Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CWKV01000029 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_CWKV01000028 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000049 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000042 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000037 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CWKV01000052 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000038 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000001 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000041 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000021 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000014 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CWKV01000051 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000003 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 2 crisprs cas8b2,cas7,cas5,cas3,cas2 0 11 0 0
NZ_CWKV01000026 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWKV01000046 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000027 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000024 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000048 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000023 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_CWKV01000017 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000006 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CWKV01000009 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 1 crisprs csa3 0 0 1 0
NZ_CWKV01000039 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000050 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000047 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000016 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000035 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CWKV01000020 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWKV01000002 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000032 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000004 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_CWKV01000045 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000043 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000033 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000011 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000013 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000019 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000025 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000010 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000018 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000040 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000030 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000031 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs casR 0 0 0 0
NZ_CWKV01000034 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000007 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000005 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CWKV01000008 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs DinG,csa3 0 0 1 0
NZ_CWKV01000012 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000015 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000044 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CWKV01000022 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CWKV01000036 Listeria monocytogenes isolate LM1, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0

Results visualization

1. NZ_CWKV01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10976 : 70532 58 Bacillus_virus(15.79%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CWKV01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKV01000023_1 32803-33381 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CWKV01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12097 : 19519 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CWKV01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 501 : 37806 55 Listeria_phage(94.23%) tail,integrase,terminase,holin attL 377:426|attR 38231:38280
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CWKV01000004.1|WP_003731276.1|37289_37541_-|hypothetical-protein 37289_37541_- 83 aa aa AcrIIA12 NA NA 501-37806 NA
5. NZ_CWKV01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKV01000003_1 32702-32984 Unclear I-A
4 spacers
cas6,cas8b2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKV01000003_2 48180-50087 Unclear I-A
29 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CWKV01000003_2 2.11|48859|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48859-48894 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_CWKV01000003_2 2.11|48859|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48859-48894 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_CWKV01000003_2 2.15|49116|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49116-49149 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_CWKV01000003_2 2.15|49116|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49116-49149 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_CWKV01000003_2 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48534-48569 36 NZ_CP011399 Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence 60125-60160 1 0.972
NZ_CWKV01000003_2 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48534-48569 36 NC_009812 Listeria phage B025, complete genome 27503-27538 1 0.972
NZ_CWKV01000003_2 2.25|49764|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49764-49799 36 NC_021539 Listeria phage LP-030-2, complete genome 14044-14079 1 0.972
NZ_CWKV01000003_2 2.25|49764|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49764-49799 36 AJ312240 Bacteriophage PSA complete genome 14022-14057 1 0.972
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KY705255 Streptococcus phage P0095, complete genome 33666-33702 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KY705251 Streptococcus phage P0091, complete genome 32778-32814 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KX879643 Streptococcus phage CHPC1151, complete genome 31697-31733 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 MK202161 Streptococcus phage CHPC1282, complete genome 32484-32520 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KY705252 Streptococcus phage P0092, complete genome 31845-31881 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 MH937506 Streptococcus phage CHPC1148, complete genome 35552-35588 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KY705253 Streptococcus phage P0093, complete genome 32631-32667 1 0.973
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 KY705254 Streptococcus phage P0094, complete genome 31034-31070 1 0.973
NZ_CWKV01000003_2 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48534-48569 36 KJ094023 Listeria phage LP-101, complete genome 27001-27036 2 0.944
NZ_CWKV01000003_2 2.17|49244|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49244-49279 36 KP399678 Listeria phage vB_LmoS_293, complete genome 1049-1084 2 0.944
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 MN689509 Lactococcus phage CHPC1175, complete genome 29544-29580 2 0.946
NZ_CWKV01000003_2 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49829-49865 37 MK448735 Streptococcus phage Javan349, complete genome 11483-11519 2 0.946
NZ_CWKV01000003_2 2.1|48209|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 48209-48244 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 228347-228382 3 0.917
NZ_CWKV01000003_2 2.16|49179|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49179-49214 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_CWKV01000003_2 2.16|49179|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49179-49214 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_CWKV01000003_2 2.14|49053|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49053-49086 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_CWKV01000003_2 2.14|49053|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49053-49086 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_CWKV01000003_2 2.18|49309|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49309-49343 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 491525-491559 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_CWKV01000003_2 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT 49895-49929 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743

1. spacer 2.11|48859|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

2. spacer 2.11|48859|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

3. spacer 2.15|49116|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

4. spacer 2.15|49116|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

5. spacer 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011399 (Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

6. spacer 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.972

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgatttttcgtagcccaattgctaaa	Protospacer
************.***********************

7. spacer 2.25|49764|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

8. spacer 2.25|49764|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to AJ312240 (Bacteriophage PSA complete genome) position: , mismatch: 1, identity: 0.972

acgtttgcggtagttttaccgggcacggtcaaatat	CRISPR spacer
acgttcgcggtagttttaccgggcacggtcaaatat	Protospacer
*****.******************************

9. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

10. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

11. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KX879643 (Streptococcus phage CHPC1151, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

12. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MK202161 (Streptococcus phage CHPC1282, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

13. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KY705252 (Streptococcus phage P0092, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

14. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MH937506 (Streptococcus phage CHPC1148, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

15. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KY705253 (Streptococcus phage P0093, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

16. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KY705254 (Streptococcus phage P0094, complete genome) position: , mismatch: 1, identity: 0.973

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgagtgttcattatcggacatctta	Protospacer
************** **********************

17. spacer 2.6|48534|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.944

cgcttcacgttggtttttcgtagcccaattgctaaa	CRISPR spacer
cgcttcacgttgattttttgtagcccaattgctaaa	Protospacer
************.*****.*****************

18. spacer 2.17|49244|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 2, identity: 0.944

ctcataaggatttcgaggcgggttaaacgacatgta	CRISPR spacer
ctcataaggattgcgaggcgggttaaatgacatgta	Protospacer
************ **************.********

19. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MN689509 (Lactococcus phage CHPC1175, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaaccgagaacgtgtgttcattatcggacatctta	Protospacer
****** *******.**********************

20. spacer 2.26|49829|37|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MK448735 (Streptococcus phage Javan349, complete genome) position: , mismatch: 2, identity: 0.946

caaaacagagaacgcgtgttcattatcggacatctta	CRISPR spacer
caaaacagagaacgggtgttcattgtcggacatctta	Protospacer
************** *********.************

21. spacer 2.1|48209|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.917

aaagaccttcgatttcattctcactttccagttaat	CRISPR spacer
gaaaaccttcgatttcattcttactttccagttaat	Protospacer
.**.*****************.**************

22. spacer 2.16|49179|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

23. spacer 2.16|49179|36|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

24. spacer 2.14|49053|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

25. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

26. spacer 2.14|49053|34|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

27. spacer 2.18|49309|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 9, identity: 0.743

gcttttttcaacaattttatcaccagatgtcatta	CRISPR spacer
agttttttcaacaattttatgaacagataattttt	Protospacer
. ****************** * *****. . ** 

28. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

29. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

30. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

31. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

32. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

33. spacer 2.27|49895|35|NZ_CWKV01000003|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CWKV01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2922 : 11208 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CWKV01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39331 : 50058 17 Listeria_phage(40.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_CWKV01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CWKV01000009_1 6846-7007 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29772 : 37616 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage