Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JPTX01000039 Listeria monocytogenes strain G4599 contig46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000001 Listeria monocytogenes strain G4599 contig1, whole genome shotgun sequence 0 crisprs DEDDh,cas3 0 0 2 0
NZ_JPTX01000050 Listeria monocytogenes strain G4599 contig57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000006 Listeria monocytogenes strain G4599 contig6, whole genome shotgun sequence 0 crisprs casR,csa3,RT,WYL 0 0 1 0
NZ_JPTX01000004 Listeria monocytogenes strain G4599 contig4, whole genome shotgun sequence 1 crisprs cas6,cas8b2,cas7,cas5,cas3,cas2 1 12 0 0
NZ_JPTX01000025 Listeria monocytogenes strain G4599 contig30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000015 Listeria monocytogenes strain G4599 contig15, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JPTX01000061 Listeria monocytogenes strain G4599 contig70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000022 Listeria monocytogenes strain G4599 contig26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000043 Listeria monocytogenes strain G4599 contig50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000026 Listeria monocytogenes strain G4599 contig31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000033 Listeria monocytogenes strain G4599 contig39, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000027 Listeria monocytogenes strain G4599 contig32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000030 Listeria monocytogenes strain G4599 contig35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000028 Listeria monocytogenes strain G4599 contig33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000049 Listeria monocytogenes strain G4599 contig56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000032 Listeria monocytogenes strain G4599 contig38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000038 Listeria monocytogenes strain G4599 contig45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000031 Listeria monocytogenes strain G4599 contig37, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000058 Listeria monocytogenes strain G4599 contig66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000007 Listeria monocytogenes strain G4599 contig7, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_JPTX01000008 Listeria monocytogenes strain G4599 contig8, whole genome shotgun sequence 1 crisprs WYL,csa3 0 0 1 0
NZ_JPTX01000055 Listeria monocytogenes strain G4599 contig62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000037 Listeria monocytogenes strain G4599 contig43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000021 Listeria monocytogenes strain G4599 contig25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000042 Listeria monocytogenes strain G4599 contig49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000066 Listeria monocytogenes strain G4599 contig75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000019 Listeria monocytogenes strain G4599 contig23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000052 Listeria monocytogenes strain G4599 contig59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000063 Listeria monocytogenes strain G4599 contig72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000013 Listeria monocytogenes strain G4599 contig13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000046 Listeria monocytogenes strain G4599 contig53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000020 Listeria monocytogenes strain G4599 contig24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000064 Listeria monocytogenes strain G4599 contig73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000017 Listeria monocytogenes strain G4599 contig18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000062 Listeria monocytogenes strain G4599 contig71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000035 Listeria monocytogenes strain G4599 contig41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000011 Listeria monocytogenes strain G4599 contig11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000024 Listeria monocytogenes strain G4599 contig29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000056 Listeria monocytogenes strain G4599 contig63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000002 Listeria monocytogenes strain G4599 contig2, whole genome shotgun sequence 0 crisprs csa3,DinG,cas3 0 0 1 0
NZ_JPTX01000010 Listeria monocytogenes strain G4599 contig10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000048 Listeria monocytogenes strain G4599 contig55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000053 Listeria monocytogenes strain G4599 contig60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000045 Listeria monocytogenes strain G4599 contig52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000041 Listeria monocytogenes strain G4599 contig48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000014 Listeria monocytogenes strain G4599 contig14, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_JPTX01000029 Listeria monocytogenes strain G4599 contig34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000005 Listeria monocytogenes strain G4599 contig5, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_JPTX01000040 Listeria monocytogenes strain G4599 contig47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000054 Listeria monocytogenes strain G4599 contig61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000016 Listeria monocytogenes strain G4599 contig16, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_JPTX01000003 Listeria monocytogenes strain G4599 contig3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000012 Listeria monocytogenes strain G4599 contig12, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JPTX01000047 Listeria monocytogenes strain G4599 contig54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000018 Listeria monocytogenes strain G4599 contig19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000034 Listeria monocytogenes strain G4599 contig40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000059 Listeria monocytogenes strain G4599 contig67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000057 Listeria monocytogenes strain G4599 contig65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000036 Listeria monocytogenes strain G4599 contig42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000009 Listeria monocytogenes strain G4599 contig9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000051 Listeria monocytogenes strain G4599 contig58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000023 Listeria monocytogenes strain G4599 contig27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000065 Listeria monocytogenes strain G4599 contig74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000044 Listeria monocytogenes strain G4599 contig51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JPTX01000060 Listeria monocytogenes strain G4599 contig69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_JPTX01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 576 : 33216 40 Listeria_phage(97.44%) portal,tail,protease,capsid,terminase,holin NA
DBSCAN-SWA_2 57378 : 114213 56 Bacillus_virus(15.0%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_JPTX01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JPTX01000008_1 85967-86128 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 110169 : 118011 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JPTX01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 162 : 25573 35 Listeria_phage(100.0%) tail,capsid,holin,terminase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JPTX01000014.1|WP_003731276.1|25056_25308_-|hypothetical-protein 25056_25308_- 83 aa aa AcrIIA12 NA NA 162-25573 yes
4. NZ_JPTX01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51755 : 58192 6 Streptococcus_phage(33.33%) integrase,transposase attL 50918:50933|attR 55098:55113
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JPTX01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JPTX01000004_1 51031-52422 Unclear I-A
21 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JPTX01000004_1 1.2|51126|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51126-51161 36 NZ_JPTX01000014.1 20275-20310 0 1.0

1. spacer 1.2|51126|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to position: 20275-20310, mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JPTX01000004_1 1.2|51126|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51126-51161 36 DQ003642 Listeria phage A006, complete genome 16672-16707 0 1.0
NZ_JPTX01000004_1 1.3|51191|35|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51191-51225 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 31167-31201 0 1.0
NZ_JPTX01000004_1 1.13|51842|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51842-51877 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_JPTX01000004_1 1.13|51842|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51842-51877 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_JPTX01000004_1 1.1|51060|37|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51060-51096 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_JPTX01000004_1 1.6|51386|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51386-51421 36 KJ094023 Listeria phage LP-101, complete genome 17910-17945 1 0.972
NZ_JPTX01000004_1 1.1|51060|37|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51060-51096 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_JPTX01000004_1 1.12|51777|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51777-51812 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 26132-26167 2 0.944
NZ_JPTX01000004_1 1.17|52098|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52098-52133 36 KJ094022 Listeria phage LP-030-3, complete genome 38302-38337 2 0.944
NZ_JPTX01000004_1 1.18|52163|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52163-52198 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_JPTX01000004_1 1.6|51386|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51386-51421 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 227438-227473 4 0.889
NZ_JPTX01000004_1 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52294-52329 36 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 3844-3879 4 0.889
NZ_JPTX01000004_1 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52294-52329 36 HI504184 Sequence 26 from Patent EP2147092 3844-3879 4 0.889
NZ_JPTX01000004_1 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52294-52329 36 AJ417489 bacteriophage U153 int gene for U153 integrase 3844-3879 4 0.889
NZ_JPTX01000004_1 1.18|52163|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52163-52198 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_JPTX01000004_1 1.15|51970|33|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51970-52002 33 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764852-1764884 7 0.788
NZ_JPTX01000004_1 1.15|51970|33|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51970-52002 33 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39334 7 0.788
NZ_JPTX01000004_1 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51517-51552 36 AP013647 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C72-MedDCM-OCT-S41-C96, *** SEQUENCING IN PROGRESS *** 13305-13340 8 0.778
NZ_JPTX01000004_1 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 52294-52329 36 NC_019743 Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence 4997-5032 8 0.778
NZ_JPTX01000004_1 1.3|51191|35|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51191-51225 35 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 176358-176392 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_JPTX01000004_1 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT 52359-52393 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743
NZ_JPTX01000004_1 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51517-51552 36 NZ_CP018048 Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence 142304-142339 11 0.694
NZ_JPTX01000004_1 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT 51517-51552 36 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 410342-410377 11 0.694

1. spacer 1.2|51126|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

2. spacer 1.3|51191|35|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 0, identity: 1.0

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
attaatgataagagcggaaagaaaactttcaaggg	Protospacer
***********************************

3. spacer 1.13|51842|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

4. spacer 1.13|51842|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

5. spacer 1.1|51060|37|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

6. spacer 1.6|51386|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccgaattg	Protospacer
********************************.***

7. spacer 1.1|51060|37|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

8. spacer 1.12|51777|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 2, identity: 0.944

gtccacatcgacaataaaaaacacattgtatcactt	CRISPR spacer
gtccacattgacaacaaaaaacacattgtatcactt	Protospacer
********.*****.*********************

9. spacer 1.17|52098|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.944

ttgttcgacggcttagacaaccatcacgcttcttta	CRISPR spacer
cttttcgacggcttagacaaccatcacgcttcttta	Protospacer
.* *********************************

10. spacer 1.18|52163|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

11. spacer 1.6|51386|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 4, identity: 0.889

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccttgctc	Protospacer
******************************  *.* 

12. spacer 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

13. spacer 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

14. spacer 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

15. spacer 1.18|52163|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

16. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

17. spacer 1.15|51970|33|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

agaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
gcaaaaaaacatctttcctatttgttttatcac	Protospacer
. **************** ******* * *..*

18. spacer 1.15|51970|33|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

agaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
agaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
************ *********     **** *     

19. spacer 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to AP013647 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C72-MedDCM-OCT-S41-C96, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.778

actttagagaaagaaaaacaagaaaaag----taaaactg	CRISPR spacer
tctttagaaaaagaaatacaagaaaaaagatttaaa----	Protospacer
 *******.******* **********.    ****    

20. spacer 1.20|52294|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NC_019743 (Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence) position: , mismatch: 8, identity: 0.778

gtgtaattcttaattccgtattgattcgctagtttt---	CRISPR spacer
gtgtaattcttactgccgtattgatt---taactctgaa	Protospacer
************ * ***********   **..*.*   

21. spacer 1.3|51191|35|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.743

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
gaaattaaaaagagagcaaagaaaactttcaagga	Protospacer
.  * *.* ***** * *****************.

22. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

23. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

24. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

25. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

26. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

27. spacer 1.21|52359|35|NZ_JPTX01000004|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

28. spacer 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.694

actttagagaaagaaaaacaagaaaaagtaaaactg	CRISPR spacer
gaaaaagagaaagagaaacaagagaaagtaacaagc	Protospacer
.    *********.********.******* *   

29. spacer 1.8|51517|36|NZ_JPTX01000004|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 11, identity: 0.694

actttagagaaagaaaaacaagaaaaagtaaaactg	CRISPR spacer
gaaaaagagaaagagaaacaagagaaagtaacaagc	Protospacer
.    *********.********.******* *   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_JPTX01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 95742 : 104028 8 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_JPTX01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47 : 10169 17 Listeria_phage(93.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JPTX01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5762 12 Listeria_phage(100.0%) integrase attL 886:899|attR 6497:6510
DBSCAN-SWA_2 118371 : 125794 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_JPTX01000016
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JPTX01000016_1 215-789 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_JPTX01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 398661 : 409390 17 Listeria_phage(40.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage