Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JNGJ01000022 Listeria monocytogenes strain J2692 J2692-1.seq22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000023 Listeria monocytogenes strain J2692 J2692-1.seq23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000010 Listeria monocytogenes strain J2692 J2692-1.seq10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000006 Listeria monocytogenes strain J2692 J2692-1.seq6, whole genome shotgun sequence 1 crisprs WYL,casR 2 4 0 0
NZ_JNGJ01000008 Listeria monocytogenes strain J2692 J2692-1.seq8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000013 Listeria monocytogenes strain J2692 J2692-1.seq13, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JNGJ01000025 Listeria monocytogenes strain J2692 J2692-1.seq25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000029 Listeria monocytogenes strain J2692 J2692-1.seq30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000003 Listeria monocytogenes strain J2692 J2692-1.seq3, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_JNGJ01000009 Listeria monocytogenes strain J2692 J2692-1.seq9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000016 Listeria monocytogenes strain J2692 J2692-1.seq16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000007 Listeria monocytogenes strain J2692 J2692-1.seq7, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000002 Listeria monocytogenes strain J2692 J2692-1.seq2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000001 Listeria monocytogenes strain J2692 J2692-1.seq1, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_JNGJ01000015 Listeria monocytogenes strain J2692 J2692-1.seq15, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_JNGJ01000027 Listeria monocytogenes strain J2692 J2692-1.seq28, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_JNGJ01000004 Listeria monocytogenes strain J2692 J2692-1.seq4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000019 Listeria monocytogenes strain J2692 J2692-1.seq19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000018 Listeria monocytogenes strain J2692 J2692-1.seq18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000011 Listeria monocytogenes strain J2692 J2692-1.seq11, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_JNGJ01000026 Listeria monocytogenes strain J2692 J2692-1.seq26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000014 Listeria monocytogenes strain J2692 J2692-1.seq14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000005 Listeria monocytogenes strain J2692 J2692-1.seq5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000021 Listeria monocytogenes strain J2692 J2692-1.seq21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000012 Listeria monocytogenes strain J2692 J2692-1.seq12, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 2 0
NZ_JNGJ01000024 Listeria monocytogenes strain J2692 J2692-1.seq24, whole genome shotgun sequence 2 crisprs csn2,cas2,cas1,cas9 4 27 1 0
NZ_JNGJ01000020 Listeria monocytogenes strain J2692 J2692-1.seq20, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 1 0
NZ_JNGJ01000017 Listeria monocytogenes strain J2692 J2692-1.seq17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JNGJ01000028 Listeria monocytogenes strain J2692 J2692-1.seq29, whole genome shotgun sequence 0 crisprs NA 0 0 1 2

Results visualization

1. NZ_JNGJ01000024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGJ01000024_1 5218-7301 TypeII II-A,II-B
31 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGJ01000024_2 109949-110059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 NZ_JNGJ01000028.1 21120-21149 0 1.0
NZ_JNGJ01000024_1 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5584-5613 30 NZ_JNGJ01000011.1 303061-303090 0 1.0
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 NZ_JNGJ01000028.1 14297-14326 0 1.0
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 NZ_JNGJ01000028.1 14298-14326 0 1.0

1. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to position: 21120-21149, mismatch: 0, identity: 1.0

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
aacaagaaaaaagatccagacaatattgca	Protospacer
******************************

2. spacer 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to position: 303061-303090, mismatch: 0, identity: 1.0

taagcgtaatattaatgtcaaagcttctag	CRISPR spacer
taagcgtaatattaatgtcaaagcttctag	Protospacer
******************************

3. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to position: 14297-14326, mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

4. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to position: 14298-14326, mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JNGJ01000024_1 1.2|5320|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5320-5349 30 DQ003637 Listeria phage A500, complete genome 30242-30271 0 1.0
NZ_JNGJ01000024_1 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5584-5613 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 222544-222573 0 1.0
NZ_JNGJ01000024_1 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5584-5613 30 KJ094023 Listeria phage LP-101, complete genome 13017-13046 0 1.0
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 NC_009813 Listeria phage B054, complete genome 2110-2139 0 1.0
NZ_JNGJ01000024_1 1.15|6179|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6179-6208 30 KP399678 Listeria phage vB_LmoS_293, complete genome 38838-38867 0 1.0
NZ_JNGJ01000024_1 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6707-6736 30 KJ094022 Listeria phage LP-030-3, complete genome 18116-18145 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 MH299806 Listeria phage LP-KV022, complete genome 20588-20617 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 JB137888 Sequence 7 from Patent WO2012159774 33043-33072 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 KJ094025 Listeria phage LP-032 contig 2, partial genome 22432-22461 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 MN114083 Listeria phage LP-013, complete genome 15094-15123 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 NC_021785 Listeria phage LP-110, complete genome 43434-43463 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 MN128593 Listeria phage LP-031, complete genome 15073-15102 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 MN904502 Listeria phage LP-018, complete genome 15094-15123 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 JX442241 Listeria phage P70, complete genome 20591-20620 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 KJ094020 Listeria phage LP-026, complete genome 64637-64666 0 1.0
NZ_JNGJ01000024_1 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6839-6868 30 MN114082 Listeria phage LP-010, complete genome 15095-15124 0 1.0
NZ_JNGJ01000024_1 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6971-7001 31 KJ094023 Listeria phage LP-101, complete genome 2451-2481 0 1.0
NZ_JNGJ01000024_1 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7104-7133 30 MT500540 Listeria phage LP-HM00113468, complete genome 36945-36974 0 1.0
NZ_JNGJ01000024_1 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7104-7133 30 NC_009812 Listeria phage B025, complete genome 7937-7966 0 1.0
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MH341452 Listeria phage PSU-VKH-LP040, complete genome 37120-37149 0 1.0
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 DQ003637 Listeria phage A500, complete genome 36223-36252 0 1.0
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 KP399677 Listeria phage vB_LmoS_188, complete genome 36255-36284 0 1.0
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 KJ094022 Listeria phage LP-030-3, complete genome 5778-5807 0 1.0
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 KP399678 Listeria phage vB_LmoS_293, complete genome 38539-38568 0 1.0
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 MH341451 Listeria phage PSU-VKH-LP019, complete genome 4931-4960 0 1.0
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 KP399677 Listeria phage vB_LmoS_188, complete genome 4940-4969 0 1.0
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 DQ003642 Listeria phage A006, complete genome 4940-4969 0 1.0
NZ_JNGJ01000024_1 1.33|7104|29|NZ_JNGJ01000024|PILER-CR 7104-7132 29 MT500540 Listeria phage LP-HM00113468, complete genome 36945-36973 0 1.0
NZ_JNGJ01000024_1 1.33|7104|29|NZ_JNGJ01000024|PILER-CR 7104-7132 29 NC_009812 Listeria phage B025, complete genome 7938-7966 0 1.0
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MH341452 Listeria phage PSU-VKH-LP040, complete genome 37121-37149 0 1.0
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 DQ003637 Listeria phage A500, complete genome 36224-36252 0 1.0
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 KP399677 Listeria phage vB_LmoS_188, complete genome 36256-36284 0 1.0
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 KJ094022 Listeria phage LP-030-3, complete genome 5779-5807 0 1.0
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 KP399678 Listeria phage vB_LmoS_293, complete genome 38540-38568 0 1.0
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 MH341451 Listeria phage PSU-VKH-LP019, complete genome 4931-4959 0 1.0
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 KP399677 Listeria phage vB_LmoS_188, complete genome 4940-4968 0 1.0
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 DQ003642 Listeria phage A006, complete genome 4940-4968 0 1.0
NZ_JNGJ01000024_1 1.2|5320|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5320-5349 30 KJ094022 Listeria phage LP-030-3, complete genome 39811-39840 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 128892-128921 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MT178766 Listeria virus P100plus, complete genome 93908-93937 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_047872 Listeria phage LMTA-94, complete genome 5469-5498 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MT178767 Listeria virus P200, complete genome 93909-93938 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 DQ004855 Listeria bacteriophage P100, complete genome 93901-93930 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KJ591605 Listeria phage LMTA-57, complete genome 15850-15879 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MN128594 Listeria phage LP-066, complete genome 128411-128440 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_042048 Listeria phage LMTA-34, complete genome 5592-5621 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KJ668717 Listeria phage LMTA-34 hypothetical proteins, transposase domain-containing protein, and hypothetical proteins genes, complete cds 913-942 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_041862 Listeria phage LP-064, complete genome 1706-1735 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KJ094030 Listeria phage LP-083-2, complete genome 133572-133601 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 JX126918 Listeria phage LP-125, complete genome 1706-1735 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_024360 Listeria phage LMSP-25, complete genome 5592-5621 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KJ535721 Listeria phage List-36, complete genome 227-256 1 0.967
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KJ094031 Listeria phage LP-124, complete genome 95687-95716 1 0.967
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 NC_003216 Listeria phage A118, complete genome 38773-38802 1 0.967
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 AJ242593 Bacteriophage A118 complete genome 38773-38802 1 0.967
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 DQ003642 Listeria phage A006, complete genome 36068-36097 1 0.967
NZ_JNGJ01000024_1 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5518-5547 30 KJ094023 Listeria phage LP-101, complete genome 33655-33684 1 0.967
NZ_JNGJ01000024_1 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5584-5613 30 MT500540 Listeria phage LP-HM00113468, complete genome 31908-31937 1 0.967
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 MH341453 Listeria phage PSU-VKH-LP041, complete genome 2110-2139 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 MH299806 Listeria phage LP-KV022, complete genome 51683-51712 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 MN114083 Listeria phage LP-013, complete genome 47204-47233 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 NC_021785 Listeria phage LP-110, complete genome 9401-9430 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 11155-11184 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 MN128593 Listeria phage LP-031, complete genome 46499-46528 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 NC_021787 Listeria phage LP-037, complete genome 3866-3895 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 MN904502 Listeria phage LP-018, complete genome 46656-46685 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 JX442241 Listeria phage P70, complete genome 53116-53145 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 KJ094020 Listeria phage LP-026, complete genome 30018-30047 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 KJ094021 Listeria phage LP-114, complete genome 37209-37238 1 0.967
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 MN114082 Listeria phage LP-010, complete genome 46489-46518 1 0.967
NZ_JNGJ01000024_1 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6971-7001 31 NC_009812 Listeria phage B025, complete genome 2459-2489 1 0.968
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 218230-218259 1 0.967
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MT500540 Listeria phage LP-HM00113468, complete genome 36219-36248 1 0.967
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 KJ094023 Listeria phage LP-101, complete genome 8703-8732 1 0.967
NZ_JNGJ01000024_1 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7104-7133 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 217503-217532 1 0.967
NZ_JNGJ01000024_1 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7104-7133 30 KJ094023 Listeria phage LP-101, complete genome 7976-8005 1 0.967
NZ_JNGJ01000024_1 1.33|7104|29|NZ_JNGJ01000024|PILER-CR 7104-7132 29 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 217504-217532 1 0.966
NZ_JNGJ01000024_1 1.33|7104|29|NZ_JNGJ01000024|PILER-CR 7104-7132 29 KJ094023 Listeria phage LP-101, complete genome 7977-8005 1 0.966
NZ_JNGJ01000024_1 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5254-5283 30 DQ003637 Listeria phage A500, complete genome 37232-37261 2 0.933
NZ_JNGJ01000024_1 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5254-5283 30 KJ094022 Listeria phage LP-030-3, complete genome 6787-6816 2 0.933
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 MH341451 Listeria phage PSU-VKH-LP019, complete genome 36962-36991 2 0.933
NZ_JNGJ01000024_1 1.16|6245|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6245-6274 30 KJ094023 Listeria phage LP-101, complete genome 18962-18991 2 0.933
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 JB137888 Sequence 7 from Patent WO2012159774 1635-1664 2 0.933
NZ_JNGJ01000024_1 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6971-7001 31 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 211978-212008 2 0.935
NZ_JNGJ01000024_1 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6905-6934 30 KJ094027 Listeria phage LP-083-1 contig 1, partial genome 830-859 3 0.9
NZ_JNGJ01000024_1 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6905-6934 30 DQ003641 Listeria phage P35, complete genome 583-612 3 0.9
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MH319731 Marine virus AG-345-E02 Ga0172268_11 genomic sequence 31346-31375 5 0.833
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 HQ632825 Prochlorococcus phage P-SSM5 genomic sequence 237944-237973 5 0.833
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 AY939844 Prochlorococcus phage P-SSM2, complete genome 101085-101114 5 0.833
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 5373-5402 6 0.8
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NZ_CP006684 Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence 172436-172465 6 0.8
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NZ_AP021886 Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence 172441-172470 6 0.8
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NZ_AP018525 Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence 172264-172293 6 0.8
NZ_JNGJ01000024_1 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5518-5547 30 NC_025830 Escherichia phage Av-05, complete genome 22529-22558 6 0.8
NZ_JNGJ01000024_1 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5584-5613 30 NZ_CP044539 Borrelia sp. CA690 plasmid cp26, complete sequence 11037-11066 6 0.8
NZ_JNGJ01000024_1 1.7|5650|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5650-5679 30 NZ_CP024448 Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence 45414-45443 6 0.8
NZ_JNGJ01000024_1 1.10|5848|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5848-5878 31 MW057856 Providencia phage PSTCR4, complete genome 27578-27608 6 0.806
NZ_JNGJ01000024_1 1.12|5981|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 5981-6010 30 MF351863 Synechococcus phage Bellamy, complete genome 141517-141546 6 0.8
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MN694096 Marine virus AFVG_250M214, complete genome 34457-34486 6 0.8
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MN694078 Marine virus AFVG_250M213, complete genome 4053-4082 6 0.8
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MN693931 Marine virus AFVG_250M215, complete genome 4055-4084 6 0.8
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_029057 Vibrio phage qdvp001, partial genome 61001-61030 6 0.8
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_014660 Acinetobacter phage Ac42, complete genome 66892-66921 6 0.8
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 34476-34504 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 64871-64899 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 32646-32674 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 55763-55791 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 106758-106786 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 65650-65678 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 112907-112935 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 72035-72063 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 81179-81207 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 68971-68999 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 69554-69582 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 4258-4286 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 51515-51543 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP045014 Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence 57284-57312 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP040742 Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence 22677-22705 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 79900-79928 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 39057-39085 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 24903-24931 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 36356-36384 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP035656 Enterococcus faecium strain UAMSEF_09 plasmid unnamed2 56176-56204 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP035662 Enterococcus faecium strain UAMSEF_20 plasmid unnamed2 25072-25100 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 71282-71310 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 81700-81728 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 119199-119227 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP012462 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2 53039-53067 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 77050-77078 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 743688-743716 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 60226-60254 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_018965 Staphylococcus aureus plasmid SAP077A, complete sequence 14325-14353 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_019009 Staphylococcus aureus plasmid SAP078A, complete sequence 34587-34615 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP026065 Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed 14932-14960 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_013340 Staphylococcus aureus plasmid SAP076A, complete sequence 9219-9247 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_014535 Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence 2899-2927 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 22583-22611 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 25706-25734 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP028469 Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence 8211-8239 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MN694237 Marine virus AFVG_250M414, complete genome 17909-17937 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 202813-202841 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MN694607 Marine virus AFVG_250M465, complete genome 20845-20873 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MN508817 Yersinia phage JC221, partial genome 44268-44296 6 0.793
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MN694635 Marine virus AFVG_250M372, complete genome 17898-17926 6 0.793
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 575781-575809 6 0.793
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 322320-322348 6 0.793
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 322320-322348 6 0.793
NZ_JNGJ01000024_1 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5254-5283 30 KT878766 Staphylococcus phage P1105, complete genome 32141-32170 7 0.767
NZ_JNGJ01000024_1 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5254-5283 30 NC_025460 Staphylococcus phage phiSa119, complete genome 7352-7381 7 0.767
NZ_JNGJ01000024_1 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5518-5547 30 MN693453 Marine virus AFVG_25M364, complete genome 1719-1748 7 0.767
NZ_JNGJ01000024_1 1.13|6047|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6047-6076 30 NZ_LR134421 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12 42588-42617 7 0.767
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 NC_048855 Phage NBEco002, complete genome 99824-99853 7 0.767
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 NC_017969 Escherichia phage bV_EcoS_AKFV33, complete genome 99958-99987 7 0.767
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 NC_024139 Escherichia phage vB_EcoS_FFH1, complete genome 99882-99911 7 0.767
NZ_JNGJ01000024_1 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6113-6142 30 MN022787 Salmonella virus VSe12, complete genome 101179-101208 7 0.767
NZ_JNGJ01000024_1 1.15|6179|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6179-6208 30 MT521992 Rhodococcus phage NiceHouse, complete genome 18590-18619 7 0.767
NZ_JNGJ01000024_1 1.18|6377|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6377-6406 30 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 374312-374341 7 0.767
NZ_JNGJ01000024_1 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6773-6802 30 NZ_CP029234 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence 189763-189792 7 0.767
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_015223 Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence 3346-3375 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 34475-34504 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 64871-64900 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 32645-32674 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 55763-55792 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR135332 Enterococcus faecium isolate E7471 plasmid 2 106757-106786 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 65650-65679 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 112906-112935 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 72035-72064 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP038997 Enterococcus faecium strain SRR24 plasmid pSRR24 81179-81208 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 68971-69000 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 69553-69582 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 4258-4287 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR134107 Enterococcus faecium isolate E6043 plasmid 3 51514-51543 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 179399-179428 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP045014 Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence 57284-57313 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP040742 Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence 22676-22705 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 79900-79929 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_AP022343 Enterococcus faecium strain KUHS13 plasmid pELF2 39056-39085 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 24902-24931 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP019994 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2 36355-36384 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP035656 Enterococcus faecium strain UAMSEF_09 plasmid unnamed2 56176-56205 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP035662 Enterococcus faecium strain UAMSEF_20 plasmid unnamed2 25071-25100 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 71282-71311 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 81700-81729 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 119199-119228 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP012462 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2 53039-53068 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 77050-77079 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 743688-743717 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 60226-60255 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_018965 Staphylococcus aureus plasmid SAP077A, complete sequence 14324-14353 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_019009 Staphylococcus aureus plasmid SAP078A, complete sequence 34587-34616 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP026065 Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed 14932-14961 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_013340 Staphylococcus aureus plasmid SAP076A, complete sequence 9218-9247 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_014535 Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence 2899-2928 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 22583-22612 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP010104 Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence 25706-25735 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP028469 Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence 8210-8239 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MN694237 Marine virus AFVG_250M414, complete genome 17908-17937 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 202813-202842 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MN694607 Marine virus AFVG_250M465, complete genome 20845-20874 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MN508817 Yersinia phage JC221, partial genome 44268-44297 7 0.767
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MN694635 Marine virus AFVG_250M372, complete genome 17897-17926 7 0.767
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 575781-575810 7 0.767
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 322320-322349 7 0.767
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 322320-322349 7 0.767
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 96172-96200 7 0.759
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 179400-179428 7 0.759
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 5522-5550 7 0.759
NZ_JNGJ01000024_1 1.35|7236|29|NZ_JNGJ01000024|PILER-CR 7236-7264 29 NZ_CP040759 Paracoccus sp. 2251 plasmid unnamed8, complete sequence 57863-57891 7 0.759
NZ_JNGJ01000024_1 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5254-5283 30 JN638751 Bacillus phage G, complete genome 221970-221999 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KF771238 Escherichia phage bV_EcoS_AHS24, complete genome 15160-15189 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 KF771236 Escherichia phage bV_EcoS_AHP24, complete genome 15159-15188 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NZ_CP017832 Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence 78547-78576 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MN693012 Marine virus AFVG_117M3, complete genome 51346-51375 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 NC_007581 Clostridium phage c-st, complete genome 83359-83388 8 0.733
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 AP008983 Clostridium phage c-st genomic DNA, complete genome 83359-83388 8 0.733
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 MT932211 Escherichia phage VEcB, complete genome 142320-142349 8 0.733
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 MN850573 Escherichia phage muut, complete genome 70019-70048 8 0.733
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 MN850601 Escherichia phage inny, complete genome 133203-133232 8 0.733
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 FR775895 Enterobacteria phage phi92, complete genome 143564-143593 8 0.733
NZ_JNGJ01000024_1 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5452-5481 30 MN850632 Escherichia phage alia, complete genome 83841-83870 8 0.733
NZ_JNGJ01000024_1 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5518-5547 30 AP014255 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S25-C160, *** SEQUENCING IN PROGRESS *** 5379-5408 8 0.733
NZ_JNGJ01000024_1 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5518-5547 30 MT349887 Acinetobacter phage 5W, complete genome 19645-19674 8 0.733
NZ_JNGJ01000024_1 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6707-6736 30 NZ_CP013462 Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence 10086-10115 8 0.733
NZ_JNGJ01000024_1 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6905-6934 30 AP018399 Xanthomonas phage XacN1 DNA, complete genome 59853-59882 8 0.733
NZ_JNGJ01000024_1 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6905-6934 30 AP018399 Xanthomonas phage XacN1 DNA, complete genome 378648-378677 8 0.733
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 139099-139128 8 0.733
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 MN692983 Marine virus AFVG_117M11, complete genome 3682-3711 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 96171-96200 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP035176 Lactobacillus plantarum strain SRCM103426 plasmid unnamed2 15623-15652 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 39839-39868 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 73108-73137 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP025417 Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence 18402-18431 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NC_021519 Lactobacillus plantarum 16 plasmid Lp16H, complete sequence 8495-8524 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP046661 Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence 35311-35340 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP046662 Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence 14284-14313 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP050809 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence 3751-3780 8 0.733
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 5522-5551 8 0.733
NZ_JNGJ01000024_1 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7236-7265 30 NZ_CP040759 Paracoccus sp. 2251 plasmid unnamed8, complete sequence 57863-57892 8 0.733
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 9365-9393 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP035176 Lactobacillus plantarum strain SRCM103426 plasmid unnamed2 15624-15652 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP035115 Lactobacillus plantarum strain SRCM103295 plasmid unnamed2 39839-39867 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP035567 Lactobacillus plantarum strain SRCM103300 plasmid unnamed1 73108-73136 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP025417 Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence 18403-18431 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NC_021519 Lactobacillus plantarum 16 plasmid Lp16H, complete sequence 8495-8523 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP046661 Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence 35312-35340 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP046662 Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence 14284-14312 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 NZ_CP050809 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence 3751-3779 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 MF547663 Clostridioides phage LIBA2945, complete genome 113801-113829 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 112607-112635 8 0.724
NZ_JNGJ01000024_1 1.34|7170|29|NZ_JNGJ01000024|PILER-CR 7170-7198 29 LN681537 Clostridium phage phiCD211, complete genome 121469-121497 8 0.724
NZ_JNGJ01000024_1 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 5386-5415 30 MN694632 Marine virus AFVG_250M389, complete genome 59767-59796 9 0.7
NZ_JNGJ01000024_1 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6707-6736 30 MW057858 Providencia phage PSTCR6, complete genome 157-186 9 0.7
NZ_JNGJ01000024_1 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6905-6934 30 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 27224-27253 9 0.7
NZ_JNGJ01000024_1 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6971-7001 31 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 86914-86944 9 0.71
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 9364-9393 9 0.7
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 MF547663 Clostridioides phage LIBA2945, complete genome 113801-113830 9 0.7
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 112607-112636 9 0.7
NZ_JNGJ01000024_1 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7170-7199 30 LN681537 Clostridium phage phiCD211, complete genome 121469-121498 9 0.7
NZ_JNGJ01000024_1 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6443-6472 30 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 772909-772938 10 0.667
NZ_JNGJ01000024_1 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6443-6472 30 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 65251-65280 10 0.667
NZ_JNGJ01000024_1 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6443-6472 30 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 65071-65100 10 0.667
NZ_JNGJ01000024_1 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR 6443-6472 30 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 65251-65280 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP016361 Bacillus cereus strain M13 plasmid pBCM1301, complete sequence 3748-3777 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_KY940428 UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence 178471-178500 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 131247-131276 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence 171457-171486 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 169285-169314 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 3747-3776 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 309960-309989 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 107884-107913 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence 159582-159611 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_010924 Bacillus cereus strain AH187 plasmid pCER270, complete sequence 215991-216020 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_011777 Bacillus cereus AH820 plasmid pAH820_272, complete sequence 160923-160952 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 CP045776 Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence 208416-208445 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 71253-71282 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 90843-90872 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence 214860-214889 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP040343 Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence 30806-30835 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP033789 Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence 272077-272106 10 0.667
NZ_JNGJ01000024_1 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT 7038-7067 30 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 54269-54298 10 0.667

1. spacer 1.2|5320|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta	Protospacer
******************************

2. spacer 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

taagcgtaatattaatgtcaaagcttctag	CRISPR spacer
taagcgtaatattaatgtcaaagcttctag	Protospacer
******************************

3. spacer 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

taagcgtaatattaatgtcaaagcttctag	CRISPR spacer
taagcgtaatattaatgtcaaagcttctag	Protospacer
******************************

4. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 0, identity: 1.0

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
gtgtttctttcccaccttctggttcaacgc	Protospacer
******************************

5. spacer 1.15|6179|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gctgcctcgctttactcttcgttatctcca	CRISPR spacer
gctgcctcgctttactcttcgttatctcca	Protospacer
******************************

6. spacer 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
gcgcttcccatcgatttaaacgcatttaca	Protospacer
******************************

7. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

8. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

9. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

10. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

11. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

12. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

13. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

14. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

15. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

16. spacer 1.25|6839|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0

gccttgcttgacccaactagtgacttcttc	CRISPR spacer
gccttgcttgacccaactagtgacttcttc	Protospacer
******************************

17. spacer 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
attcgtgaatgccgacaatcgttcatttcca	Protospacer
*******************************

18. spacer 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctaggtctagg	Protospacer
******************************

19. spacer 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctaggtctagg	Protospacer
******************************

20. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

21. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

22. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

23. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

24. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gtcatttttaatagtttcaattgctgataa	Protospacer
******************************

25. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

26. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

27. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga	Protospacer
******************************

28. spacer 1.33|7104|29|NZ_JNGJ01000024|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctaggtctag	Protospacer
*****************************

29. spacer 1.33|7104|29|NZ_JNGJ01000024|PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctaggtctag	Protospacer
*****************************

30. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

31. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

32. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

33. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

34. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gtcatttttaatagtttcaattgctgata	Protospacer
*****************************

35. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

36. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

37. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg	Protospacer
*****************************

38. spacer 1.2|5320|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967

agcttgcgtttagaggacgaagaaaaacta	CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta	Protospacer
***********.******************

39. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

40. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

41. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

42. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

43. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ004855 (Listeria bacteriophage P100, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

44. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

45. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttatttagtttgtttatctatctaact	Protospacer
*****.************************

46. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

47. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ668717 (Listeria phage LMTA-34 hypothetical proteins, transposase domain-containing protein, and hypothetical proteins genes, complete cds) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttatttagtttgtttatctatctaact	Protospacer
*****.************************

48. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

49. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttatttagtttgtttatctatctaact	Protospacer
*****.************************

50. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

51. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttacctatctaact	Protospacer
*******************.**********

52. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttgtttagtttgtttatccatctaact	Protospacer
*********************.********

53. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 1, identity: 0.967

cctttgtttagtttgtttatctatctaact	CRISPR spacer
cctttatttagtttgtttatctatctaact	Protospacer
*****.************************

54. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.967

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
aacaagaaaaaagacccagacaatattgca	Protospacer
**************.***************

55. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.967

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
aacaagaaaaaagacccagacaatattgca	Protospacer
**************.***************

56. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.967

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
aacaagaaaaaagacccagacaatattgca	Protospacer
**************.***************

57. spacer 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

gctgttgcaacatgatcaaaaaaattattt	CRISPR spacer
gctgtcgcaacatgatcaaaaaaattattt	Protospacer
*****.************************

58. spacer 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967

taagcgtaatattaatgtcaaagcttctag	CRISPR spacer
taagggtaatattaatgtcaaagcttctag	Protospacer
**** *************************

59. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.967

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
gtgtttctttcccaccttccggttcaacgc	Protospacer
*******************.**********

60. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

61. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

62. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

63. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

64. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

65. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

66. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

67. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

68. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

69. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

70. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 1, identity: 0.967

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttggaggaactgaatttactggcacta	Protospacer
* ****************************

71. spacer 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.968

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
atccgtgaatgccgacaatcgttcatttcca	Protospacer
**.****************************

72. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

73. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

74. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta	Protospacer
**.***************************

75. spacer 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctagatctagg	Protospacer
***********************.******

76. spacer 1.29|7104|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967

tcgtccactctagtagcatctaggtctagg	CRISPR spacer
tcgtccactctagtagcatctagatctagg	Protospacer
***********************.******

77. spacer 1.33|7104|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.966

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctagatctag	Protospacer
***********************.*****

78. spacer 1.33|7104|29|NZ_JNGJ01000024|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.966

tcgtccactctagtagcatctaggtctag	CRISPR spacer
tcgtccactctagtagcatctagatctag	Protospacer
***********************.*****

79. spacer 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 2, identity: 0.933

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttgaagatattaactacattcagaca	Protospacer
******.*******.***************

80. spacer 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.933

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttgaagatattaactacattcagaca	Protospacer
******.*******.***************

81. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 2, identity: 0.933

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
aacaagaaaaaagatccagacaatgtcgca	Protospacer
************************.*.***

82. spacer 1.16|6245|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.933

aacacaccgagcaatagaaatacactgtta	CRISPR spacer
agcacaccgagcaatagaaatatactgtta	Protospacer
*.********************.*******

83. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 2, identity: 0.933

cctttggaggaactgaatttactggcacta	CRISPR spacer
catttgggggaactgaatttactggcacta	Protospacer
* *****.**********************

84. spacer 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.935

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
atccgtgaatgctgacaatcgttcatttcca	Protospacer
**.*********.******************

85. spacer 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to KJ094027 (Listeria phage LP-083-1 contig 1, partial genome) position: , mismatch: 3, identity: 0.9

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ctattgtcgtcgggtagttcacccatatct	Protospacer
.*.*****************.*********

86. spacer 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 3, identity: 0.9

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ctattgtcgtcgggtagttcacccatatct	Protospacer
.*.*****************.*********

87. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

88. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

89. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 5, identity: 0.833

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
ggtggagtaaatcaatataaagatagaata	Protospacer
****..******************. * **

90. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8

cctttgtttagtttgtttatctatctaact	CRISPR spacer
caattgtttagtttgtttatttatttaata	Protospacer
*  *****************.***.***. 

91. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 6, identity: 0.8

cctttgtttagtttgtttatctatctaact	CRISPR spacer
caattgtttagtttgtttatttatttaata	Protospacer
*  *****************.***.***. 

92. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8

cctttgtttagtttgtttatctatctaact	CRISPR spacer
caattgtttagtttgtttatttatttaata	Protospacer
*  *****************.***.***. 

93. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8

cctttgtttagtttgtttatctatctaact	CRISPR spacer
caattgtttagtttgtttatttatttaata	Protospacer
*  *****************.***.***. 

94. spacer 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_025830 (Escherichia phage Av-05, complete genome) position: , mismatch: 6, identity: 0.8

-gctgttgcaacatgatcaaaaaaattattt	CRISPR spacer
aattgat-caacatgattagaaaaattattt	Protospacer
 ..** * *********.*.***********

95. spacer 1.6|5584|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP044539 (Borrelia sp. CA690 plasmid cp26, complete sequence) position: , mismatch: 6, identity: 0.8

taagcgtaa--tattaatgtcaaagcttctag	CRISPR spacer
--agctacatttattaatgtcaatgcttctag	Protospacer
  ***   *  ************ ********

96. spacer 1.7|5650|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP024448 (Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence) position: , mismatch: 6, identity: 0.8

tgatggatgacatttctaagcaaataacta	CRISPR spacer
tgatgggtaacatttctaagcaaatacggg	Protospacer
******.*.*****************   .

97. spacer 1.10|5848|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806

ttcagactatgttttcaacaaagggatgcta	CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa	Protospacer
*** . ********** *****.****** *

98. spacer 1.12|5981|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 6, identity: 0.8

tcatagtctgttggaacatctgc---atgaact	CRISPR spacer
tcatagtctgttggaacatcttccaagtaa---	Protospacer
********************* *   .*.*   

99. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694096 (Marine virus AFVG_250M214, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

100. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694078 (Marine virus AFVG_250M213, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

101. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN693931 (Marine virus AFVG_250M215, complete genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta	Protospacer
*  .* * **** *****************

102. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_029057 (Vibrio phage qdvp001, partial genome) position: , mismatch: 6, identity: 0.8

ggtgaggtaaatcaatataaaga-tgcatta	CRISPR spacer
gcagatgtaaatcaatataaagattgtgtt-	Protospacer
*  ** ***************** **..** 

103. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_014660 (Acinetobacter phage Ac42, complete genome) position: , mismatch: 6, identity: 0.8

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcctagttaataattacaattgctgataa	Protospacer
 ** *  ******.** *************

104. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

105. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

106. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

107. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

108. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

109. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

110. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

111. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

112. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

113. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

114. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

115. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

116. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

117. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

118. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

119. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

120. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

121. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

122. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

123. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

124. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

125. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

126. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

127. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

128. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

129. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

130. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
aacttttttaattgtttcaattgctgttt	Protospacer
. * ******** ************* * 

131. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atcgtttttaatagattcaattgcttctt	Protospacer
.**.********** **********  * 

132. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

133. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

134. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

135. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

136. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gacatttttaatagtttctaatgcttctt	Protospacer
* **************** * ****  * 

137. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gctttgtttaatattatcaattgctgata	Protospacer
*.. * ******* * *************

138. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gctttgtttaatattatcaattgctgata	Protospacer
*.. * ******* * *************

139. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ctcatttttgatagtttcagttgcagctt	Protospacer
 ********.*********.**** * * 

140. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

141. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
gccattttcaatagcttcaattgctactg	Protospacer
*.******.*****.**********. *.

142. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

143. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
atctgttttaatagtttcatttgcttatt	Protospacer
.**  ************** ***** ** 

144. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 6, identity: 0.793

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcatttttaaatgtttcaattgcaccta	Protospacer
 **********  ***********   **

145. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccg	Protospacer
 *. .********.************ **

146. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg	Protospacer
*  ********* *********** *  *

147. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 6, identity: 0.793

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg	Protospacer
*  ********* *********** *  *

148. spacer 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 7, identity: 0.767

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttaaagatatgaacaacataccaatt	Protospacer
************** *** **** * .*. 

149. spacer 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 7, identity: 0.767

caagttaaagatatcaactacattcagaca	CRISPR spacer
caagttaaagatatgaacaacataccaatt	Protospacer
************** *** **** * .*. 

150. spacer 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN693453 (Marine virus AFVG_25M364, complete genome) position: , mismatch: 7, identity: 0.767

--gctgttgcaacatgatcaaaaaaattattt	CRISPR spacer
caaccat--caacatgctcaataaaattattt	Protospacer
  .*..*  ******* **** **********

151. spacer 1.13|6047|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134421 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12) position: , mismatch: 7, identity: 0.767

ttcccagccgtaatagatactaaattacca	CRISPR spacer
tcaattgccgaaatagttactaaattacca	Protospacer
*.  . **** ***** *************

152. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

153. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_017969 (Escherichia phage bV_EcoS_AKFV33, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

154. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

155. spacer 1.14|6113|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MN022787 (Salmonella virus VSe12, complete genome) position: , mismatch: 7, identity: 0.767

gtgtttctttcccaccttctggttcaacgc	CRISPR spacer
aagtagcttttccagcttctggttcaacga	Protospacer
. **  ****.*** ************** 

156. spacer 1.15|6179|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MT521992 (Rhodococcus phage NiceHouse, complete genome) position: , mismatch: 7, identity: 0.767

gctgcctcgctttactcttcgttatctcca	CRISPR spacer
aatacctctctttactcttctttatcttta	Protospacer
. *.**** *********** ******..*

157. spacer 1.18|6377|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767

gaaaaagttgtcgatcttacaaaaaaattc	CRISPR spacer
aaaaaagatgtcgatcttaccaaaatctct	Protospacer
.****** ************ ****  *..

158. spacer 1.24|6773|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 7, identity: 0.767

cctttggaggaactgaatttactggcacta	CRISPR spacer
tcgacgcaggaacagaatttgctggcacta	Protospacer
.*  .* ****** ******.*********

159. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.767

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
cgttaggtaaatcaatataaaggtttcgta	Protospacer
 ** ******************.* .  **

160. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

161. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

162. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

163. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

164. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

165. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

166. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

167. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

168. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

169. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

170. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

171. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

172. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

173. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
tttgggtttaataaattcaattgctgataa	Protospacer
 *..  *******. ***************

174. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

175. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

176. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

177. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

178. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

179. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

180. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

181. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

182. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

183. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

184. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

185. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

186. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

187. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
aacttttttaattgtttcaattgctgtttt	Protospacer
. * ******** ************* *  

188. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atcgtttttaatagattcaattgcttcttg	Protospacer
.**.********** **********  * .

189. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

190. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

191. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

192. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

193. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gacatttttaatagtttctaatgcttcttt	Protospacer
* **************** * ****  *  

194. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gctttgtttaatattatcaattgctgatag	Protospacer
*.. * ******* * *************.

195. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gctttgtttaatattatcaattgctgatag	Protospacer
*.. * ******* * *************.

196. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ctcatttttgatagtttcagttgcagcttt	Protospacer
 ********.*********.**** * *  

197. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

198. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
gccattttcaatagcttcaattgctactgt	Protospacer
*.******.*****.**********. *. 

199. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

200. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
atctgttttaatagtttcatttgcttattc	Protospacer
.**  ************** ***** **  

201. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 7, identity: 0.767

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcatttttaaatgtttcaattgcacctat	Protospacer
 **********  ***********   ** 

202. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccgc	Protospacer
 *. .********.************ ** 

203. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc	Protospacer
*  ********* *********** *  * 

204. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.767

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc	Protospacer
*  ********* *********** *  * 

205. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
ttcattgttaataatttcaattgctttat	Protospacer
 ***** ******.***********    

206. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
tttgggtttaataaattcaattgctgata	Protospacer
 *..  *******. **************

207. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 7, identity: 0.759

gtcatttttaatagtttcaattgctgata	CRISPR spacer
taaagtttttataatttcaattgctgatt	Protospacer
   * **** ***.************** 

208. spacer 1.35|7236|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 7, identity: 0.759

tcaaaagcgcgcatgaggaagaaatcacg	CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacg	Protospacer
.*.  .**** ********** *******

209. spacer 1.1|5254|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733

caagttaaagatatcaactacattcagaca	CRISPR spacer
aaagttaaaggtatcaactacaaggattta	Protospacer
 *********.***********   *  .*

210. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KF771238 (Escherichia phage bV_EcoS_AHS24, complete genome) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tgtttgttttgtttgtttatcgatctcgtc	Protospacer
. ******* *********** **** ...

211. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to KF771236 (Escherichia phage bV_EcoS_AHP24, complete genome) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tgtttgttttgtttgtttatcgatctcgtc	Protospacer
. ******* *********** **** ...

212. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP017832 (Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tttttgtttagtctgtttatccatccgttt	Protospacer
..**********.********.***.. .*

213. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN693012 (Marine virus AFVG_117M3, complete genome) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tctttgtttagttagtttatttattctttt	Protospacer
.************ ******.***..  .*

214. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_007581 (Clostridium phage c-st, complete genome) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tctttgtttaatttgtttatctgtaaatag	Protospacer
.*********.***********.*  *   

215. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to AP008983 (Clostridium phage c-st genomic DNA, complete genome) position: , mismatch: 8, identity: 0.733

cctttgtttagtttgtttatctatctaact	CRISPR spacer
tctttgtttaatttgtttatctgtaaatag	Protospacer
.*********.***********.*  *   

216. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT932211 (Escherichia phage VEcB, complete genome) position: , mismatch: 8, identity: 0.733

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
cagaagaaaaaagatcctgacaataagatc	Protospacer
 * ************** *******  .. 

217. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN850573 (Escherichia phage muut, complete genome) position: , mismatch: 8, identity: 0.733

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
cagaagaaaaaagatcctgacaataagatc	Protospacer
 * ************** *******  .. 

218. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN850601 (Escherichia phage inny, complete genome) position: , mismatch: 8, identity: 0.733

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
cagaagaaaaaagatcctgacaataagatc	Protospacer
 * ************** *******  .. 

219. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to FR775895 (Enterobacteria phage phi92, complete genome) position: , mismatch: 8, identity: 0.733

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
cagaagaaaaaagatcctgacaataagatc	Protospacer
 * ************** *******  .. 

220. spacer 1.4|5452|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN850632 (Escherichia phage alia, complete genome) position: , mismatch: 8, identity: 0.733

aacaagaaaaaagatccagacaatattgca	CRISPR spacer
cagaagaaaaaagatcctgacaataagatc	Protospacer
 * ************** *******  .. 

221. spacer 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to AP014255 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S25-C160, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

gctgttgcaacatgatcaaaaaaattattt	CRISPR spacer
agctcagcaacataatcaaaaaaataattt	Protospacer
. . . *******.*********** ****

222. spacer 1.5|5518|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MT349887 (Acinetobacter phage 5W, complete genome) position: , mismatch: 8, identity: 0.733

gctgttgcaacatgatcaaaaaaattattt	CRISPR spacer
gctgttgcaacccgatcaaaaaatcggatg	Protospacer
*********** .********** . . * 

223. spacer 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013462 (Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence) position: , mismatch: 8, identity: 0.733

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
gtcgcgtccaacgatttaaacgcatttacc	Protospacer
*.  . .*** ****************** 

224. spacer 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg	Protospacer
..*********** .**********  *. 

225. spacer 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg	Protospacer
..*********** .**********  *. 

226. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.733

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
aaacatataaatcaatataatgttgcatta	Protospacer
..  * .************* * *******

227. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 8, identity: 0.733

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
tccaaagttaatcaatataaagatgcaatg	Protospacer
  ..*.** ****************** *.

228. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
ttcattgttaataatttcaattgctttatg	Protospacer
 ***** ******.***********    .

229. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

230. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

231. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

232. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

233. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

234. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

235. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

236. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
actatttttaatagttgcaattgccataaa	Protospacer
...************* *******..  **

237. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 8, identity: 0.733

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
taaagtttttataatttcaattgctgattt	Protospacer
   * **** ***.**************  

238. spacer 1.31|7236|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 8, identity: 0.733

tcaaaagcgcgcatgaggaagaaatcacga	CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacgg	Protospacer
.*.  .**** ********** *******.

239. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

240. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

241. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

242. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

243. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

244. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

245. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

246. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

247. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
actatttttaatagttgcaattgccataa	Protospacer
...************* *******..  *

248. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

249. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

250. spacer 1.34|7170|29|NZ_JNGJ01000024|PILER-CR matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 8, identity: 0.724

gtcatttttaatagtttcaattgctgata	CRISPR spacer
agcatttttaatagcttctattgctctat	Protospacer
. ************.*** ******    

251. spacer 1.3|5386|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MN694632 (Marine virus AFVG_250M389, complete genome) position: , mismatch: 9, identity: 0.7

cctttgtttagtttgtttatctatctaact	CRISPR spacer
agtttctttagtttgtttatctaatgcaaa	Protospacer
  *** ***************** .  *  

252. spacer 1.23|6707|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to MW057858 (Providencia phage PSTCR6, complete genome) position: , mismatch: 9, identity: 0.7

gcgcttcccatcgatttaaacgcatttaca	CRISPR spacer
aaatgtcccatcgatttaaacgcaattctc	Protospacer
. .. ******************* ** . 

253. spacer 1.26|6905|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgtcgtcgggtagttcgcccatatct	CRISPR spacer
ggcaggctgtcgggcagttcgcccatatcc	Protospacer
     *..******.**************.

254. spacer 1.27|6971|31|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 9, identity: 0.71

attcgtgaatgccgacaatcgttcatttcca	CRISPR spacer
aagcgtgaatgccgacaatagtccatcattt	Protospacer
*  **************** **.***. .. 

255. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

256. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

257. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

258. spacer 1.30|7170|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 9, identity: 0.7

gtcatttttaatagtttcaattgctgataa	CRISPR spacer
agcatttttaatagcttctattgctctatc	Protospacer
. ************.*** ******     

259. spacer 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

260. spacer 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

261. spacer 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

262. spacer 1.19|6443|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 10, identity: 0.667

accaacggcgcgcaaaagaaaatcattaaa	CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc	Protospacer
.**** ****************     .. 

263. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

264. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

265. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

266. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

267. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

268. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

269. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

270. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

271. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

272. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

273. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

274. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

275. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

276. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

277. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

278. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

279. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

280. spacer 1.28|7038|30|NZ_JNGJ01000024|CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

ggtgaggtaaatcaatataaagatgcatta	CRISPR spacer
caaagaaaaaatctatataaagatgcattc	Protospacer
 . .... ***** *************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 163556 : 173588 6 Tupanvirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_JNGJ01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 152442 : 159865 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 246544 : 309789 74 Listeria_phage(89.47%) tail,tRNA,capsid,integrase,portal,terminase,holin,protease attL 253820:253836|attR 291101:291117
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JNGJ01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 75008 : 82852 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JNGJ01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 114101 : 124828 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JNGJ01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGJ01000006_1 244348-244956 Orphan I-A
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JNGJ01000006_1 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244764-244798 35 NZ_JNGJ01000012.1 2911-2945 1 0.971
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 NZ_JNGJ01000011.1 293980-294015 0 1.0

1. spacer 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to position: 2911-2945, mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

2. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to position: 293980-294015, mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_JNGJ01000006_1 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244893-244927 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_JNGJ01000006_1 1.3|244507|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244507-244541 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_JNGJ01000006_1 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244764-244798 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_JNGJ01000006_1 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244764-244798 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_JNGJ01000006_1 1.3|244507|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244507-244541 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_JNGJ01000006_1 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244764-244798 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_JNGJ01000006_1 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244828-244863 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_JNGJ01000006_1 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244893-244927 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_JNGJ01000006_1 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244893-244927 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_JNGJ01000006_1 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244893-244927 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_JNGJ01000006_1 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT 244893-244927 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

2. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

3. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

4. spacer 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

5. spacer 1.3|244507|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

6. spacer 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

7. spacer 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

8. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

9. spacer 1.3|244507|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

10. spacer 1.7|244764|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

11. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

12. spacer 1.8|244828|36|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

13. spacer 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

14. spacer 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

15. spacer 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

16. spacer 1.9|244893|35|NZ_JNGJ01000006|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_JNGJ01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGJ01000027.1|WP_003731276.1|739_991_+|hypothetical-protein 739_991_+ 83 aa aa AcrIIA12 NA NA No NA
7. NZ_JNGJ01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88112 : 96398 8 Prochlorococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JNGJ01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JNGJ01000003_1 37011-37162 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_JNGJ01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 255 : 9088 13 Listeria_phage(70.0%) NA NA
DBSCAN-SWA_2 22438 : 81879 58 Bacillus_virus(15.79%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_JNGJ01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 35241 52 Listeria_phage(93.62%) tail,terminase,holin,integrase,capsid attL 10437:10449|attR 35258:35270
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JNGJ01000028.1|WP_015987418.1|30927_31164_-|hypothetical-protein 30927_31164_- 78 aa aa NA HTH_XRE NA 0-35241 yes
NZ_JNGJ01000028.1|WP_003733687.1|31175_31370_-|hypothetical-protein 31175_31370_- 64 aa aa NA HTH_XRE NA 0-35241 yes