Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNVT01000021 Xanthomonas translucens strain XT5523 flattened_line_39, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVT01000059 Xanthomonas translucens strain XT5523 flattened_line_115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000098 Xanthomonas translucens strain XT5523 flattened_line_193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000057 Xanthomonas translucens strain XT5523 flattened_line_111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000007 Xanthomonas translucens strain XT5523 flattened_line_11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000065 Xanthomonas translucens strain XT5523 flattened_line_127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000050 Xanthomonas translucens strain XT5523 flattened_line_97, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000019 Xanthomonas translucens strain XT5523 flattened_line_35, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000117 Xanthomonas translucens strain XT5523 flattened_line_231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000115 Xanthomonas translucens strain XT5523 flattened_line_227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000029 Xanthomonas translucens strain XT5523 flattened_line_55, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000079 Xanthomonas translucens strain XT5523 flattened_line_157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000072 Xanthomonas translucens strain XT5523 flattened_line_143, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000006 Xanthomonas translucens strain XT5523 flattened_line_9, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_LNVT01000042 Xanthomonas translucens strain XT5523 flattened_line_81, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000022 Xanthomonas translucens strain XT5523 flattened_line_41, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000064 Xanthomonas translucens strain XT5523 flattened_line_125, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000101 Xanthomonas translucens strain XT5523 flattened_line_199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000002 Xanthomonas translucens strain XT5523 flattened_line_2, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNVT01000012 Xanthomonas translucens strain XT5523 flattened_line_21, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 2
NZ_LNVT01000091 Xanthomonas translucens strain XT5523 flattened_line_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000048 Xanthomonas translucens strain XT5523 flattened_line_93, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000108 Xanthomonas translucens strain XT5523 flattened_line_213, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000009 Xanthomonas translucens strain XT5523 flattened_line_15, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000051 Xanthomonas translucens strain XT5523 flattened_line_99, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000080 Xanthomonas translucens strain XT5523 flattened_line_159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000045 Xanthomonas translucens strain XT5523 flattened_line_87, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000089 Xanthomonas translucens strain XT5523 flattened_line_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000076 Xanthomonas translucens strain XT5523 flattened_line_151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000044 Xanthomonas translucens strain XT5523 flattened_line_85, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000109 Xanthomonas translucens strain XT5523 flattened_line_215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000052 Xanthomonas translucens strain XT5523 flattened_line_101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000036 Xanthomonas translucens strain XT5523 flattened_line_69, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000077 Xanthomonas translucens strain XT5523 flattened_line_153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000023 Xanthomonas translucens strain XT5523 flattened_line_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000066 Xanthomonas translucens strain XT5523 flattened_line_129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000034 Xanthomonas translucens strain XT5523 flattened_line_65, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000047 Xanthomonas translucens strain XT5523 flattened_line_91, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000026 Xanthomonas translucens strain XT5523 flattened_line_49, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVT01000038 Xanthomonas translucens strain XT5523 flattened_line_73, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000049 Xanthomonas translucens strain XT5523 flattened_line_95, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNVT01000103 Xanthomonas translucens strain XT5523 flattened_line_203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000067 Xanthomonas translucens strain XT5523 flattened_line_131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000107 Xanthomonas translucens strain XT5523 flattened_line_211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000105 Xanthomonas translucens strain XT5523 flattened_line_207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000095 Xanthomonas translucens strain XT5523 flattened_line_187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000104 Xanthomonas translucens strain XT5523 flattened_line_205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000028 Xanthomonas translucens strain XT5523 flattened_line_53, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000099 Xanthomonas translucens strain XT5523 flattened_line_195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000056 Xanthomonas translucens strain XT5523 flattened_line_109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000097 Xanthomonas translucens strain XT5523 flattened_line_191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000030 Xanthomonas translucens strain XT5523 flattened_line_57, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000110 Xanthomonas translucens strain XT5523 flattened_line_217, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000032 Xanthomonas translucens strain XT5523 flattened_line_61, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000040 Xanthomonas translucens strain XT5523 flattened_line_77, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVT01000003 Xanthomonas translucens strain XT5523 flattened_line_4, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVT01000039 Xanthomonas translucens strain XT5523 flattened_line_75, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000011 Xanthomonas translucens strain XT5523 flattened_line_19, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 9 46 0 0
