Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JNGP01000043 Listeria monocytogenes strain 2012-L5322 contig_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000013 Listeria monocytogenes strain 2012-L5322 contig_13, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_JNGP01000055 Listeria monocytogenes strain 2012-L5322 contig_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000010 Listeria monocytogenes strain 2012-L5322 contig_10, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_JNGP01000002 Listeria monocytogenes strain 2012-L5322 contig_2, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 0
NZ_JNGP01000064 Listeria monocytogenes strain 2012-L5322 contig_79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000041 Listeria monocytogenes strain 2012-L5322 contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000053 Listeria monocytogenes strain 2012-L5322 contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000007 Listeria monocytogenes strain 2012-L5322 contig_7, whole genome shotgun sequence 1 crisprs NA 1 4 1 1
NZ_JNGP01000052 Listeria monocytogenes strain 2012-L5322 contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000054 Listeria monocytogenes strain 2012-L5322 contig_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000058 Listeria monocytogenes strain 2012-L5322 contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000014 Listeria monocytogenes strain 2012-L5322 contig_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_JNGP01000042 Listeria monocytogenes strain 2012-L5322 contig_44, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGP01000046 Listeria monocytogenes strain 2012-L5322 contig_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000038 Listeria monocytogenes strain 2012-L5322 contig_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000048 Listeria monocytogenes strain 2012-L5322 contig_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000035 Listeria monocytogenes strain 2012-L5322 contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000019 Listeria monocytogenes strain 2012-L5322 contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000017 Listeria monocytogenes strain 2012-L5322 contig_17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000009 Listeria monocytogenes strain 2012-L5322 contig_9, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_JNGP01000063 Listeria monocytogenes strain 2012-L5322 contig_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000021 Listeria monocytogenes strain 2012-L5322 contig_21, whole genome shotgun sequence 0 crisprs casR,WYL 0 0 0 0
NZ_JNGP01000016 Listeria monocytogenes strain 2012-L5322 contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000028 Listeria monocytogenes strain 2012-L5322 contig_28, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_JNGP01000050 Listeria monocytogenes strain 2012-L5322 contig_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000037 Listeria monocytogenes strain 2012-L5322 contig_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000068 Listeria monocytogenes strain 2012-L5322 contig_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000006 Listeria monocytogenes strain 2012-L5322 contig_6, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000029 Listeria monocytogenes strain 2012-L5322 contig_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000004 Listeria monocytogenes strain 2012-L5322 contig_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000061 Listeria monocytogenes strain 2012-L5322 contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000060 Listeria monocytogenes strain 2012-L5322 contig_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000011 Listeria monocytogenes strain 2012-L5322 contig_11, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGP01000044 Listeria monocytogenes strain 2012-L5322 contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000003 Listeria monocytogenes strain 2012-L5322 contig_3, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_JNGP01000057 Listeria monocytogenes strain 2012-L5322 contig_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000005 Listeria monocytogenes strain 2012-L5322 contig_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000049 Listeria monocytogenes strain 2012-L5322 contig_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000012 Listeria monocytogenes strain 2012-L5322 contig_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000018 Listeria monocytogenes strain 2012-L5322 contig_18, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_JNGP01000022 Listeria monocytogenes strain 2012-L5322 contig_22, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGP01000047 Listeria monocytogenes strain 2012-L5322 contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000027 Listeria monocytogenes strain 2012-L5322 contig_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000025 Listeria monocytogenes strain 2012-L5322 contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000040 Listeria monocytogenes strain 2012-L5322 contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000015 Listeria monocytogenes strain 2012-L5322 contig_15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000062 Listeria monocytogenes strain 2012-L5322 contig_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000032 Listeria monocytogenes strain 2012-L5322 contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000026 Listeria monocytogenes strain 2012-L5322 contig_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000033 Listeria monocytogenes strain 2012-L5322 contig_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000067 Listeria monocytogenes strain 2012-L5322 contig_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000034 Listeria monocytogenes strain 2012-L5322 contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000024 Listeria monocytogenes strain 2012-L5322 contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGP01000066 Listeria monocytogenes strain 2012-L5322 contig_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000065 Listeria monocytogenes strain 2012-L5322 contig_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000008 Listeria monocytogenes strain 2012-L5322 contig_8, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGP01000056 Listeria monocytogenes strain 2012-L5322 contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000031 Listeria monocytogenes strain 2012-L5322 contig_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000023 Listeria monocytogenes strain 2012-L5322 contig_23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000045 Listeria monocytogenes strain 2012-L5322 contig_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000036 Listeria monocytogenes strain 2012-L5322 contig_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000001 Listeria monocytogenes strain 2012-L5322 contig_1, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_JNGP01000030 Listeria monocytogenes strain 2012-L5322 contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000039 Listeria monocytogenes strain 2012-L5322 contig_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000020 Listeria monocytogenes strain 2012-L5322 contig_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000051 Listeria monocytogenes strain 2012-L5322 contig_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGP01000059 Listeria monocytogenes strain 2012-L5322 contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_JNGP01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGP01000007_1 30241-30527 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JNGP01000007_1 1.4|30463|36|NZ_JNGP01000007|PILER-CR,CRT 30463-30498 36 NZ_JNGP01000007.1 181553-181588 2 0.944

1. spacer 1.4|30463|36|NZ_JNGP01000007|PILER-CR,CRT matches to position: 181553-181588, mismatch: 2, identity: 0.944

acaataataggatattttggatttgtctgcgttcct	CRISPR spacer
acgataataggatattttggatttgcctgcgttcct	Protospacer
**.**********************.**********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JNGP01000007_1 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT 30399-30433 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_JNGP01000007_1 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT 30399-30433 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_JNGP01000007_1 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder 30399-30434 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_JNGP01000007_1 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder 30399-30434 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_JNGP01000007_1 1.1|30270|37|NZ_JNGP01000007|PILER-CR,CRT 30270-30306 37 NC_009812 Listeria phage B025, complete genome 30705-30741 2 0.946
NZ_JNGP01000007_1 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT 30399-30433 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_JNGP01000007_1 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder 30399-30434 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_JNGP01000007_1 1.5|30270|38|NZ_JNGP01000007|CRISPRCasFinder 30270-30307 38 NC_009812 Listeria phage B025, complete genome 30704-30741 3 0.921

1. spacer 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

2. spacer 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

3. spacer 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

4. spacer 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

5. spacer 1.1|30270|37|NZ_JNGP01000007|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.946

tttatttctcctacgcttttcttatttctgtaaataa	CRISPR spacer
tttatttctcctgcgcttttcttatttttgtaaataa	Protospacer
************.**************.*********

6. spacer 1.3|30399|35|NZ_JNGP01000007|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

7. spacer 1.7|30399|36|NZ_JNGP01000007|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

8. spacer 1.5|30270|38|NZ_JNGP01000007|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.921

tttatttctcctacgcttttcttatttctgtaaataag	CRISPR spacer
tttatttctcctgcgcttttcttatttttgtaaataaa	Protospacer
************.**************.*********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 163620 : 193159 41 Listeria_phage(44.83%) portal,capsid,protease,terminase,tail,integrase,head attL 167808:167822|attR 182163:182177
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGP01000007.1|WP_023552266.1|171999_172248_+|DUF3850-domain-containing-protein 171999_172248_+ 82 aa aa NA NA NA 163620-193159 yes
2. NZ_JNGP01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGP01000013_1 37110-37261 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JNGP01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25740 : 36468 17 Listeria_phage(40.0%) holin,tail NA
DBSCAN-SWA_2 252193 : 262224 7 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JNGP01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79066 : 87352 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JNGP01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGP01000014.1|WP_003731276.1|38104_38356_+|hypothetical-protein 38104_38356_+ 83 aa aa AcrIIA12 NA NA No NA
6. NZ_JNGP01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6070 12 Listeria_phage(88.89%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_JNGP01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 217464 : 224887 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 355685 : 415194 58 Bacillus_virus(15.79%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JNGP01000042
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 63 : 2434 8 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_JNGP01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 22182 26 Listeria_phage(100.0%) portal,capsid,terminase,plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_JNGP01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81897 : 89741 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 93659 : 102801 15 Listeria_phage(86.67%) integrase attL 91416:91428|attR 98703:98715
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_JNGP01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 20252 23 Listeria_phage(100.0%) tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage