Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CWLB01000127 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000098 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000024 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000140 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs cas6 0 0 0 0
NZ_CWLB01000012 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000025 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000060 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000005 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000010 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000121 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000112 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000115 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000059 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000001 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000099 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000021 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000006 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000029 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000142 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000125 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000057 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000041 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWLB01000009 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000071 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000077 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000074 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000061 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000132 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000017 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_CWLB01000062 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000093 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000088 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000002 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000084 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000097 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 1 crisprs cas8b2,cas7,cas5,cas3,cas2 2 11 0 0
NZ_CWLB01000092 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000079 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000110 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWLB01000139 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000133 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000108 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000134 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000067 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000124 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000040 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000120 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000107 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000038 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs casR 0 0 0 0
NZ_CWLB01000048 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWLB01000090 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000080 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000033 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000065 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000113 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000053 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000076 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000123 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000136 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000022 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000070 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000049 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000086 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000138 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000055 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000103 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000045 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CWLB01000096 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000052 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000118 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000116 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000051 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000042 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000066 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_CWLB01000044 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000018 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000023 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000089 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CWLB01000135 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000141 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000020 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000026 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 1 crisprs NA 0 3 0 0
NZ_CWLB01000046 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000003 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000027 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000119 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000094 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000064 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000069 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CWLB01000117 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000063 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000056 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000104 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000004 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000082 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CWLB01000008 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000016 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000036 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000100 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000072 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000143 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000128 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_CWLB01000073 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000047 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000129 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000114 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000122 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000068 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000106 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000007 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000078 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000137 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000130 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000035 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000015 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000105 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000109 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000011 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000091 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000102 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000039 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000014 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000030 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000019 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_CWLB01000058 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000013 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CWLB01000075 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000081 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000031 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000087 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000101 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000028 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000032 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000085 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000054 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000131 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000050 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000037 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000095 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000043 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000034 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWLB01000111 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000126 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWLB01000083 Listeria monocytogenes isolate LM12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CWLB01000066
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWLB01000066_1 30788-31070 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CWLB01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14464 : 25191 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CWLB01000053
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61 : 9350 17 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CWLB01000097
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWLB01000097_1 6074-7918 Unclear I-A
28 spacers
cas2,cas3,cas5,cas7,cas8b2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 NZ_CWLB01000026.1 39985-40021 0 1.0
NZ_CWLB01000097_1 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6428-6463 36 NZ_CWLB01000125.1 1016-1051 1 0.972

1. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to position: 39985-40021, mismatch: 0, identity: 1.0

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgcgtgttcattatcggacatctta	Protospacer
*************************************

2. spacer 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to position: 1016-1051, mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CWLB01000097_1 1.11|6753|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6753-6788 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_CWLB01000097_1 1.11|6753|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6753-6788 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_CWLB01000097_1 1.15|7010|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7010-7043 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_CWLB01000097_1 1.15|7010|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7010-7043 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_CWLB01000097_1 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6428-6463 36 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 60125-60160 1 0.972
NZ_CWLB01000097_1 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6428-6463 36 NC_009812 Listeria phage B025, complete genome 27503-27538 1 0.972
NZ_CWLB01000097_1 1.25|7658|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7658-7693 36 NC_021539 Listeria phage LP-030-2, complete genome 14044-14079 1 0.972
NZ_CWLB01000097_1 1.25|7658|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7658-7693 36 AJ312240 Bacteriophage PSA complete genome 14022-14057 1 0.972
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KY705255 Streptococcus phage P0095, complete genome 33666-33702 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KY705251 Streptococcus phage P0091, complete genome 32778-32814 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KX879643 Streptococcus phage CHPC1151, complete genome 31697-31733 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 MK202161 Streptococcus phage CHPC1282, complete genome 32484-32520 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KY705252 Streptococcus phage P0092, complete genome 31845-31881 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 MH937506 Streptococcus phage CHPC1148, complete genome 35552-35588 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KY705253 Streptococcus phage P0093, complete genome 32631-32667 1 0.973
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 KY705254 Streptococcus phage P0094, complete genome 31034-31070 1 0.973
NZ_CWLB01000097_1 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6428-6463 36 KJ094023 Listeria phage LP-101, complete genome 27001-27036 2 0.944
NZ_CWLB01000097_1 1.17|7138|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7138-7173 36 KP399678 Listeria phage vB_LmoS_293, complete genome 1049-1084 2 0.944
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 MN689509 Lactococcus phage CHPC1175, complete genome 29544-29580 2 0.946
NZ_CWLB01000097_1 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7723-7759 37 MK448735 Streptococcus phage Javan349, complete genome 11483-11519 2 0.946
NZ_CWLB01000097_1 1.1|6103|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6103-6138 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 228347-228382 3 0.917
NZ_CWLB01000097_1 1.16|7073|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7073-7108 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_CWLB01000097_1 1.16|7073|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7073-7108 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_CWLB01000097_1 1.14|6947|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6947-6980 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_CWLB01000097_1 1.14|6947|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 6947-6980 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_CWLB01000097_1 1.18|7203|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7203-7237 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 491525-491559 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_CWLB01000097_1 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT 7789-7823 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743

1. spacer 1.11|6753|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

2. spacer 1.11|6753|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

3. spacer 1.15|7010|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

4. spacer 1.15|7010|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

5. spacer 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

6. spacer 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

7. spacer 1.25|7658|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

8. spacer 1.25|7658|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

9. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

10. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

11. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KX879643 (Streptococcus phage CHPC1151, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

12. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MK202161 (Streptococcus phage CHPC1282, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

13. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KY705252 (Streptococcus phage P0092, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

14. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MH937506 (Streptococcus phage CHPC1148, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

15. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KY705253 (Streptococcus phage P0093, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

16. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KY705254 (Streptococcus phage P0094, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

17. spacer 1.6|6428|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.944

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgattttttgtagcccaattgctaaa	Protospacer
************.*****.*****************

18. spacer 1.17|7138|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.944

ctcataaggatttcgaggcgggttaaacgacatgta	CRISPR spacer
ctcataaggattgcgaggcgggttaaatgacatgta	Protospacer
************ **************.********

19. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MN689509 (Lactococcus phage CHPC1175, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaaccgagaacgtgtgttcattatcggacatctta	Protospacer
****** *******.**********************

20. spacer 1.26|7723|37|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MK448735 (Streptococcus phage Javan349, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgggtgttcattgtcggacatctta	Protospacer
************** *********.************

21. spacer 1.1|6103|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.917

aaagaccttcgatttcattctcactttccagttaat	CRISPR spacer
gaaaaccttcgatttcattcttactttccagttaat	Protospacer
.**.*****************.**************

22. spacer 1.16|7073|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

23. spacer 1.16|7073|36|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

24. spacer 1.14|6947|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

25. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

26. spacer 1.14|6947|34|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

27. spacer 1.18|7203|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 9, identity: 0.743

gcttttttcaacaattttatcaccagatgtcatta	CRISPR spacer
agttttttcaacaattttatgaacagataattttt	Protospacer
. ****************** * *****. . ** 

28. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

29. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

30. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

31. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

32. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

33. spacer 1.27|7789|35|NZ_CWLB01000097|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CWLB01000054
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 18673 20 Listeria_phage(100.0%) terminase,holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CWLB01000100
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 422 : 8435 13 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CWLB01000125
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_CWLB01000026
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWLB01000026_1 39763-39985 Orphan I-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 MN694189 Marine virus AFVG_250M578, complete genome 47880-47913 6 0.824
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5993 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4523 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6145 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34767 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11326-11359 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63641 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NZ_KX274135 Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence 30674-30707 8 0.765
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NC_020183 Staphylococcus aureus subsp. aureus ST398 plasmid pUR3912, isolate C3912 complete sequence 4238-4271 8 0.765
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_CWLB01000026_1 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder 39921-39955 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743
NZ_CWLB01000026_1 1.6|39922|40|NZ_CWLB01000026|CRT 39922-39961 40 MN694189 Marine virus AFVG_250M578, complete genome 47880-47919 10 0.75
NZ_CWLB01000026_1 1.8|39922|34|NZ_CWLB01000026|PILER-CR 39922-39955 34 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 15683-15716 10 0.706

1. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aattttttcattttctaagccctcattttttatta	Protospacer
* *****************.****** ***.*  *

2. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.824

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
attttttcattttctaagccctcattttttatta	Protospacer
 *****************.****** ***.*  *

3. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aggtcttcactttctaagtcctcatagttcatac	Protospacer
   *.****.**************** **** * 

4. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aggtcttcactttctaagtcctcatagttcatac	Protospacer
   *.****.**************** **** * 

5. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aggtcttcactttctaagtcctcatagttcagac	Protospacer
   *.****.**************** ****.* 

6. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
ataacttcatttactaagtccttatatttcttaa	Protospacer
 *  .******* *********.*******  **

7. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
ataacttcatttactaagtccttatatttcttaa	Protospacer
 *  .******* *********.*******  **

8. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
ataacttcatttactaagtccttatatttcttaa	Protospacer
 *  .******* *********.*******  **

9. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NZ_KX274135 (Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
tttatttcattttctaattcctcacacattacat	Protospacer
*** ************* ******.*. *.* * 

10. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NC_020183 (Staphylococcus aureus subsp. aureus ST398 plasmid pUR3912, isolate C3912 complete sequence) position: , mismatch: 8, identity: 0.765

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
tttatttcattttctaattcctcacacattacat	Protospacer
*** ************* ******.*. *.* * 

11. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac	Protospacer
    *.****.**************** **** * 

12. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcatac	Protospacer
    *.****.**************** **** * 

13. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
caggtcttcactttctaagtcctcatagttcagac	Protospacer
    *.****.**************** ****.* 

14. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

15. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

16. spacer 1.3|39921|35|NZ_CWLB01000026|CRISPRCasFinder matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

atttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
cataacttcatttactaagtccttatatttcttaa	Protospacer
  *  .******* *********.*******  **

17. spacer 1.6|39922|40|NZ_CWLB01000026|CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 10, identity: 0.75

tttttttcattttctaagtcctcatatttcaaaaatttac	CRISPR spacer
attttttcattttctaagccctcattttttattaaacaat	Protospacer
 *****************.****** ***.*  ** . *.

18. spacer 1.8|39922|34|NZ_CWLB01000026|PILER-CR matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 10, identity: 0.706

tttttttcattttctaagtcctcatatttcaaaa	CRISPR spacer
aaatcttcattttctaagtgctcaaatttttcag	Protospacer
   *.************** **** ****.  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_CWLB01000128
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CWLB01000128.1|WP_003731276.1|1629_1881_+|hypothetical-protein 1629_1881_+ 83 aa aa AcrIIA12 NA NA No NA
10. NZ_CWLB01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18217 : 26503 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_CWLB01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 615 : 12585 8 Listeria_phage(87.5%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_CWLB01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 193 : 7615 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_CWLB01000102
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5827 13 Listeria_phage(83.33%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_CWLB01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1700 : 9544 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_CWLB01000117
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 153 : 7767 12 Listeria_phage(91.67%) portal,protease,tail,capsid,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage