Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CWKQ01000008 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000024 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000004 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWKQ01000018 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000027 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000023 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000030 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000011 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 1 crisprs WYL,csa3 0 0 1 0
NZ_CWKQ01000014 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000026 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000032 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000007 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000012 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 2 crisprs cas2,cas3,cas5,cas7,cas8b2,cas6 0 12 0 0
NZ_CWKQ01000033 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000010 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000028 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000009 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CWKQ01000005 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 1 crisprs casR,WYL 1 0 0 0
NZ_CWKQ01000013 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000021 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000017 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000016 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs DEDDh,cas3 0 0 1 0
NZ_CWKQ01000025 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000031 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000029 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000006 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_CWKQ01000015 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWKQ01000022 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000020 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKQ01000001 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWKQ01000003 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs DinG,csa3 0 0 1 0
NZ_CWKQ01000002 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CWKQ01000019 Listeria monocytogenes isolate LM11, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0

Results visualization

1. NZ_CWKQ01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKQ01000011_1 48938-49099 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71864 : 79708 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CWKQ01000012
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKQ01000012_1 45327-47234 Unclear I-A
29 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKQ01000012_2 62430-62713 Unclear I-A
4 spacers
cas6,cas8b2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CWKQ01000012_1 1.15|46265|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46265-46298 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_CWKQ01000012_1 1.15|46265|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46265-46298 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_CWKQ01000012_1 1.19|46520|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46520-46555 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_CWKQ01000012_1 1.19|46520|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46520-46555 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KY705255 Streptococcus phage P0095, complete genome 33666-33702 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KY705251 Streptococcus phage P0091, complete genome 32778-32814 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KX879643 Streptococcus phage CHPC1151, complete genome 31697-31733 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 MK202161 Streptococcus phage CHPC1282, complete genome 32484-32520 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KY705252 Streptococcus phage P0092, complete genome 31845-31881 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 MH937506 Streptococcus phage CHPC1148, complete genome 35552-35588 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KY705253 Streptococcus phage P0093, complete genome 32631-32667 1 0.973
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 KY705254 Streptococcus phage P0094, complete genome 31034-31070 1 0.973
NZ_CWKQ01000012_1 1.5|45615|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45615-45650 36 NC_021539 Listeria phage LP-030-2, complete genome 14044-14079 1 0.972
NZ_CWKQ01000012_1 1.5|45615|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45615-45650 36 AJ312240 Bacteriophage PSA complete genome 14022-14057 1 0.972
NZ_CWKQ01000012_1 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46845-46880 36 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 60125-60160 1 0.972
NZ_CWKQ01000012_1 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46845-46880 36 NC_009812 Listeria phage B025, complete genome 27503-27538 1 0.972
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 MN689509 Lactococcus phage CHPC1175, complete genome 29544-29580 2 0.946
NZ_CWKQ01000012_1 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45549-45585 37 MK448735 Streptococcus phage Javan349, complete genome 11483-11519 2 0.946
NZ_CWKQ01000012_1 1.13|46135|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46135-46170 36 KP399678 Listeria phage vB_LmoS_293, complete genome 1049-1084 2 0.944
NZ_CWKQ01000012_1 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46845-46880 36 KJ094023 Listeria phage LP-101, complete genome 27001-27036 2 0.944
NZ_CWKQ01000012_1 1.14|46200|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46200-46235 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_CWKQ01000012_1 1.29|47170|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 47170-47205 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 228347-228382 3 0.917
NZ_CWKQ01000012_1 1.14|46200|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46200-46235 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_CWKQ01000012_1 1.16|46328|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46328-46361 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_CWKQ01000012_1 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 45485-45519 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743
NZ_CWKQ01000012_1 1.12|46071|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46071-46105 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 491525-491559 9 0.743
NZ_CWKQ01000012_1 1.16|46328|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR 46328-46361 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_CWKQ01000012_2 2.8|62650|34|NZ_CWKQ01000012|CRISPRCasFinder 62650-62683 34 MT496970 Escherichia phage Mt1B1_P17, complete genome 96388-96421 12 0.647

1. spacer 1.15|46265|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

taaattactttcgaacaatgccgctaacgcttct	CRISPR spacer
taaattactttcgaacaatgccgctaacgcttct	Protospacer
**********************************

2. spacer 1.15|46265|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

taaattactttcgaacaatgccgctaacgcttct	CRISPR spacer
taaattactttcgaacaatgccgctaacgcttct	Protospacer
**********************************

3. spacer 1.19|46520|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

attgaggtgtattactgtcgccagttgagtaaccag	CRISPR spacer
attgaggtgtattactgtcgccagttgagtaaccag	Protospacer
************************************

4. spacer 1.19|46520|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

attgaggtgtattactgtcgccagttgagtaaccag	CRISPR spacer
attgaggtgtattactgtcgccagttgagtaaccag	Protospacer
************************************

5. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

6. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

7. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KX879643 (Streptococcus phage CHPC1151, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

8. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MK202161 (Streptococcus phage CHPC1282, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

9. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KY705252 (Streptococcus phage P0092, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

10. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MH937506 (Streptococcus phage CHPC1148, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

11. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KY705253 (Streptococcus phage P0093, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

12. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KY705254 (Streptococcus phage P0094, complete genome) position: , mismatch: 1, identity: 0.973

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacactcgttctctgttttg	Protospacer
********************** **************

13. spacer 1.5|45615|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

atatttgaccgtgcccggtaaaactaccgcaaacgt	CRISPR spacer
atatttgaccgtgcccggtaaaactaccgcgaacgt	Protospacer
******************************.*****

14. spacer 1.5|45615|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 1, identity: 0.972

atatttgaccgtgcccggtaaaactaccgcaaacgt	CRISPR spacer
atatttgaccgtgcccggtaaaactaccgcgaacgt	Protospacer
******************************.*****

15. spacer 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 1, identity: 0.972

tttagcaattgggctacgaaaaaccaacgtgaagcg	CRISPR spacer
tttagcaattgggctacgaaaaatcaacgtgaagcg	Protospacer
***********************.************

16. spacer 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.972

tttagcaattgggctacgaaaaaccaacgtgaagcg	CRISPR spacer
tttagcaattgggctacgaaaaatcaacgtgaagcg	Protospacer
***********************.************

17. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MN689509 (Lactococcus phage CHPC1175, complete genome) position: , mismatch: 2, identity: 0.946

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgataatgaacacacgttctcggttttg	Protospacer
**********************.******* ******

18. spacer 1.4|45549|37|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MK448735 (Streptococcus phage Javan349, complete genome) position: , mismatch: 2, identity: 0.946

taagatgtccgataatgaacacgcgttctctgttttg	CRISPR spacer
taagatgtccgacaatgaacacccgttctctgttttg	Protospacer
************.********* **************

19. spacer 1.13|46135|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.944

tacatgtcgtttaacccgcctcgaaatccttatgag	CRISPR spacer
tacatgtcatttaacccgcctcgcaatccttatgag	Protospacer
********.************** ************

20. spacer 1.24|46845|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.944

tttagcaattgggctacgaaaaaccaacgtgaagcg	CRISPR spacer
tttagcaattgggctacaaaaaatcaacgtgaagcg	Protospacer
*****************.*****.************

21. spacer 1.14|46200|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tccaaactccttccgcacattgggcaatattttata	CRISPR spacer
cccaaactccttccacacattggacaatattttata	Protospacer
.*************.********.************

22. spacer 1.29|47170|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.917

attaactggaaagtgagaatgaaatcgaaggtcttt	CRISPR spacer
attaactggaaagtaagaatgaaatcgaaggttttc	Protospacer
**************.*****************.**.

23. spacer 1.14|46200|36|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tccaaactccttccgcacattgggcaatattttata	CRISPR spacer
tccaagctccttccgcacattgggcaaaattcaatg	Protospacer
*****.********************* ***. **.

24. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aattttttcattttctaagccctcattttttatta	Protospacer
* *****************.****** ***.*  *

25. spacer 1.16|46328|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

gcaaaacaacaaattggaaagatgttttttttct	CRISPR spacer
gtgataaaacaaataggaaagatgtttttttgct	Protospacer
*..* * ******* **************** **

26. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac	Protospacer
    *.****.**************** **** * 

27. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac	Protospacer
    *.****.**************** **** * 

28. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcagac	Protospacer
    *.****.**************** ****.* 

29. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

30. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

31. spacer 1.3|45485|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

32. spacer 1.12|46071|35|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 9, identity: 0.743

taatgacatctggtgataaaattgttgaaaaaagc	CRISPR spacer
aaaaattatctgttcataaaattgttgaaaaaact	Protospacer
 ** . .***** * ****************** .

33. spacer 1.16|46328|34|NZ_CWKQ01000012|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

-----gcaaaacaacaaattggaaagatgttttttttct	CRISPR spacer
tttttggaaa-----aaattggaaatatgtttttttctt	Protospacer
     * ***     ********** **********..*

34. spacer 2.8|62650|34|NZ_CWKQ01000012|CRISPRCasFinder matches to MT496970 (Escherichia phage Mt1B1_P17, complete genome) position: , mismatch: 12, identity: 0.647

gtaaggacttcttcaccatctttcatttctgttt	CRISPR spacer
tctgttacttcttcactatctttcttttctagaa	Protospacer
 . .  **********.******* *****.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CWKQ01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58568 : 66854 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CWKQ01000005
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKQ01000005_1 3736-4320 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CWKQ01000005_1 1.2|3853|39|NZ_CWKQ01000005|CRT 3853-3891 39 NZ_CWKQ01000005.1 6058-6096 2 0.949

1. spacer 1.2|3853|39|NZ_CWKQ01000005|CRT matches to position: 6058-6096, mismatch: 2, identity: 0.949

taacacttcaagactagtacaaccagcaaacatggcacg	CRISPR spacer
taacgcttcaagactagtacagccagcaaacatggcacg	Protospacer
****.****************.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CWKQ01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39334 : 50061 17 Listeria_phage(40.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CWKQ01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 95446 : 156748 59 Streptococcus_phage(15.79%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CWKQ01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 398 : 37703 55 Listeria_phage(94.23%) terminase,tail,holin,integrase attL 274:323|attR 38128:38177
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CWKQ01000006.1|WP_003731276.1|37186_37438_-|hypothetical-protein 37186_37438_- 83 aa aa AcrIIA12 NA NA 398-37703 NA
8. NZ_CWKQ01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 883 : 8305 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage