Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LODH01000098 Pseudomonas aeruginosa strain 105777 LT17_contig000099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000031 Pseudomonas aeruginosa strain 105777 LT17_contig000031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000050 Pseudomonas aeruginosa strain 105777 LT17_contig000050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000047 Pseudomonas aeruginosa strain 105777 LT17_contig000047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000105 Pseudomonas aeruginosa strain 105777 LT17_contig000106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000010 Pseudomonas aeruginosa strain 105777 LT17_contig000010, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_LODH01000006 Pseudomonas aeruginosa strain 105777 LT17_contig000006, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LODH01000072 Pseudomonas aeruginosa strain 105777 LT17_contig000073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000043 Pseudomonas aeruginosa strain 105777 LT17_contig000043, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000083 Pseudomonas aeruginosa strain 105777 LT17_contig000084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000019 Pseudomonas aeruginosa strain 105777 LT17_contig000019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000042 Pseudomonas aeruginosa strain 105777 LT17_contig000042, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LODH01000103 Pseudomonas aeruginosa strain 105777 LT17_contig000104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000084 Pseudomonas aeruginosa strain 105777 LT17_contig000085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000096 Pseudomonas aeruginosa strain 105777 LT17_contig000097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000074 Pseudomonas aeruginosa strain 105777 LT17_contig000075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000052 Pseudomonas aeruginosa strain 105777 LT17_contig000052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000067 Pseudomonas aeruginosa strain 105777 LT17_contig000068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000039 Pseudomonas aeruginosa strain 105777 LT17_contig000039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000037 Pseudomonas aeruginosa strain 105777 LT17_contig000037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000058 Pseudomonas aeruginosa strain 105777 LT17_contig000059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000035 Pseudomonas aeruginosa strain 105777 LT17_contig000035, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_LODH01000075 Pseudomonas aeruginosa strain 105777 LT17_contig000076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000054 Pseudomonas aeruginosa strain 105777 LT17_contig000054, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LODH01000021 Pseudomonas aeruginosa strain 105777 LT17_contig000021, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_LODH01000079 Pseudomonas aeruginosa strain 105777 LT17_contig000080, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_LODH01000051 Pseudomonas aeruginosa strain 105777 LT17_contig000051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000063 Pseudomonas aeruginosa strain 105777 LT17_contig000064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000100 Pseudomonas aeruginosa strain 105777 LT17_contig000101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000012 Pseudomonas aeruginosa strain 105777 LT17_contig000012, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LODH01000028 Pseudomonas aeruginosa strain 105777 LT17_contig000028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000014 Pseudomonas aeruginosa strain 105777 LT17_contig000014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000001 Pseudomonas aeruginosa strain 105777 LT17_contig000001, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000064 Pseudomonas aeruginosa strain 105777 LT17_contig000065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000091 Pseudomonas aeruginosa strain 105777 LT17_contig000092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000087 Pseudomonas aeruginosa strain 105777 LT17_contig000088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000026 Pseudomonas aeruginosa strain 105777 LT17_contig000026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000101 Pseudomonas aeruginosa strain 105777 LT17_contig000102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000040 Pseudomonas aeruginosa strain 105777 LT17_contig000040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000078 Pseudomonas aeruginosa strain 105777 LT17_contig000079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000088 Pseudomonas aeruginosa strain 105777 LT17_contig000089, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LODH01000045 Pseudomonas aeruginosa strain 105777 LT17_contig000045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000081 Pseudomonas aeruginosa strain 105777 LT17_contig000082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000070 Pseudomonas aeruginosa strain 105777 LT17_contig000071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000044 Pseudomonas aeruginosa strain 105777 LT17_contig000044, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000073 Pseudomonas aeruginosa strain 105777 LT17_contig000074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000027 Pseudomonas aeruginosa strain 105777 LT17_contig000027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000007 Pseudomonas aeruginosa strain 105777 LT17_contig000007, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LODH01000099 Pseudomonas aeruginosa strain 105777 LT17_contig000100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000057 Pseudomonas aeruginosa strain 105777 LT17_contig000058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000056 Pseudomonas aeruginosa strain 105777 LT17_contig000057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000008 Pseudomonas aeruginosa strain 105777 LT17_contig000008, whole genome shotgun sequence 1 crisprs NA 5 0 0 0
NZ_LODH01000022 Pseudomonas aeruginosa strain 105777 LT17_contig000022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000090 Pseudomonas aeruginosa strain 105777 LT17_contig000091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000016 Pseudomonas aeruginosa strain 105777 LT17_contig000016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000095 Pseudomonas aeruginosa strain 105777 LT17_contig000096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000009 Pseudomonas aeruginosa strain 105777 LT17_contig000009, whole genome shotgun sequence 0 crisprs DEDDh,DinG 0 0 0 0
NZ_LODH01000076 Pseudomonas aeruginosa strain 105777 LT17_contig000077, whole genome shotgun sequence 1 crisprs NA 0 2 0 0
NZ_LODH01000048 Pseudomonas aeruginosa strain 105777 LT17_contig000048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000004 Pseudomonas aeruginosa strain 105777 LT17_contig000004, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000092 Pseudomonas aeruginosa strain 105777 LT17_contig000093, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000062 Pseudomonas aeruginosa strain 105777 LT17_contig000063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000038 Pseudomonas aeruginosa strain 105777 LT17_contig000038, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000104 Pseudomonas aeruginosa strain 105777 LT17_contig000105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000023 Pseudomonas aeruginosa strain 105777 LT17_contig000023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000005 Pseudomonas aeruginosa strain 105777 LT17_contig000005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000085 Pseudomonas aeruginosa strain 105777 LT17_contig000086, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000041 Pseudomonas aeruginosa strain 105777 LT17_contig000041, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_LODH01000069 Pseudomonas aeruginosa strain 105777 LT17_contig000070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000093 Pseudomonas aeruginosa strain 105777 LT17_contig000094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000082 Pseudomonas aeruginosa strain 105777 LT17_contig000083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000020 Pseudomonas aeruginosa strain 105777 LT17_contig000020, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000061 Pseudomonas aeruginosa strain 105777 LT17_contig000062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000065 Pseudomonas aeruginosa strain 105777 LT17_contig000066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000013 Pseudomonas aeruginosa strain 105777 LT17_contig000013, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LODH01000036 Pseudomonas aeruginosa strain 105777 LT17_contig000036, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LODH01000046 Pseudomonas aeruginosa strain 105777 LT17_contig000046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000011 Pseudomonas aeruginosa strain 105777 LT17_contig000011, whole genome shotgun sequence 0 crisprs cas3,WYL 0 0 1 0
NZ_LODH01000071 Pseudomonas aeruginosa strain 105777 LT17_contig000072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000080 Pseudomonas aeruginosa strain 105777 LT17_contig000081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000055 Pseudomonas aeruginosa strain 105777 LT17_contig000056, whole genome shotgun sequence 0 crisprs RT,csa3 0 0 1 0
NZ_LODH01000024 Pseudomonas aeruginosa strain 105777 LT17_contig000024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000029 Pseudomonas aeruginosa strain 105777 LT17_contig000029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000015 Pseudomonas aeruginosa strain 105777 LT17_contig000015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000025 Pseudomonas aeruginosa strain 105777 LT17_contig000025, whole genome shotgun sequence 1 crisprs DEDDh,cas3 1 3 0 0
NZ_LODH01000097 Pseudomonas aeruginosa strain 105777 LT17_contig000098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000086 Pseudomonas aeruginosa strain 105777 LT17_contig000087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000068 Pseudomonas aeruginosa strain 105777 LT17_contig000069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000066 Pseudomonas aeruginosa strain 105777 LT17_contig000067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000032 Pseudomonas aeruginosa strain 105777 LT17_contig000032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000060 Pseudomonas aeruginosa strain 105777 LT17_contig000061, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LODH01000030 Pseudomonas aeruginosa strain 105777 LT17_contig000030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000018 Pseudomonas aeruginosa strain 105777 LT17_contig000018, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_LODH01000003 Pseudomonas aeruginosa strain 105777 LT17_contig000003, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LODH01000089 Pseudomonas aeruginosa strain 105777 LT17_contig000090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000059 Pseudomonas aeruginosa strain 105777 LT17_contig000060, whole genome shotgun sequence 1 crisprs NA 0 1 1 0
NZ_LODH01000034 Pseudomonas aeruginosa strain 105777 LT17_contig000034, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LODH01000077 Pseudomonas aeruginosa strain 105777 LT17_contig000078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000033 Pseudomonas aeruginosa strain 105777 LT17_contig000033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000002 Pseudomonas aeruginosa strain 105777 LT17_contig000002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000049 Pseudomonas aeruginosa strain 105777 LT17_contig000049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000094 Pseudomonas aeruginosa strain 105777 LT17_contig000095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000102 Pseudomonas aeruginosa strain 105777 LT17_contig000103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LODH01000053 Pseudomonas aeruginosa strain 105777 LT17_contig000053, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_LODH01000017 Pseudomonas aeruginosa strain 105777 LT17_contig000017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LODH01000055
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 122 : 36820 44 uncultured_Caudovirales_phage(25.0%) plate,tail,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LODH01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LODH01000008_1 85-408 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LODH01000008_1 1.1|124|18|NZ_LODH01000008|CRT 124-141 18 NZ_LODH01000008.1 10-27 0 1.0
NZ_LODH01000008_1 1.4|295|18|NZ_LODH01000008|CRT 295-312 18 NZ_LODH01000008.1 10-27 0 1.0
NZ_LODH01000008_1 1.1|124|18|NZ_LODH01000008|CRT 124-141 18 NZ_LODH01000013.1 63890-63907 1 0.944
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000008.1 67-84 1 0.944
NZ_LODH01000008_1 1.4|295|18|NZ_LODH01000008|CRT 295-312 18 NZ_LODH01000013.1 63890-63907 1 0.944
NZ_LODH01000008_1 1.1|124|18|NZ_LODH01000008|CRT 124-141 18 NZ_LODH01000001.1 208356-208373 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000007.1 332080-332097 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000015.1 50084-50101 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000037.1 21900-21917 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000037.1 76535-76552 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000041.1 82488-82505 2 0.889
NZ_LODH01000008_1 1.2|181|18|NZ_LODH01000008|CRT 181-198 18 NZ_LODH01000070.1 21814-21831 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000001.1 67403-67420 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000006.1 67523-67540 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000009.1 205842-205859 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000018.1 51903-51920 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000030.1 49628-49645 2 0.889
NZ_LODH01000008_1 1.3|238|18|NZ_LODH01000008|CRT 238-255 18 NZ_LODH01000035.1 33575-33592 2 0.889
NZ_LODH01000008_1 1.4|295|18|NZ_LODH01000008|CRT 295-312 18 NZ_LODH01000001.1 208356-208373 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000007.1 332080-332097 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000015.1 50084-50101 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000037.1 21900-21917 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000037.1 76535-76552 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000041.1 82488-82505 2 0.889
NZ_LODH01000008_1 1.5|352|18|NZ_LODH01000008|CRT 352-369 18 NZ_LODH01000070.1 21814-21831 2 0.889

1. spacer 1.1|124|18|NZ_LODH01000008|CRT matches to position: 10-27, mismatch: 0, identity: 1.0

tcggcgccgaggccagga	CRISPR spacer
tcggcgccgaggccagga	Protospacer
******************

2. spacer 1.4|295|18|NZ_LODH01000008|CRT matches to position: 10-27, mismatch: 0, identity: 1.0

tcggcgccgaggccagga	CRISPR spacer
tcggcgccgaggccagga	Protospacer
******************

3. spacer 1.1|124|18|NZ_LODH01000008|CRT matches to position: 63890-63907, mismatch: 1, identity: 0.944

tcggcgccgaggccagga	CRISPR spacer
tccgcgccgaggccagga	Protospacer
** ***************

4. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 67-84, mismatch: 1, identity: 0.944

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgccgaggtcgatc	Protospacer
*******.**********

5. spacer 1.4|295|18|NZ_LODH01000008|CRT matches to position: 63890-63907, mismatch: 1, identity: 0.944

tcggcgccgaggccagga	CRISPR spacer
tccgcgccgaggccagga	Protospacer
** ***************

6. spacer 1.1|124|18|NZ_LODH01000008|CRT matches to position: 208356-208373, mismatch: 2, identity: 0.889

tcggcgccgaggccagga	CRISPR spacer
tcagcgccgagaccagga	Protospacer
**.********.******

7. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 332080-332097, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgcggagaccagga	Protospacer
******* ***.******

8. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 50084-50101, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgtcgaggccggga	Protospacer
******.*******.***

9. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 21900-21917, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgcagcggccagga	Protospacer
******* * ********

10. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 76535-76552, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
cctgcgccgcggccagga	Protospacer
** ****** ********

11. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 82488-82505, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
cctgcgccgcggccagga	Protospacer
** ****** ********

12. spacer 1.2|181|18|NZ_LODH01000008|CRT matches to position: 21814-21831, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccgccgccgaggccatga	Protospacer
*** *********** **

13. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 67403-67420, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcgccgctcaggtcgatc	Protospacer
*** **** *********

14. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 67523-67540, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgccgaggttgatc	Protospacer
*******.*****.****

15. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 205842-205859, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgctgatgtcgttc	Protospacer
********** **** **

16. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 51903-51920, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgctgaagccgatc	Protospacer
**********.*.*****

17. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 49628-49645, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgttgatgtcgatc	Protospacer
******.*** *******

18. spacer 1.3|238|18|NZ_LODH01000008|CRT matches to position: 33575-33592, mismatch: 2, identity: 0.889

gcggcgctgaggtcgatc	CRISPR spacer
gcggcgctgccgtcgatc	Protospacer
*********  *******

19. spacer 1.4|295|18|NZ_LODH01000008|CRT matches to position: 208356-208373, mismatch: 2, identity: 0.889

tcggcgccgaggccagga	CRISPR spacer
tcagcgccgagaccagga	Protospacer
**.********.******

20. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 332080-332097, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgcggagaccagga	Protospacer
******* ***.******

21. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 50084-50101, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgtcgaggccggga	Protospacer
******.*******.***

22. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 21900-21917, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccggcgcagcggccagga	Protospacer
******* * ********

23. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 76535-76552, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
cctgcgccgcggccagga	Protospacer
** ****** ********

24. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 82488-82505, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
cctgcgccgcggccagga	Protospacer
** ****** ********

25. spacer 1.5|352|18|NZ_LODH01000008|CRT matches to position: 21814-21831, mismatch: 2, identity: 0.889

ccggcgccgaggccagga	CRISPR spacer
ccgccgccgaggccatga	Protospacer
*** *********** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LODH01000053
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 210 : 16835 19 Pseudomonas_phage(89.47%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LODH01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_LODH01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LODH01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_LODH01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55662 : 59082 7 Pseudomonas_phage(100.0%) holin NA
DBSCAN-SWA_2 73107 : 101062 28 Pseudomonas_phage(75.0%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_LODH01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_LODH01000076
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LODH01000076_1 17925-18135 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 36265-36319 0 1.0
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 257505-257559 0 1.0
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 122500-122554 0 1.0
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 44775-44829 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 28264-28318 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 183990-184044 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 191945-191999 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 234828-234882 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 70171-70225 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 187709-187763 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 191402-191456 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 208093-208147 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 196427-196481 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 354045-354099 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 35526-35580 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 113664-113718 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 211283-211337 1 0.982
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 329126-329180 2 0.964
NZ_LODH01000076_1 1.2|18059|55|NZ_LODH01000076|PILER-CR 18059-18113 55 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 29793-29847 2 0.964
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 36343-36412 10 0.857
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 257583-257652 10 0.857
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 122407-122476 10 0.857
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 329204-329273 12 0.829
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 29700-29769 12 0.829
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 44853-44922 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 28342-28411 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 183897-183966 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 191852-191921 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 234735-234804 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 70078-70147 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 187616-187685 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 191309-191378 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 208000-208069 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 196334-196403 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 353952-354021 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 35604-35673 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 113742-113811 14 0.8
NZ_LODH01000076_1 1.1|17957|70|NZ_LODH01000076|PILER-CR 17957-18026 70 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 211190-211259 14 0.8

1. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 0, identity: 1.0

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	Protospacer
*******************************************************

2. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	Protospacer
*******************************************************

3. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 0, identity: 1.0

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	Protospacer
*******************************************************

4. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

5. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

6. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

7. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

8. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

9. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

10. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

11. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

12. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

13. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

14. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

15. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

16. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

17. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 1, identity: 0.982

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacggacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
************************************************ ******

18. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.964

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacgaacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
***************.******************************** ******

19. spacer 1.2|18059|55|NZ_LODH01000076|PILER-CR matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.964

caggctgttggcacggacgccgtccatcacgataccgaccgcgccggccccggtc	CRISPR spacer
caggctgttggcacgaacgccgtccatcacgataccgaccgcgccggcgccggtc	Protospacer
***************.******************************** ******

20. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 10, identity: 0.857

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	Protospacer
************************************************************

21. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 10, identity: 0.857

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	Protospacer
************************************************************

22. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 10, identity: 0.857

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	Protospacer
************************************************************

23. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 12, identity: 0.829

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
tgccagcttggtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	Protospacer
* ******* **************************************************

24. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.829

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
tgccagcttggtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	Protospacer
* ******* **************************************************

25. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

26. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

27. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

28. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

29. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

30. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

31. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

32. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

33. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

34. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

35. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

36. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

37. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

38. spacer 1.1|17957|70|NZ_LODH01000076|PILER-CR matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 14, identity: 0.8

ttccagcttcgtgttgccgatctcgataccacgggctttgtcggtttctacgccgtccgg	CRISPR spacer
cgccagcttggtgttgccgatctcgatgccacgggctttgtcggtttctacgccgtccgg	Protospacer
. ******* *****************.********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_LODH01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_LODH01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 136 : 7762 9 uncultured_Caudovirales_phage(33.33%) integrase attL 844:856|attR 7495:7507
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_LODH01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_LODH01000018
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 545481 : 553388 13 Pseudomonas_phage(100.0%) capsid,integrase attL 545428:545454|attR 555396:555422
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_LODH01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 148990 : 184562 49 Pseudomonas_phage(63.27%) integrase,protease,transposase,terminase,head attL 141602:141618|attR 176244:176260
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_LODH01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 115644 : 122538 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_LODH01000059
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LODH01000059_1 4496-4586 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 210486-210526 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 261779-261819 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 209984-210024 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 26557-26597 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 26715-26755 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 78857-78897 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 43163-43203 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 352188-352228 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 29964-30004 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 46635-46675 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 28143-28183 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 28143-28183 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 27909-27949 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 29318-29358 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 253489-253529 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 104456-104496 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 312300-312340 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 204335-204375 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 330177-330217 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 276757-276797 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 29340-29380 0 1.0
NZ_LODH01000059_1 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder 4521-4561 41 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 26763-26803 1 0.976

1. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

2. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

3. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

4. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

5. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

6. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

7. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

8. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

9. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

10. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

11. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

12. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

13. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

14. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

15. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

16. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

17. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

18. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

19. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

20. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

21. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgactttcctgcggagcatccg	Protospacer
*****************************************

22. spacer 1.1|4521|41|NZ_LODH01000059|CRISPRCasFinder matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 1, identity: 0.976

gttcaaattttccggctgatgactttcctgcggagcatccg	CRISPR spacer
gttcaaattttccggctgatgaccttcctgcggagcatccg	Protospacer
***********************.*****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 99172 : 106626 9 Acinetobacter_phage(33.33%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_LODH01000085
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62 : 7473 8 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_LODH01000070
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_LODH01000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74264 : 97317 33 Pseudomonas_phage(100.0%) transposase,integrase,head attL 76736:76751|attR 92797:92812
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LODH01000041.1|WP_003094216.1|84126_84357_-|DNA-binding-protein 84126_84357_- 76 aa aa NA NA NA 74264-97317 yes
20. NZ_LODH01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_LODH01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_LODH01000035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73937 : 116178 56 Pseudomonas_phage(79.41%) holin,protease,tRNA,terminase,integrase,portal,capsid,head attL 70176:70192|attR 110952:110968
DBSCAN-SWA_2 145302 : 151488 9 Vibrio_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_LODH01000044
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66 : 7728 10 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_LODH01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7396 8 Pseudomonas_phage(100.0%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_LODH01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_LODH01000025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LODH01000025_1 436487-436755 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LODH01000025_1 1.4|436695|33|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436695-436727 33 NZ_LODH01000014.1 40117-40149 2 0.939

1. spacer 1.4|436695|33|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to position: 40117-40149, mismatch: 2, identity: 0.939

agacaagaaaaaccggtcgatgcgggttgtgat	CRISPR spacer
agacaagaaaaaccgctcgatgcgcgttgtgat	Protospacer
*************** ******** ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK034952 Pseudomonas phage Dobby, complete genome 32388-32419 0 1.0
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511042 Pseudomonas phage CF126, partial genome 9365-9396 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511040 Pseudomonas phage CF63, partial genome 55856-55887 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511051 Pseudomonas phage BR181, partial genome 54933-54964 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 KC900378 Pseudomonas phage LKA5, complete genome 7930-7961 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NC_003278 Pseudomonas phage phiCTX, complete genome 31683-31714 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511041 Pseudomonas phage CF69, partial genome 9393-9424 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511049 Pseudomonas phage BR326, partial genome 54933-54964 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511045 Pseudomonas phage BR208, partial genome 54933-54964 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511044 Pseudomonas phage BR197, partial genome 9393-9424 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511050 Pseudomonas phage BR150, partial genome 9321-9352 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511048 Pseudomonas phage BR320, partial genome 9321-9352 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 KM389401 UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00001 genomic sequence 4844-4875 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511046 Pseudomonas phage BR313, partial genome 54933-54964 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 Y13918 Pseudomonas aeruginosa phage phi CTX DNA, complete genome 31683-31714 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 AB008550 Pseudomonas phage phiCTX DNA, complete genome 31683-31714 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NC_042342 Pseudomonas virus H66, complete genome 8813-8844 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511047 Pseudomonas phage BR319, partial genome 9497-9528 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511043 Pseudomonas phage BR228, partial genome 5442-5473 1 0.969
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 MK511039 Pseudomonas phage CF24, partial genome 9393-9424 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 MK511036 Pseudomonas phage BR327, partial genome 17529-17560 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 JQ762257 Pseudomonas phage MP42, complete genome 17491-17522 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 KM389243 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence 7555-7586 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 MK511018 Pseudomonas phage CF28, partial genome 17561-17592 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 17102-17133 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 17534-17565 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NC_030918 Pseudomonas phage JBD93, complete genome 16691-16722 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 EU272037 Pseudomonas phage MP38, complete genome 17707-17738 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 JX434032 Pseudomonas phage JBD30, complete genome 17530-17561 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 KU199708 Pseudomonas phage JBD69, complete genome 17513-17544 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 DQ631426 Pseudomonas phage DMS3, complete genome 17086-17117 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 JX434031 Pseudomonas phage JBD24, complete genome 17379-17410 1 0.969
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NC_009818 Pseudomonas phage MP22, complete genome 16164-16195 2 0.938
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 JX434033 Pseudomonas phage JBD88a, complete genome 16153-16184 2 0.938
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 KU199707 Pseudomonas phage JBD16C, partial genome 16130-16161 2 0.938
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 17074-17105 2 0.938
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 DQ873690 Phage MP22, complete genome 16164-16195 2 0.938
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 MG707188 Pseudomonas phage TC7, partial genome 14616-14647 3 0.906
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NC_031091 Pseudomonas phage MD8, complete genome 29222-29253 4 0.875
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NC_030931 Pseudomonas phage phi2, complete genome 5548-5579 4 0.875
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 309134-309165 7 0.781
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1498691-1498722 8 0.75
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 53473-53504 9 0.719
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 431527-431558 9 0.719
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 MT889371 Microbacterium phage DelaGarza, complete genome 20639-20670 9 0.719
NZ_LODH01000025_1 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436515-436546 32 NZ_KF418775 Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence 101470-101501 10 0.688
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 79780-79811 10 0.688
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 78090-78121 10 0.688
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 367786-367817 10 0.688
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1123676-1123707 11 0.656
NZ_LODH01000025_1 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436575-436606 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1339050-1339081 11 0.656
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NC_018583 Gordonia sp. KTR9 plasmid pGKT3, complete sequence 37659-37690 11 0.656
NZ_LODH01000025_1 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT 436635-436666 32 NZ_CP047236 Gordonia sp. JH63 plasmid pJH63-1, complete sequence 120365-120396 11 0.656

1. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK034952 (Pseudomonas phage Dobby, complete genome) position: , mismatch: 0, identity: 1.0

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcggccgcgggtcggcaacgtcga	Protospacer
********************************

2. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511042 (Pseudomonas phage CF126, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

3. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511040 (Pseudomonas phage CF63, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

4. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511051 (Pseudomonas phage BR181, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

5. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

6. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_003278 (Pseudomonas phage phiCTX, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

7. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511041 (Pseudomonas phage CF69, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

8. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511049 (Pseudomonas phage BR326, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

9. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511045 (Pseudomonas phage BR208, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

10. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511044 (Pseudomonas phage BR197, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

11. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511050 (Pseudomonas phage BR150, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

12. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511048 (Pseudomonas phage BR320, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

13. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to KM389401 (UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

14. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511046 (Pseudomonas phage BR313, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

15. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to Y13918 (Pseudomonas aeruginosa phage phi CTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

16. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to AB008550 (Pseudomonas phage phiCTX DNA, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgtccgcgggtcggcaacgtcga	Protospacer
*********** ********************

17. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

18. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511047 (Pseudomonas phage BR319, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

19. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511043 (Pseudomonas phage BR228, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

20. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511039 (Pseudomonas phage CF24, partial genome) position: , mismatch: 1, identity: 0.969

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
aaccgggcgcgcccgcgggtcggcaacgtcga	Protospacer
*********** ********************

21. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

22. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

23. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to KM389243 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

24. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

25. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

26. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

27. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

28. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

29. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

30. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

31. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

32. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 1, identity: 0.969

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacgga	Protospacer
********************.***********

33. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

34. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

35. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

36. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

37. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 2, identity: 0.938

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
aactgccggtgccggatcgttgccttgacggt	Protospacer
********************.********** 

38. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 3, identity: 0.906

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcagatcgcggtgctcaccgacgtctctactg	Protospacer
*********.*.******************.*

39. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 4, identity: 0.875

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aaagatcgccgcactcaccgacgtctctaccg	Protospacer
. ******* **.*******************

40. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 4, identity: 0.875

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
acggatcgccgccctcaccgacgtctctaccg	Protospacer
.*.****** ** *******************

41. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 7, identity: 0.781

--aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
ttgacc--gcccggccgctggtcggcaacgtcac	Protospacer
  .***  ** ******* *************. 

42. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcatatcgcagcgctcaccgtcgcatgcctcg	Protospacer
*** **************** **. * . .**

43. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaggcggcgcggcggcgggtcggccacggcct	Protospacer
.*   ******** ********** *** *  

44. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaagatggtcggcggcaggtcggcaacgtcga	Protospacer
.*  . *  **** **.***************

45. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 9, identity: 0.719

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
gcagatcgccacgctcaccgacgacctcgtgg	Protospacer
********* .************ *..... *

46. spacer 1.1|436515|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 10, identity: 0.688

aaccgggcgcggccgcgggtcggcaacgtcga	CRISPR spacer
gaccgggcgcggccgcgcgccggcctggattg	Protospacer
.**************** *.****   * . .

47. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 10, identity: 0.688

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
ccagatcgccacgctcaccgacgtgagctggg	Protospacer
 ******** .*************   .   *

48. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.688

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
ccagatcgccacgctcaccgacgtgagctggg	Protospacer
 ******** .*************   .   *

49. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
ggcgatgcgtgcgggatcgtcgccatgacggg	Protospacer
..* ..  **** *********** ******.

50. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 11, identity: 0.656

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aactgtcgcagcgatcaccgacgcctctcaac	Protospacer
.   .******** *********.****    

51. spacer 1.2|436575|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 11, identity: 0.656

gcagatcgcagcgctcaccgacgtctctaccg	CRISPR spacer
aactgtcgcagcgatcaccgacgcctctcaac	Protospacer
.   .******** *********.****    

52. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 11, identity: 0.656

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
tgggcgtagtgcaggatcgtcgcctggacggc	Protospacer
 .    ..**** ************ ***** 

53. spacer 1.3|436635|32|NZ_LODH01000025|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047236 (Gordonia sp. JH63 plasmid pJH63-1, complete sequence) position: , mismatch: 11, identity: 0.656

aactgccggtgccggatcgtcgccttgacgga	CRISPR spacer
tgggcgtagtgcaggatcgtcgcctggacggc	Protospacer
 .    ..**** ************ ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
27. NZ_LODH01000079
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 106 : 21342 28 Pseudomonas_virus(77.78%) tail,holin,plate NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LODH01000079.1|WP_033936089.1|14375_14834_+|hypothetical-protein 14375_14834_+ 152 aa aa AcrIF11 NA NZ_LODH01000079.1_14830_15058_+ 106-21342 NA
28. NZ_LODH01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22150 : 61586 57 Pseudomonas_phage(63.83%) portal,protease,lysis,head,integrase,capsid,tail,holin,terminase attL 22439:22458|attR 64228:64247
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
29. NZ_LODH01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 153189 : 177745 32 Pseudomonas_phage(96.55%) transposase,integrase attL 158596:158611|attR 172238:172253
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage