Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JNGO01000034 Listeria monocytogenes strain 2012-L5240 contig_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000056 Listeria monocytogenes strain 2012-L5240 contig_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000008 Listeria monocytogenes strain 2012-L5240 contig_8, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_JNGO01000015 Listeria monocytogenes strain 2012-L5240 contig_15, whole genome shotgun sequence 1 crisprs WYL 0 0 0 0
NZ_JNGO01000016 Listeria monocytogenes strain 2012-L5240 contig_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000062 Listeria monocytogenes strain 2012-L5240 contig_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000024 Listeria monocytogenes strain 2012-L5240 contig_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000009 Listeria monocytogenes strain 2012-L5240 contig_9, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGO01000050 Listeria monocytogenes strain 2012-L5240 contig_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000063 Listeria monocytogenes strain 2012-L5240 contig_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000046 Listeria monocytogenes strain 2012-L5240 contig_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000027 Listeria monocytogenes strain 2012-L5240 contig_30, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGO01000010 Listeria monocytogenes strain 2012-L5240 contig_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_JNGO01000044 Listeria monocytogenes strain 2012-L5240 contig_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000028 Listeria monocytogenes strain 2012-L5240 contig_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000047 Listeria monocytogenes strain 2012-L5240 contig_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000030 Listeria monocytogenes strain 2012-L5240 contig_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000005 Listeria monocytogenes strain 2012-L5240 contig_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000039 Listeria monocytogenes strain 2012-L5240 contig_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000049 Listeria monocytogenes strain 2012-L5240 contig_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000014 Listeria monocytogenes strain 2012-L5240 contig_14, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_JNGO01000057 Listeria monocytogenes strain 2012-L5240 contig_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000036 Listeria monocytogenes strain 2012-L5240 contig_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000003 Listeria monocytogenes strain 2012-L5240 contig_3, whole genome shotgun sequence 0 crisprs DinG,csa3 0 0 2 0
NZ_JNGO01000023 Listeria monocytogenes strain 2012-L5240 contig_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000042 Listeria monocytogenes strain 2012-L5240 contig_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000020 Listeria monocytogenes strain 2012-L5240 contig_21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000018 Listeria monocytogenes strain 2012-L5240 contig_19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000060 Listeria monocytogenes strain 2012-L5240 contig_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000038 Listeria monocytogenes strain 2012-L5240 contig_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000006 Listeria monocytogenes strain 2012-L5240 contig_6, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_JNGO01000051 Listeria monocytogenes strain 2012-L5240 contig_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000037 Listeria monocytogenes strain 2012-L5240 contig_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000033 Listeria monocytogenes strain 2012-L5240 contig_39, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGO01000017 Listeria monocytogenes strain 2012-L5240 contig_18, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGO01000002 Listeria monocytogenes strain 2012-L5240 contig_2, whole genome shotgun sequence 1 crisprs NA 1 4 1 1
NZ_JNGO01000001 Listeria monocytogenes strain 2012-L5240 contig_1, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000011 Listeria monocytogenes strain 2012-L5240 contig_11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000004 Listeria monocytogenes strain 2012-L5240 contig_4, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 0
NZ_JNGO01000025 Listeria monocytogenes strain 2012-L5240 contig_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000053 Listeria monocytogenes strain 2012-L5240 contig_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000054 Listeria monocytogenes strain 2012-L5240 contig_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000007 Listeria monocytogenes strain 2012-L5240 contig_7, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGO01000035 Listeria monocytogenes strain 2012-L5240 contig_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000058 Listeria monocytogenes strain 2012-L5240 contig_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000048 Listeria monocytogenes strain 2012-L5240 contig_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000045 Listeria monocytogenes strain 2012-L5240 contig_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000031 Listeria monocytogenes strain 2012-L5240 contig_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000021 Listeria monocytogenes strain 2012-L5240 contig_22, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_JNGO01000013 Listeria monocytogenes strain 2012-L5240 contig_13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000032 Listeria monocytogenes strain 2012-L5240 contig_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000022 Listeria monocytogenes strain 2012-L5240 contig_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000043 Listeria monocytogenes strain 2012-L5240 contig_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000041 Listeria monocytogenes strain 2012-L5240 contig_49, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000019 Listeria monocytogenes strain 2012-L5240 contig_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000059 Listeria monocytogenes strain 2012-L5240 contig_77, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000055 Listeria monocytogenes strain 2012-L5240 contig_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000012 Listeria monocytogenes strain 2012-L5240 contig_12, whole genome shotgun sequence 1 crisprs WYL,casR 2 0 0 0
NZ_JNGO01000029 Listeria monocytogenes strain 2012-L5240 contig_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000040 Listeria monocytogenes strain 2012-L5240 contig_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000061 Listeria monocytogenes strain 2012-L5240 contig_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000052 Listeria monocytogenes strain 2012-L5240 contig_67, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGO01000026 Listeria monocytogenes strain 2012-L5240 contig_29, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_JNGO01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 177 : 22349 26 Listeria_phage(100.0%) portal,capsid,terminase,tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_JNGO01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8961 15 Listeria_phage(86.67%) integrase attL 2800:2812|attR 10594:10606
DBSCAN-SWA_2 12879 : 20723 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JNGO01000014
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGO01000014_1 37100-37251 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JNGO01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5889 12 Listeria_phage(88.89%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JNGO01000002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGO01000002_1 30231-30517 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JNGO01000002_1 1.4|30453|36|NZ_JNGO01000002|PILER-CR,CRT 30453-30488 36 NZ_JNGO01000002.1 181543-181578 2 0.944

1. spacer 1.4|30453|36|NZ_JNGO01000002|PILER-CR,CRT matches to position: 181543-181578, mismatch: 2, identity: 0.944

acaataataggatattttggatttgtctgcgttcct	CRISPR spacer
acgataataggatattttggatttgcctgcgttcct	Protospacer
**.**********************.**********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JNGO01000002_1 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT 30389-30423 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_JNGO01000002_1 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT 30389-30423 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_JNGO01000002_1 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder 30389-30424 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_JNGO01000002_1 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder 30389-30424 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_JNGO01000002_1 1.1|30260|37|NZ_JNGO01000002|PILER-CR,CRT 30260-30296 37 NC_009812 Listeria phage B025, complete genome 30705-30741 2 0.946
NZ_JNGO01000002_1 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT 30389-30423 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_JNGO01000002_1 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder 30389-30424 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_JNGO01000002_1 1.5|30260|38|NZ_JNGO01000002|CRISPRCasFinder 30260-30297 38 NC_009812 Listeria phage B025, complete genome 30704-30741 3 0.921

1. spacer 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

2. spacer 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

3. spacer 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

4. spacer 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

5. spacer 1.1|30260|37|NZ_JNGO01000002|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.946

tttatttctcctacgcttttcttatttctgtaaataa	CRISPR spacer
tttatttctcctgcgcttttcttatttttgtaaataa	Protospacer
************.**************.*********

6. spacer 1.3|30389|35|NZ_JNGO01000002|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

7. spacer 1.7|30389|36|NZ_JNGO01000002|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

8. spacer 1.5|30260|38|NZ_JNGO01000002|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.921

tttatttctcctacgcttttcttatttctgtaaataag	CRISPR spacer
tttatttctcctgcgcttttcttatttttgtaaataaa	Protospacer
************.**************.*********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 163610 : 193149 41 Listeria_phage(44.83%) terminase,head,portal,tail,protease,capsid,integrase attL 167798:167812|attR 182153:182167
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGO01000002.1|WP_023552266.1|171989_172238_+|DUF3850-domain-containing-protein 171989_172238_+ 82 aa aa NA NA NA 163610-193149 yes
6. NZ_JNGO01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25730 : 36458 17 Listeria_phage(40.0%) tail,holin NA
DBSCAN-SWA_2 252183 : 262214 7 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_JNGO01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 183964 : 191387 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 322185 : 381694 58 Bacillus_virus(15.79%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JNGO01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88169 : 96455 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_JNGO01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 20232 23 Listeria_phage(100.0%) tail,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_JNGO01000012
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGO01000012_1 116584-117168 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JNGO01000012_1 1.3|116779|39|NZ_JNGO01000012|CRT 116779-116817 39 NZ_JNGO01000012.1 114574-114612 0 1.0
NZ_JNGO01000012_1 1.6|117013|39|NZ_JNGO01000012|CRT 117013-117051 39 NZ_JNGO01000012.1 114808-114846 2 0.949

1. spacer 1.3|116779|39|NZ_JNGO01000012|CRT matches to position: 114574-114612, mismatch: 0, identity: 1.0

tatgccatgtttgaagattgtactagtcttgaagagctg	CRISPR spacer
tatgccatgtttgaagattgtactagtcttgaagagctg	Protospacer
***************************************

2. spacer 1.6|117013|39|NZ_JNGO01000012|CRT matches to position: 114808-114846, mismatch: 2, identity: 0.949

cgtgccatgtttgctggttgtactagtcttgaagtgtta	CRISPR spacer
cgtgccatgtttgctggctgtactagtcttgaagcgtta	Protospacer
*****************.****************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_JNGO01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53 : 2424 8 Listeria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_JNGO01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGO01000010.1|WP_003731276.1|38094_38346_+|hypothetical-protein 38094_38346_+ 83 aa aa AcrIIA12 NA NA No NA
13. NZ_JNGO01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGO01000015_1 50572-50733 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage