strain SIMT-07 contig_411, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000540 Xanthomonas translucens pv. translucens strain SIMT-07 contig_540, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000289 Xanthomonas translucens pv. translucens strain SIMT-07 contig_289, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000507 Xanthomonas translucens pv. translucens strain SIMT-07 contig_507, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000676 Xanthomonas translucens pv. translucens strain SIMT-07 contig_676, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000534 Xanthomonas translucens pv. translucens strain SIMT-07 contig_534, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000282 Xanthomonas translucens pv. translucens strain SIMT-07 contig_282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000599 Xanthomonas translucens pv. translucens strain SIMT-07 contig_599, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000519 Xanthomonas translucens pv. translucens strain SIMT-07 contig_519, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000654 Xanthomonas translucens pv. translucens strain SIMT-07 contig_654, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000306 Xanthomonas translucens pv. translucens strain SIMT-07 contig_306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000210 Xanthomonas translucens pv. translucens strain SIMT-07 contig_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000683 Xanthomonas translucens pv. translucens strain SIMT-07 contig_683, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000579 Xanthomonas translucens pv. translucens strain SIMT-07 contig_579, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000510 Xanthomonas translucens pv. translucens strain SIMT-07 contig_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000364 Xanthomonas translucens pv. translucens strain SIMT-07 contig_364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000485 Xanthomonas translucens pv. translucens strain SIMT-07 contig_485, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000630 Xanthomonas translucens pv. translucens strain SIMT-07 contig_630, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000175 Xanthomonas translucens pv. translucens strain SIMT-07 contig_175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000559 Xanthomonas translucens pv. translucens strain SIMT-07 contig_559, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000155 Xanthomonas translucens pv. translucens strain SIMT-07 contig_155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000026 Xanthomonas translucens pv. translucens strain SIMT-07 contig_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000024 Xanthomonas translucens pv. translucens strain SIMT-07 contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000704 Xanthomonas translucens pv. translucens strain SIMT-07 contig_705, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000298 Xanthomonas translucens pv. translucens strain SIMT-07 contig_298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000600 Xanthomonas translucens pv. translucens strain SIMT-07 contig_600, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000658 Xanthomonas translucens pv. translucens strain SIMT-07 contig_658, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000405 Xanthomonas translucens pv. translucens strain SIMT-07 contig_405, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000249 Xanthomonas translucens pv. translucens strain SIMT-07 contig_249, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000133 Xanthomonas translucens pv. translucens strain SIMT-07 contig_133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000012 Xanthomonas translucens pv. translucens strain SIMT-07 contig_12, whole genome shotgun sequence 0 crisprs Cas9_archaeal 0 0 0 0
NZ_MADQ01000007 Xanthomonas translucens pv. translucens strain SIMT-07 contig_7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000053 Xanthomonas translucens pv. translucens strain SIMT-07 contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000115 Xanthomonas translucens pv. translucens strain SIMT-07 contig_115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000614 Xanthomonas translucens pv. translucens strain SIMT-07 contig_614, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000506 Xanthomonas translucens pv. translucens strain SIMT-07 contig_506, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000596 Xanthomonas translucens pv. translucens strain SIMT-07 contig_596, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000335 Xanthomonas translucens pv. translucens strain SIMT-07 contig_335, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000340 Xanthomonas translucens pv. translucens strain SIMT-07 contig_340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000099 Xanthomonas translucens pv. translucens strain SIMT-07 contig_99, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000030 Xanthomonas translucens pv. translucens strain SIMT-07 contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000029 Xanthomonas translucens pv. translucens strain SIMT-07 contig_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000441 Xanthomonas translucens pv. translucens strain SIMT-07 contig_441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000653 Xanthomonas translucens pv. translucens strain SIMT-07 contig_653, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000445 Xanthomonas translucens pv. translucens strain SIMT-07 contig_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000503 Xanthomonas translucens pv. translucens strain SIMT-07 contig_503, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000649 Xanthomonas translucens pv. translucens strain SIMT-07 contig_649, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000198 Xanthomonas translucens pv. translucens strain SIMT-07 contig_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000652 Xanthomonas translucens pv. translucens strain SIMT-07 contig_652, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000393 Xanthomonas translucens pv. translucens strain SIMT-07 contig_393, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000054 Xanthomonas translucens pv. translucens strain SIMT-07 contig_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000685 Xanthomonas translucens pv. translucens strain SIMT-07 contig_685, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000674 Xanthomonas translucens pv. translucens strain SIMT-07 contig_674, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000138 Xanthomonas translucens pv. translucens strain SIMT-07 contig_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000223 Xanthomonas translucens pv. translucens strain SIMT-07 contig_223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000149 Xanthomonas translucens pv. translucens strain SIMT-07 contig_149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000041 Xanthomonas translucens pv. translucens strain SIMT-07 contig_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000419 Xanthomonas translucens pv. translucens strain SIMT-07 contig_419, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000190 Xanthomonas translucens pv. translucens strain SIMT-07 contig_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000216 Xanthomonas translucens pv. translucens strain SIMT-07 contig_216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000661 Xanthomonas translucens pv. translucens strain SIMT-07 contig_661, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000543 Xanthomonas translucens pv. translucens strain SIMT-07 contig_543, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000286 Xanthomonas translucens pv. translucens strain SIMT-07 contig_286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000049 Xanthomonas translucens pv. translucens strain SIMT-07 contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000592 Xanthomonas translucens pv. translucens strain SIMT-07 contig_592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000182 Xanthomonas translucens pv. translucens strain SIMT-07 contig_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000539 Xanthomonas translucens pv. translucens strain SIMT-07 contig_539, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000283 Xanthomonas translucens pv. translucens strain SIMT-07 contig_283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000408 Xanthomonas translucens pv. translucens strain SIMT-07 contig_408, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000572 Xanthomonas translucens pv. translucens strain SIMT-07 contig_572, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000394 Xanthomonas translucens pv. translucens strain SIMT-07 contig_394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_MADQ01000002 Xanthomonas translucens pv. translucens strain SIMT-07 contig_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_MADQ01000642
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000642_1 1-158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_MADQ01000351
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000351_1 159-271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_MADQ01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 742 : 31104 40 Siphoviridae_environmental_samples(34.78%) terminase,lysis,tail,integrase attL 545:559|attR 29867:29881
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_MADQ01000001.1|WP_058195519.1|2309_2594_+|hypothetical-protein 2309_2594_+ 94 aa aa AcrIC10 NA NA 742-31104 yes
NZ_MADQ01000001.1|WP_058195493.1|28878_29391_-|lysis-protein 28878_29391_- 170 aa aa NA NA NA 742-31104 yes
4. NZ_MADQ01000213
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000213_1 65-176 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_MADQ01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000011_1 12111-16030 TypeI I-C
59 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_MADQ01000011_1 1.39|14691|35|NZ_MADQ01000011|PILER-CR 14691-14725 35 NZ_MADQ01000001.1 27792-27826 0 1.0
NZ_MADQ01000011_1 1.41|14825|34|NZ_MADQ01000011|PILER-CR 14825-14858 34 NZ_MADQ01000001.1 30110-30143 0 1.0
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_MADQ01000001.1 33567-33600 0 1.0
NZ_MADQ01000011_1 1.58|15958|33|NZ_MADQ01000011|PILER-CR 15958-15990 33 NZ_MADQ01000001.1 13809-13841 0 1.0
NZ_MADQ01000011_1 1.97|14652|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14652-14686 35 NZ_MADQ01000001.1 27792-27826 0 1.0
NZ_MADQ01000011_1 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 14784-14817 34 NZ_MADQ01000001.1 30110-30143 0 1.0
NZ_MADQ01000011_1 1.112|15636|35|NZ_MADQ01000011|CRT 15636-15670 35 NZ_MADQ01000001.1 33566-33600 0 1.0
NZ_MADQ01000011_1 1.116|15901|33|NZ_MADQ01000011|CRT,CRISPRCasFinder 15901-15933 33 NZ_MADQ01000001.1 13809-13841 0 1.0
NZ_MADQ01000011_1 1.117|15965|35|NZ_MADQ01000011|CRT,CRISPRCasFinder 15965-15999 35 NZ_MADQ01000001.1 8982-9016 1 0.971

1. spacer 1.39|14691|35|NZ_MADQ01000011|PILER-CR matches to position: 27792-27826, mismatch: 0, identity: 1.0

cgcagtctctggccggagattgagctgaaccgctc	CRISPR spacer
cgcagtctctggccggagattgagctgaaccgctc	Protospacer
***********************************

2. spacer 1.41|14825|34|NZ_MADQ01000011|PILER-CR matches to position: 30110-30143, mismatch: 0, identity: 1.0

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcggatgtggcaagagcggcgtcgtccagatccg	Protospacer
**********************************

3. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to position: 33567-33600, mismatch: 0, identity: 1.0

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tccaagtcgggatggtccgcggcgccggcgcggc	Protospacer
**********************************

4. spacer 1.58|15958|33|NZ_MADQ01000011|PILER-CR matches to position: 13809-13841, mismatch: 0, identity: 1.0

ccgtactacgtcaccggcaacttcgagggtggt	CRISPR spacer
ccgtactacgtcaccggcaacttcgagggtggt	Protospacer
*********************************

5. spacer 1.97|14652|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to position: 27792-27826, mismatch: 0, identity: 1.0

cgcagtctctggccggagattgagctgaaccgctc	CRISPR spacer
cgcagtctctggccggagattgagctgaaccgctc	Protospacer
***********************************

6. spacer 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to position: 30110-30143, mismatch: 0, identity: 1.0

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcggatgtggcaagagcggcgtcgtccagatccg	Protospacer
**********************************

7. spacer 1.112|15636|35|NZ_MADQ01000011|CRT matches to position: 33566-33600, mismatch: 0, identity: 1.0

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
ctccaagtcgggatggtccgcggcgccggcgcggc	Protospacer
***********************************

8. spacer 1.116|15901|33|NZ_MADQ01000011|CRT,CRISPRCasFinder matches to position: 13809-13841, mismatch: 0, identity: 1.0

ccgtactacgtcaccggcaacttcgagggtggt	CRISPR spacer
ccgtactacgtcaccggcaacttcgagggtggt	Protospacer
*********************************

9. spacer 1.117|15965|35|NZ_MADQ01000011|CRT,CRISPRCasFinder matches to position: 8982-9016, mismatch: 1, identity: 0.971

acccatgccatgtcgtcccggcgccactcgacatc	CRISPR spacer
acccaagccatgtcgtcccggcgccactcgacatc	Protospacer
***** *****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_MADQ01000011_1 1.24|13683|34|NZ_MADQ01000011|PILER-CR 13683-13716 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_MADQ01000011_1 1.24|13683|34|NZ_MADQ01000011|PILER-CR 13683-13716 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_MADQ01000011_1 1.82|13659|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13659-13692 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_MADQ01000011_1 1.82|13659|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13659-13692 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_MADQ01000011_1 1.11|12814|36|NZ_MADQ01000011|PILER-CR 12814-12849 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_MADQ01000011_1 1.11|12814|36|NZ_MADQ01000011|PILER-CR 12814-12849 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_MADQ01000011_1 1.69|12803|36|NZ_MADQ01000011|CRISPRCasFinder,CRT 12803-12838 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_MADQ01000011_1 1.69|12803|36|NZ_MADQ01000011|CRISPRCasFinder,CRT 12803-12838 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_MADQ01000011_1 1.17|13216|34|NZ_MADQ01000011|PILER-CR 13216-13249 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_MADQ01000011_1 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13199-13232 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_MADQ01000011_1 1.17|13216|34|NZ_MADQ01000011|PILER-CR 13216-13249 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_MADQ01000011_1 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13199-13232 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_MADQ01000011_1 1.17|13216|34|NZ_MADQ01000011|PILER-CR 13216-13249 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_MADQ01000011_1 1.51|15488|35|NZ_MADQ01000011|PILER-CR 15488-15522 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_MADQ01000011_1 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13199-13232 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_MADQ01000011_1 1.109|15437|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 15437-15471 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_MADQ01000011_1 1.40|14758|35|NZ_MADQ01000011|PILER-CR 14758-14792 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_MADQ01000011_1 1.98|14718|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14718-14752 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_MADQ01000011_1 1.35|14420|35|NZ_MADQ01000011|PILER-CR 14420-14454 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_MADQ01000011_1 1.35|14420|35|NZ_MADQ01000011|PILER-CR 14420-14454 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_MADQ01000011_1 1.49|15355|34|NZ_MADQ01000011|PILER-CR 15355-15388 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_MADQ01000011_1 1.49|15355|34|NZ_MADQ01000011|PILER-CR 15355-15388 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_MADQ01000011_1 1.49|15355|34|NZ_MADQ01000011|PILER-CR 15355-15388 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_MADQ01000011_1 1.49|15355|34|NZ_MADQ01000011|PILER-CR 15355-15388 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_MADQ01000011_1 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14385-14419 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_MADQ01000011_1 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14385-14419 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_MADQ01000011_1 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 15306-15339 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_MADQ01000011_1 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 15306-15339 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_MADQ01000011_1 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 15306-15339 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_MADQ01000011_1 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 15306-15339 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_MADQ01000011_1 1.112|15636|35|NZ_MADQ01000011|CRT 15636-15670 35 MN234219 Mycobacterium phage Mercurio, complete genome 14560-14594 7 0.8
NZ_MADQ01000011_1 1.15|13082|34|NZ_MADQ01000011|PILER-CR 13082-13115 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_MADQ01000011_1 1.21|13482|35|NZ_MADQ01000011|PILER-CR 13482-13516 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_MADQ01000011_1 1.33|14285|35|NZ_MADQ01000011|PILER-CR 14285-14319 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_MADQ01000011_1 1.38|14624|35|NZ_MADQ01000011|PILER-CR 14624-14658 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_MADQ01000011_1 1.41|14825|34|NZ_MADQ01000011|PILER-CR 14825-14858 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_MADQ01000011_1 1.41|14825|34|NZ_MADQ01000011|PILER-CR 14825-14858 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_MADQ01000011_1 1.41|14825|34|NZ_MADQ01000011|PILER-CR 14825-14858 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_MADQ01000011_1 1.42|14891|36|NZ_MADQ01000011|PILER-CR 14891-14926 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_MADQ01000011_1 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13067-13100 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_MADQ01000011_1 1.79|13461|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 13461-13495 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_MADQ01000011_1 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14252-14286 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_MADQ01000011_1 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14586-14620 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_MADQ01000011_1 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 14784-14817 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_MADQ01000011_1 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 14784-14817 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_MADQ01000011_1 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 14784-14817 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_MADQ01000011_1 1.100|14849|36|NZ_MADQ01000011|CRISPRCasFinder,CRT 14849-14884 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_MADQ01000011_1 1.112|15636|35|NZ_MADQ01000011|CRT 15636-15670 35 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35857 8 0.771
NZ_MADQ01000011_1 1.13|12950|34|NZ_MADQ01000011|PILER-CR 12950-12983 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_MADQ01000011_1 1.13|12950|34|NZ_MADQ01000011|PILER-CR 12950-12983 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_MADQ01000011_1 1.15|13082|34|NZ_MADQ01000011|PILER-CR 13082-13115 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_MADQ01000011_1 1.38|14624|35|NZ_MADQ01000011|PILER-CR 14624-14658 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_MADQ01000011_1 1.39|14691|35|NZ_MADQ01000011|PILER-CR 14691-14725 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_MADQ01000011_1 1.41|14825|34|NZ_MADQ01000011|PILER-CR 14825-14858 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_MADQ01000011_1 1.44|15024|33|NZ_MADQ01000011|PILER-CR 15024-15056 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_MADQ01000011_1 1.71|12937|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 12937-12970 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_MADQ01000011_1 1.71|12937|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 12937-12970 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_MADQ01000011_1 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13067-13100 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_MADQ01000011_1 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14586-14620 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_MADQ01000011_1 1.97|14652|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14652-14686 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_MADQ01000011_1 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 14784-14817 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_MADQ01000011_1 1.102|14980|33|NZ_MADQ01000011|CRISPRCasFinder,CRT 14980-15012 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_MADQ01000011_1 1.112|15636|35|NZ_MADQ01000011|CRT 15636-15670 35 MN234185 Mycobacterium phage Lemuria, complete genome 13916-13950 9 0.743
NZ_MADQ01000011_1 1.8|12611|35|NZ_MADQ01000011|PILER-CR 12611-12645 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_MADQ01000011_1 1.8|12611|35|NZ_MADQ01000011|PILER-CR 12611-12645 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_MADQ01000011_1 1.23|13617|34|NZ_MADQ01000011|PILER-CR 13617-13650 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_MADQ01000011_1 1.23|13617|34|NZ_MADQ01000011|PILER-CR 13617-13650 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_MADQ01000011_1 1.35|14420|35|NZ_MADQ01000011|PILER-CR 14420-14454 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_MADQ01000011_1 1.36|14487|37|NZ_MADQ01000011|PILER-CR 14487-14523 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_MADQ01000011_1 1.42|14891|36|NZ_MADQ01000011|PILER-CR 14891-14926 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_MADQ01000011_1 1.66|12603|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 12603-12637 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_MADQ01000011_1 1.66|12603|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 12603-12637 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_MADQ01000011_1 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13594-13627 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_MADQ01000011_1 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13594-13627 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_MADQ01000011_1 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14385-14419 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_MADQ01000011_1 1.94|14451|37|NZ_MADQ01000011|CRISPRCasFinder,CRT 14451-14487 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_MADQ01000011_1 1.100|14849|36|NZ_MADQ01000011|CRISPRCasFinder,CRT 14849-14884 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_MADQ01000011_1 1.112|15636|35|NZ_MADQ01000011|CRT 15636-15670 35 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375385-375419 10 0.714
NZ_MADQ01000011_1 1.15|13082|34|NZ_MADQ01000011|PILER-CR 13082-13115 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_MADQ01000011_1 1.15|13082|34|NZ_MADQ01000011|PILER-CR 13082-13115 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_MADQ01000011_1 1.23|13617|34|NZ_MADQ01000011|PILER-CR 13617-13650 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_MADQ01000011_1 1.23|13617|34|NZ_MADQ01000011|PILER-CR 13617-13650 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_MADQ01000011_1 1.38|14624|35|NZ_MADQ01000011|PILER-CR 14624-14658 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_MADQ01000011_1 1.46|15156|34|NZ_MADQ01000011|PILER-CR 15156-15189 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_MADQ01000011_1 1.54|15690|34|NZ_MADQ01000011|PILER-CR 15690-15723 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_MADQ01000011_1 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13067-13100 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_MADQ01000011_1 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13067-13100 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_MADQ01000011_1 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13594-13627 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_MADQ01000011_1 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 13594-13627 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_MADQ01000011_1 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT 14586-14620 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_MADQ01000011_1 1.104|15110|34|NZ_MADQ01000011|CRISPRCasFinder,CRT 15110-15143 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676

1. spacer 1.24|13683|34|NZ_MADQ01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

2. spacer 1.24|13683|34|NZ_MADQ01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

3. spacer 1.82|13659|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

4. spacer 1.82|13659|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

5. spacer 1.11|12814|36|NZ_MADQ01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

6. spacer 1.11|12814|36|NZ_MADQ01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

7. spacer 1.69|12803|36|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

8. spacer 1.69|12803|36|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

9. spacer 1.17|13216|34|NZ_MADQ01000011|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
cagtgtgcagcaccgtggcccctcttgcgaaggg	Protospacer
 ******** *.**********************

10. spacer 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
cagtgtgcagcaccgtggcccctcttgcgaaggg	Protospacer
 ******** *.**********************

11. spacer 1.17|13216|34|NZ_MADQ01000011|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
gtatgtgcatcaccgtggcccctcttgcgaaggg	Protospacer
. .********.**********************

12. spacer 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
gtatgtgcatcaccgtggcccctcttgcgaaggg	Protospacer
. .********.**********************

13. spacer 1.17|13216|34|NZ_MADQ01000011|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
ttgcgtgtatctccgtggcccctcttgcgaaggg	Protospacer
  *.***.*** **********************

14. spacer 1.51|15488|35|NZ_MADQ01000011|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggccaacctggtggtgctggtcttcacttccag	CRISPR spacer
ctggccaacctggtcgtgctggtgttcacgaacag	Protospacer
************** ******** *****   ***

15. spacer 1.75|13199|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
ttgcgtgtatctccgtggcccctcttgcgaaggg	Protospacer
  *.***.*** **********************

16. spacer 1.109|15437|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggccaacctggtggtgctggtcttcacttccag	CRISPR spacer
ctggccaacctggtcgtgctggtgttcacgaacag	Protospacer
************** ******** *****   ***

17. spacer 1.40|14758|35|NZ_MADQ01000011|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

tgtacaaggcgcacaggctagcatggctc-catgtc	CRISPR spacer
agtacaaggcgcacaagctcgcatggcttgcctgt-	Protospacer
 **************.*** ********. * *** 

18. spacer 1.98|14718|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

tgtacaaggcgcacaggctagcatggctc-catgtc	CRISPR spacer
agtacaaggcgcacaagctcgcatggcttgcctgt-	Protospacer
 **************.*** ********. * *** 

19. spacer 1.35|14420|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

20. spacer 1.35|14420|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

21. spacer 1.49|15355|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

22. spacer 1.49|15355|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

23. spacer 1.49|15355|34|NZ_MADQ01000011|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

24. spacer 1.49|15355|34|NZ_MADQ01000011|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc	CRISPR spacer
tcgtgggggtcggcctggcaaatctgtgtcgccc	Protospacer
***  *  * ***************  *******

25. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tgattctcgggaagggccgcggcgccggcgcggc	Protospacer
*     ****** ** ******************

26. spacer 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

27. spacer 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

28. spacer 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

29. spacer 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

30. spacer 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *   

31. spacer 1.107|15306|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

tcgatgccggcggcctggcaaatctcagtcgccc	CRISPR spacer
tcgtgggggtcggcctggcaaatctgtgtcgccc	Protospacer
***  *  * ***************  *******

32. spacer 1.112|15636|35|NZ_MADQ01000011|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.8

----ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgattc----tcgggaagggccgcggcgccggcgcggc	Protospacer
    .**    ****** ** ******************

33. spacer 1.15|13082|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gcctttggccgggccgaggcacagctggcggcgg	Protospacer
  ** . *************** * ********.

34. spacer 1.21|13482|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

tgaacacggtcgctgaagaactcgccaccagagag	CRISPR spacer
tgaacacggtcgccgaagaactcgcactgtcagaa	Protospacer
*************.***********  .   ***.

35. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

36. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

37. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

38. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

39. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

40. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

41. spacer 1.33|14285|35|NZ_MADQ01000011|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

42. spacer 1.38|14624|35|NZ_MADQ01000011|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
aggcgcgaaagcagcaaggccggtaaccgggatac	Protospacer
*.****** ************** **** * *  .

43. spacer 1.41|14825|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

44. spacer 1.41|14825|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

45. spacer 1.41|14825|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

46. spacer 1.42|14891|36|NZ_MADQ01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

cgggacgc---ggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
---gatgtgcaggcgctgggcgtcgtcgacgccgcgcgg	Protospacer
   **.*.   *********.***** *********** 

47. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
ggcacgaatggacggtccgcggcgccggcgaggc	Protospacer
  ** *   ***.***************** ***

48. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tcattctcgggaagggccgcggcgccggcgctcc	Protospacer
**    ****** ** ***************  *

49. spacer 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gcctttggccgggccgaggcacagctggcggcgg	Protospacer
  ** . *************** * ********.

50. spacer 1.79|13461|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

tgaacacggtcgctgaagaactcgccaccagagag	CRISPR spacer
tgaacacggtcgccgaagaactcgcactgtcagaa	Protospacer
*************.***********  .   ***.

51. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

52. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

53. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

54. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

55. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

56. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

57. spacer 1.91|14252|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

58. spacer 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
aggcgcgaaagcagcaaggccggtaaccgggatac	Protospacer
*.****** ************** **** * *  .

59. spacer 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

60. spacer 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

61. spacer 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

62. spacer 1.100|14849|36|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

cgggacgc---ggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
---gatgtgcaggcgctgggcgtcgtcgacgccgcgcgg	Protospacer
   **.*.   *********.***** *********** 

63. spacer 1.112|15636|35|NZ_MADQ01000011|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.771

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
cggcacgaatggacggtccgcggcgccggcgaggc	Protospacer
*  ** *   ***.***************** ***

64. spacer 1.13|12950|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

65. spacer 1.13|12950|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

66. spacer 1.15|13082|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tactactg----ccgggccgaggcactggtggcggcga	CRISPR spacer
----gcggtgaccctggccgaggcactggtggcggccg	Protospacer
    .* *    ** ********************* .

67. spacer 1.38|14624|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
tcgcgcgacggcagcaaggccggcaacatcgtgcg	Protospacer
  *******.************* *** *   ** 

68. spacer 1.39|14691|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

cgcagtc-tctggccggagattgagctgaaccgctc	CRISPR spacer
-gcgaccgaacggccgaagattgcgctgaaccgctc	Protospacer
 **...*   .*****.****** ************

69. spacer 1.41|14825|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
atggcccgggcaagatcggcctcgtccagatcgg	Protospacer
 .** .  ******* **** *********** *

70. spacer 1.44|15024|33|NZ_MADQ01000011|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

acggtgatccgatgctgggcgatgtctgggatg	CRISPR spacer
ccggtgacccgctgctgggcgatgtcgatgcca	Protospacer
 ******.*** ************** . * ..

71. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tcagcgtcggggtcgtccgcggcgccggcgactt	Protospacer
** . ******.* ****************   .

72. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..* 

73. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..* 

74. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..* 

75. spacer 1.71|12937|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

76. spacer 1.71|12937|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

77. spacer 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tactactg----ccgggccgaggcactggtggcggcga	CRISPR spacer
----gcggtgaccctggccgaggcactggtggcggccg	Protospacer
    .* *    ** ********************* .

78. spacer 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
tcgcgcgacggcagcaaggccggcaacatcgtgcg	Protospacer
  *******.************* *** *   ** 

79. spacer 1.97|14652|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

cgcagtc-tctggccggagattgagctgaaccgctc	CRISPR spacer
-gcgaccgaacggccgaagattgcgctgaaccgctc	Protospacer
 **...*   .*****.****** ************

80. spacer 1.99|14784|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
atggcccgggcaagatcggcctcgtccagatcgg	Protospacer
 .** .  ******* **** *********** *

81. spacer 1.102|14980|33|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

acggtgatccgatgctgggcgatgtctgggatg	CRISPR spacer
ccggtgacccgctgctgggcgatgtcgatgcca	Protospacer
 ******.*** ************** . * ..

82. spacer 1.112|15636|35|NZ_MADQ01000011|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 9, identity: 0.743

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtcattctcgggaagggccgcggcgccggcgctcc	Protospacer
 **    ****** ** ***************  *

83. spacer 1.8|12611|35|NZ_MADQ01000011|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
gatgcccaacgccccgcccagcaccgcgaccagca	Protospacer
*  *. ..  ************ ****** *****

84. spacer 1.8|12611|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
accgagcgcggccccgcccagcgccgccagcacaa	Protospacer
.. * ..*************** **** ****  *

85. spacer 1.23|13617|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

86. spacer 1.23|13617|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

87. spacer 1.35|14420|35|NZ_MADQ01000011|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcacggatttacgatggacgacatggtcaacga	Protospacer
* . *.    **************** **** ***

88. spacer 1.36|14487|37|NZ_MADQ01000011|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

acctgcttgcggcgcagttcggcggcctgcaggtcca	CRISPR spacer
accatgccgcggcgcaggtcggcgccctgcaggttgg	Protospacer
***   ..********* ****** *********. .

89. spacer 1.42|14891|36|NZ_MADQ01000011|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

cgggacgcggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
gtggacgcggcgctgggcgtcgtggtcgtcaagatg	Protospacer
  ***************.******* **.*. *   

90. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgcgatcggcatggtgcgcggcgccggcgggcc	Protospacer
 .  ..**** ***** ************* * *

91. spacer 1.66|12603|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
gatgcccaacgccccgcccagcaccgcgaccagca	Protospacer
*  *. ..  ************ ****** *****

92. spacer 1.66|12603|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
accgagcgcggccccgcccagcgccgccagcacaa	Protospacer
.. * ..*************** **** ****  *

93. spacer 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

94. spacer 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

95. spacer 1.93|14385|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcacggatttacgatggacgacatggtcaacga	Protospacer
* . *.    **************** **** ***

96. spacer 1.94|14451|37|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

acctgcttgcggcgcagttcggcggcctgcaggtcca	CRISPR spacer
accatgccgcggcgcaggtcggcgccctgcaggttgg	Protospacer
***   ..********* ****** *********. .

97. spacer 1.100|14849|36|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

cgggacgcggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
gtggacgcggcgctgggcgtcgtggtcgtcaagatg	Protospacer
  ***************.******* **.*. *   

98. spacer 1.112|15636|35|NZ_MADQ01000011|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.714

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtcagcgtcggggtcgtccgcggcgccggcgactt	Protospacer
 ** . ******.* ****************   .

99. spacer 1.15|13082|34|NZ_MADQ01000011|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

----tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gaggtggcg----cgggccgaggcgcaggtggcggcgg	Protospacer
    *. ..    ***********.* **********.

100. spacer 1.15|13082|34|NZ_MADQ01000011|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
agcgcgaaccgggccgaggcactggcgtcggctg	Protospacer
 .*    .*****************.* **** .

101. spacer 1.23|13617|34|NZ_MADQ01000011|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
attcaacaccttcatcaccaccccatataagcca	Protospacer
*********** ******** ***.. . * .  

102. spacer 1.23|13617|34|NZ_MADQ01000011|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
ctgtccgtgctgcatcaccagcccgccccagtat	Protospacer
 * .     *******************.* **.

103. spacer 1.38|14624|35|NZ_MADQ01000011|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
ctgaccgacatcagcaaggcctggaacctgggcac	Protospacer
  *  ***** ********** ******** .  .

104. spacer 1.46|15156|34|NZ_MADQ01000011|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

ggtgatcatcctcgacgagtgctacaccgttttc	CRISPR spacer
tcctatcatcatcgacgggtgctacacccgtcgt	Protospacer
  . ****** ******.**********  *. .

105. spacer 1.54|15690|34|NZ_MADQ01000011|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgcgatcggcatggtgcgcggcgccggcggtcc	Protospacer
 .  ..**** ***** *************   *

106. spacer 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

----tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gaggtggcg----cgggccgaggcgcaggtggcggcgg	Protospacer
    *. ..    ***********.* **********.

107. spacer 1.73|13067|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
agcgcgaaccgggccgaggcactggcgtcggctg	Protospacer
 .*    .*****************.* **** .

108. spacer 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
attcaacaccttcatcaccaccccatataagcca	Protospacer
*********** ******** ***.. . * .  

109. spacer 1.81|13594|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
ctgtccgtgctgcatcaccagcccgccccagtat	Protospacer
 * .     *******************.* **.

110. spacer 1.96|14586|35|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
ctgaccgacatcagcaaggcctggaacctgggcac	Protospacer
  *  ***** ********** ******** .  .

111. spacer 1.104|15110|34|NZ_MADQ01000011|CRISPRCasFinder,CRT matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

ggtgatcatcctcgacgagtgctacaccgttttc	CRISPR spacer
tcctatcatcatcgacgggtgctacacccgtcgt	Protospacer
  . ****** ******.**********  *. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_MADQ01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15302 : 21647 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_MADQ01000125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000125_1 8821-8923 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_MADQ01000070
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_MADQ01000070_1 3178-3321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage