| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_CWLB01000117 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000026 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 1 crisprs | 0 | 3 | 0 | 0 | |
| NZ_CWLB01000096 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000120 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000137 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000016 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000125 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000101 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000035 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000058 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000053 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000070 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000067 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000054 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000076 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000108 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000044 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000089 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000021 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000023 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000050 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000024 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000079 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000093 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000100 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000062 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000048 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000013 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000111 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000008 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000052 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000057 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000078 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000130 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000007 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000143 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000018 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000106 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000059 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000042 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000097 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 1 crisprs | 2 | 11 | 0 | 0 | |
| NZ_CWLB01000133 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000019 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000068 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000040 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000069 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000039 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000064 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000074 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000115 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000087 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000073 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000034 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000091 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000075 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000056 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000109 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000065 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000041 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000081 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000107 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000036 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000085 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000095 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000012 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000031 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000090 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000014 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000051 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000020 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000131 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000119 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000071 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000092 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000004 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000088 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000132 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000140 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000001 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000032 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000030 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000066 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000011 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000017 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000138 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000046 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000126 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000121 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000025 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000015 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000139 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000086 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000123 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000129 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000141 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000029 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000072 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000080 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000010 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000037 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000136 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000084 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000083 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000022 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000005 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000002 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000134 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000077 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000114 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000094 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000116 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000099 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000038 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000027 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000110 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000003 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000122 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000124 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000055 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000128 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 1 | |
| NZ_CWLB01000047 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000061 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000112 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000033 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000049 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000043 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000135 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000009 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000028 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000103 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000098 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000104 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000105 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000082 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000006 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000045 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000142 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000118 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000102 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_CWLB01000063 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000127 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000060 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_CWLB01000113 | Listeria monocytogenes isolate LM12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 422 : 8435 | 13 | Listeria_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 153 : 7767 | 12 | Listeria_phage(91.67%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_CWLB01000026_1 | 39921-39955 | 35 | MN694189 | Marine virus AFVG_250M578, complete genome | 47879-47913 | 6 | 0.829 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | MN694189 | Marine virus AFVG_250M578, complete genome | 47880-47913 | 6 | 0.824 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | MK448625 | Streptococcus satellite phage Javan738, complete genome | 5960-5993 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | MK448449 | Streptococcus satellite phage Javan356, complete genome | 4490-4523 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | MK448636 | Streptococcus satellite phage Javan749, complete genome | 6112-6145 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NZ_CP045037 | Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence | 34734-34767 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NZ_CP018177 | Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence | 11326-11359 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NZ_CP018181 | Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence | 63608-63641 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NZ_KX274135 | Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence | 30674-30707 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NC_020183 | Staphylococcus aureus subsp. aureus ST398 plasmid pUR3912, isolate C3912 complete sequence | 4238-4271 | 8 | 0.765 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | MK448625 | Streptococcus satellite phage Javan738, complete genome | 5960-5994 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | MK448449 | Streptococcus satellite phage Javan356, complete genome | 4490-4524 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | MK448636 | Streptococcus satellite phage Javan749, complete genome | 6112-6146 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | NZ_CP045037 | Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence | 34734-34768 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | NZ_CP018177 | Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence | 11325-11359 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39921-39955 | 35 | NZ_CP018181 | Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence | 63608-63642 | 9 | 0.743 | |
| NZ_CWLB01000026_1 | 39922-39961 | 40 | MN694189 | Marine virus AFVG_250M578, complete genome | 47880-47919 | 10 | 0.75 | |
| NZ_CWLB01000026_1 | 39922-39955 | 34 | NZ_CP016746 | Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence | 15683-15716 | 10 | 0.706 |
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer aattttttcattttctaagccctcattttttatta Protospacer * *****************.****** ***.* *
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer attttttcattttctaagccctcattttttatta Protospacer *****************.****** ***.* *
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer aggtcttcactttctaagtcctcatagttcatac Protospacer *.****.**************** **** *
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer aggtcttcactttctaagtcctcatagttcatac Protospacer *.****.**************** **** *
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer aggtcttcactttctaagtcctcatagttcagac Protospacer *.****.**************** ****.*
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer ataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer ataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer ataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer tttatttcattttctaattcctcacacattacat Protospacer *** ************* ******.*. *.* *
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer tttatttcattttctaattcctcacacattacat Protospacer *** ************* ******.*. *.* *
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac Protospacer
*.****.**************** **** *
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac Protospacer
*.****.**************** **** *
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer
caggtcttcactttctaagtcctcatagttcagac Protospacer
*.****.**************** ****.*
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer cataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer cataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
atttttttcattttctaagtcctcatatttcaaaa CRISPR spacer cataacttcatttactaagtccttatatttcttaa Protospacer * .******* *********.******* **
tttttttcattttctaagtcctcatatttcaaaaatttac CRISPR spacer attttttcattttctaagccctcattttttattaaacaat Protospacer *****************.****** ***.* ** . *.
tttttttcattttctaagtcctcatatttcaaaa CRISPR spacer aaatcttcattttctaagtgctcaaatttttcag Protospacer *.************** **** ****. *.
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 1700 : 9544 | 7 | Streptococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_CWLB01000097_1 | 6074-7918 | Unclear |
I-A
|
28 spacers
|
cas2,cas3,cas5,cas7,cas8b2 |
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_CWLB01000097_1 | 7723-7759 | 37 | NZ_CWLB01000026.1 | 39985-40021 | 0 | 1.0 | |
| NZ_CWLB01000097_1 | 6428-6463 | 36 | NZ_CWLB01000125.1 | 1016-1051 | 1 | 0.972 |
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgcgtgttcattatcggacatctta Protospacer *************************************
cgcttcacgttggtttttcgtagcccaattgctaaa CRISPR spacer cgcttcacgttgatttttcgtagcccaattgctaaa Protospacer ************.***********************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_CWLB01000097_1 | 6753-6788 | 36 | NC_003216 | Listeria phage A118, complete genome | 18563-18598 | 0 | 1.0 | |
| NZ_CWLB01000097_1 | 6753-6788 | 36 | AJ242593 | Bacteriophage A118 complete genome | 18563-18598 | 0 | 1.0 | |
| NZ_CWLB01000097_1 | 7010-7043 | 34 | NC_003216 | Listeria phage A118, complete genome | 19172-19205 | 0 | 1.0 | |
| NZ_CWLB01000097_1 | 7010-7043 | 34 | AJ242593 | Bacteriophage A118 complete genome | 19172-19205 | 0 | 1.0 | |
| NZ_CWLB01000097_1 | 6428-6463 | 36 | NZ_CP011399 | Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence | 60125-60160 | 1 | 0.972 | |
| NZ_CWLB01000097_1 | 6428-6463 | 36 | NC_009812 | Listeria phage B025, complete genome | 27503-27538 | 1 | 0.972 | |
| NZ_CWLB01000097_1 | 7658-7693 | 36 | NC_021539 | Listeria phage LP-030-2, complete genome | 14044-14079 | 1 | 0.972 | |
| NZ_CWLB01000097_1 | 7658-7693 | 36 | AJ312240 | Bacteriophage PSA complete genome | 14022-14057 | 1 | 0.972 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KY705255 | Streptococcus phage P0095, complete genome | 33666-33702 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KY705251 | Streptococcus phage P0091, complete genome | 32778-32814 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KX879643 | Streptococcus phage CHPC1151, complete genome | 31697-31733 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | MK202161 | Streptococcus phage CHPC1282, complete genome | 32484-32520 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KY705252 | Streptococcus phage P0092, complete genome | 31845-31881 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | MH937506 | Streptococcus phage CHPC1148, complete genome | 35552-35588 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KY705253 | Streptococcus phage P0093, complete genome | 32631-32667 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | KY705254 | Streptococcus phage P0094, complete genome | 31034-31070 | 1 | 0.973 | |
| NZ_CWLB01000097_1 | 6428-6463 | 36 | KJ094023 | Listeria phage LP-101, complete genome | 27001-27036 | 2 | 0.944 | |
| NZ_CWLB01000097_1 | 7138-7173 | 36 | KP399678 | Listeria phage vB_LmoS_293, complete genome | 1049-1084 | 2 | 0.944 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | MN689509 | Lactococcus phage CHPC1175, complete genome | 29544-29580 | 2 | 0.946 | |
| NZ_CWLB01000097_1 | 7723-7759 | 37 | MK448735 | Streptococcus phage Javan349, complete genome | 11483-11519 | 2 | 0.946 | |
| NZ_CWLB01000097_1 | 6103-6138 | 36 | NZ_LR134403 | Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence | 228347-228382 | 3 | 0.917 | |
| NZ_CWLB01000097_1 | 7073-7108 | 36 | MH341453 | Listeria phage PSU-VKH-LP041, complete genome | 41996-42031 | 3 | 0.917 | |
| NZ_CWLB01000097_1 | 7073-7108 | 36 | KJ094023 | Listeria phage LP-101, complete genome | 32760-32795 | 5 | 0.861 | |
| NZ_CWLB01000097_1 | 6947-6980 | 34 | NC_022111 | Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence | 1764851-1764884 | 6 | 0.824 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | MN694189 | Marine virus AFVG_250M578, complete genome | 47879-47913 | 6 | 0.829 | |
| NZ_CWLB01000097_1 | 6947-6980 | 34 | NZ_CP038863 | Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence | 39302-39335 | 9 | 0.735 | |
| NZ_CWLB01000097_1 | 7203-7237 | 35 | NC_014533 | Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence | 491525-491559 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | MK448625 | Streptococcus satellite phage Javan738, complete genome | 5960-5994 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | MK448449 | Streptococcus satellite phage Javan356, complete genome | 4490-4524 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | MK448636 | Streptococcus satellite phage Javan749, complete genome | 6112-6146 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | NZ_CP045037 | Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence | 34734-34768 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | NZ_CP018177 | Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence | 11325-11359 | 9 | 0.743 | |
| NZ_CWLB01000097_1 | 7789-7823 | 35 | NZ_CP018181 | Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence | 63608-63642 | 9 | 0.743 |
ctggttactcaactggcgacagtaatacacctcaat CRISPR spacer ctggttactcaactggcgacagtaatacacctcaat Protospacer ************************************
ctggttactcaactggcgacagtaatacacctcaat CRISPR spacer ctggttactcaactggcgacagtaatacacctcaat Protospacer ************************************
agaagcgttagcggcattgttcgaaagtaattta CRISPR spacer agaagcgttagcggcattgttcgaaagtaattta Protospacer **********************************
agaagcgttagcggcattgttcgaaagtaattta CRISPR spacer agaagcgttagcggcattgttcgaaagtaattta Protospacer **********************************
cgcttcacgttggtttttcgtagcccaattgctaaa CRISPR spacer cgcttcacgttgatttttcgtagcccaattgctaaa Protospacer ************.***********************
cgcttcacgttggtttttcgtagcccaattgctaaa CRISPR spacer cgcttcacgttgatttttcgtagcccaattgctaaa Protospacer ************.***********************
acgtttgcggtagttttaccgggcacggtcaaatat CRISPR spacer acgttcgcggtagttttaccgggcacggtcaaatat Protospacer *****.******************************
acgtttgcggtagttttaccgggcacggtcaaatat CRISPR spacer acgttcgcggtagttttaccgggcacggtcaaatat Protospacer *****.******************************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgagtgttcattatcggacatctta Protospacer ************** **********************
cgcttcacgttggtttttcgtagcccaattgctaaa CRISPR spacer cgcttcacgttgattttttgtagcccaattgctaaa Protospacer ************.*****.*****************
ctcataaggatttcgaggcgggttaaacgacatgta CRISPR spacer ctcataaggattgcgaggcgggttaaatgacatgta Protospacer ************ **************.********
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaaccgagaacgtgtgttcattatcggacatctta Protospacer ****** *******.**********************
caaaacagagaacgcgtgttcattatcggacatctta CRISPR spacer caaaacagagaacgggtgttcattgtcggacatctta Protospacer ************** *********.************
aaagaccttcgatttcattctcactttccagttaat CRISPR spacer gaaaaccttcgatttcattcttactttccagttaat Protospacer .**.*****************.**************
tataaaatattgcccaatgtgcggaaggagtttgga CRISPR spacer tataaaatattgtccaatgtgtggaaggagtttggg Protospacer ************.********.*************.
tataaaatattgcccaatgtgcggaaggagtttgga CRISPR spacer cattgaattttgcccaatgtgcggaaggagcttgga Protospacer .** .*** *********************.*****
agaaaaaaaacatctttccaatttgttgttttgc CRISPR spacer agcaaaaaaacatctttcctatttgttttatcac Protospacer ** **************** ******* * *..*
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer taataaaaaatgagggcttagaaaatgaaaaaatt Protospacer * *.*** ******.***************** *
agaaaaaaaacatctttccaatttgttgttttgc----- CRISPR spacer aagaaaaaaacatatttccaatt-----ttttccaaaaa Protospacer *..********** ********* **** *
gcttttttcaacaattttatcaccagatgtcatta CRISPR spacer agttttttcaacaattttatgaacagataattttt Protospacer . ****************** * *****. . **
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer gtatgaactatgaggacttagaaagtgaagacctg Protospacer * **** ****************.****.*
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer gtatgaactatgaggacttagaaagtgaagacctg Protospacer * **** ****************.****.*
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer gtctgaactatgaggacttagaaagtgaagacctg Protospacer *.**** ****************.****.*
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer ttaagaaatataaggacttagtaaatgaagttatg Protospacer ** *******.********* *******. *
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer ttaagaaatataaggacttagtaaatgaagttatg Protospacer ** *******.********* *******. *
ttttgaaatatgaggacttagaaaatgaaaaaaat CRISPR spacer ttaagaaatataaggacttagtaaatgaagttatg Protospacer ** *******.********* *******. *
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 61 : 9350 | 17 | Listeria_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 18673 | 20 | Listeria_phage(100.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 18217 : 26503 | 8 | Synechococcus_phage(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 5827 | 13 | Listeria_phage(83.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 193 : 7615 | 8 | Hokovirus(33.33%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 615 : 12585 | 8 | Listeria_phage(87.5%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 14464 : 25191 | 17 | Listeria_phage(40.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 83 aa aa | AcrIIA12 | NA | NA | No | NA |