NZ_LNVT01000075 Xanthomonas translucens strain XT5523 flattened_line_149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000055 Xanthomonas translucens strain XT5523 flattened_line_107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000069 Xanthomonas translucens strain XT5523 flattened_line_135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000001 Xanthomonas translucens strain XT5523 flattened_line_0, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000037 Xanthomonas translucens strain XT5523 flattened_line_71, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000111 Xanthomonas translucens strain XT5523 flattened_line_219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000112 Xanthomonas translucens strain XT5523 flattened_line_221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000094 Xanthomonas translucens strain XT5523 flattened_line_185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000004 Xanthomonas translucens strain XT5523 flattened_line_5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000015 Xanthomonas translucens strain XT5523 flattened_line_27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000093 Xanthomonas translucens strain XT5523 flattened_line_183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000014 Xanthomonas translucens strain XT5523 flattened_line_25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000114 Xanthomonas translucens strain XT5523 flattened_line_225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000060 Xanthomonas translucens strain XT5523 flattened_line_117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000087 Xanthomonas translucens strain XT5523 flattened_line_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000033 Xanthomonas translucens strain XT5523 flattened_line_63, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000078 Xanthomonas translucens strain XT5523 flattened_line_155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000082 Xanthomonas translucens strain XT5523 flattened_line_163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000113 Xanthomonas translucens strain XT5523 flattened_line_223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000035 Xanthomonas translucens strain XT5523 flattened_line_67, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVT01000027 Xanthomonas translucens strain XT5523 flattened_line_51, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000086 Xanthomonas translucens strain XT5523 flattened_line_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000062 Xanthomonas translucens strain XT5523 flattened_line_121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000025 Xanthomonas translucens strain XT5523 flattened_line_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000018 Xanthomonas translucens strain XT5523 flattened_line_33, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000074 Xanthomonas translucens strain XT5523 flattened_line_147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000031 Xanthomonas translucens strain XT5523 flattened_line_59, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000010 Xanthomonas translucens strain XT5523 flattened_line_17, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000092 Xanthomonas translucens strain XT5523 flattened_line_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000106 Xanthomonas translucens strain XT5523 flattened_line_209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000053 Xanthomonas translucens strain XT5523 flattened_line_103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000063 Xanthomonas translucens strain XT5523 flattened_line_123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000084 Xanthomonas translucens strain XT5523 flattened_line_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000085 Xanthomonas translucens strain XT5523 flattened_line_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000083 Xanthomonas translucens strain XT5523 flattened_line_165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000024 Xanthomonas translucens strain XT5523 flattened_line_45, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000068 Xanthomonas translucens strain XT5523 flattened_line_133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000102 Xanthomonas translucens strain XT5523 flattened_line_201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000088 Xanthomonas translucens strain XT5523 flattened_line_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000058 Xanthomonas translucens strain XT5523 flattened_line_113, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVT01000046 Xanthomonas translucens strain XT5523 flattened_line_89, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000017 Xanthomonas translucens strain XT5523 flattened_line_31, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000071 Xanthomonas translucens strain XT5523 flattened_line_141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000043 Xanthomonas translucens strain XT5523 flattened_line_83, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000081 Xanthomonas translucens strain XT5523 flattened_line_161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000116 Xanthomonas translucens strain XT5523 flattened_line_229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000020 Xanthomonas translucens strain XT5523 flattened_line_37, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVT01000070 Xanthomonas translucens strain XT5523 flattened_line_137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000073 Xanthomonas translucens strain XT5523 flattened_line_145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000041 Xanthomonas translucens strain XT5523 flattened_line_79, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000100 Xanthomonas translucens strain XT5523 flattened_line_197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000090 Xanthomonas translucens strain XT5523 flattened_line_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000008 Xanthomonas translucens strain XT5523 flattened_line_13, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVT01000061 Xanthomonas translucens strain XT5523 flattened_line_119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000013 Xanthomonas translucens strain XT5523 flattened_line_23, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_LNVT01000005 Xanthomonas translucens strain XT5523 flattened_line_7, whole genome shotgun sequence 0 crisprs Cas9_archaeal,cas3,csa3 0 0 0 0
NZ_LNVT01000096 Xanthomonas translucens strain XT5523 flattened_line_189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000054 Xanthomonas translucens strain XT5523 flattened_line_105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVT01000016 Xanthomonas translucens strain XT5523 flattened_line_29, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_LNVT01000040
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVT01000040_1 2588-2690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNVT01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVT01000006_1 174919-175030 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 97884 : 104229 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LNVT01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 64685 : 117190 44 Staphylococcus_phage(28.57%) plate,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LNVT01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31864 : 62226 40 Siphoviridae_environmental_samples(34.78%) integrase,terminase,tail attL 30300:30319|attR 56135:56154
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNVT01000012.1|WP_058195519.1|33431_33716_+|hypothetical-protein 33431_33716_+ 94 aa aa AcrIC10 NA NA 31864-62226 yes
NZ_LNVT01000012.1|WP_058195493.1|60000_60513_-|hypothetical-protein 60000_60513_- 170 aa aa NA NA NA 31864-62226 yes
5. NZ_LNVT01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVT01000008_1 75569-75712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LNVT01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVT01000011_1 53197-57508 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVT01000011_1 1.1|53228|35|NZ_LNVT01000011|CRISPRCasFinder,CRT 53228-53262 35 NZ_LNVT01000012.1 40104-40138 1 0.971
NZ_LNVT01000011_1 1.2|53294|33|NZ_LNVT01000011|CRISPRCasFinder,CRT 53294-53326 33 NZ_LNVT01000012.1 44931-44963 0 1.0
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_LNVT01000012.1 64689-64722 0 1.0
NZ_LNVT01000011_1 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54410-54443 34 NZ_LNVT01000012.1 61232-61265 0 1.0
NZ_LNVT01000011_1 1.21|54541|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54541-54575 35 NZ_LNVT01000012.1 58914-58948 0 1.0
NZ_LNVT01000011_1 1.66|53295|33|NZ_LNVT01000011|PILER-CR 53295-53327 33 NZ_LNVT01000012.1 44931-44963 0 1.0
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_LNVT01000012.1 64689-64722 0 1.0
NZ_LNVT01000011_1 1.83|54427|34|NZ_LNVT01000011|PILER-CR 54427-54460 34 NZ_LNVT01000012.1 61232-61265 0 1.0
NZ_LNVT01000011_1 1.85|54560|35|NZ_LNVT01000011|PILER-CR 54560-54594 35 NZ_LNVT01000012.1 58914-58948 0 1.0

1. spacer 1.1|53228|35|NZ_LNVT01000011|CRISPRCasFinder,CRT matches to position: 40104-40138, mismatch: 1, identity: 0.971

gatgtcgagtggcgccgggacgacatggcatgggt	CRISPR spacer
gatgtcgagtggcgccgggacgacatggcttgggt	Protospacer
***************************** *****

2. spacer 1.2|53294|33|NZ_LNVT01000011|CRISPRCasFinder,CRT matches to position: 44931-44963, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

3. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to position: 64689-64722, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

4. spacer 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to position: 61232-61265, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

5. spacer 1.21|54541|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to position: 58914-58948, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

6. spacer 1.66|53295|33|NZ_LNVT01000011|PILER-CR matches to position: 44931-44963, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

7. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to position: 64689-64722, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

8. spacer 1.83|54427|34|NZ_LNVT01000011|PILER-CR matches to position: 61232-61265, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

9. spacer 1.85|54560|35|NZ_LNVT01000011|PILER-CR matches to position: 58914-58948, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVT01000011_1 1.36|55535|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55535-55568 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVT01000011_1 1.36|55535|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55535-55568 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVT01000011_1 1.100|55569|34|NZ_LNVT01000011|PILER-CR 55569-55602 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVT01000011_1 1.100|55569|34|NZ_LNVT01000011|PILER-CR 55569-55602 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVT01000011_1 1.49|56389|36|NZ_LNVT01000011|CRT,CRISPRCasFinder 56389-56424 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVT01000011_1 1.49|56389|36|NZ_LNVT01000011|CRT,CRISPRCasFinder 56389-56424 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVT01000011_1 1.113|56436|36|NZ_LNVT01000011|PILER-CR 56436-56471 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVT01000011_1 1.113|56436|36|NZ_LNVT01000011|PILER-CR 56436-56471 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVT01000011_1 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55995-56028 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVT01000011_1 1.107|56036|34|NZ_LNVT01000011|PILER-CR 56036-56069 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVT01000011_1 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55995-56028 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVT01000011_1 1.107|56036|34|NZ_LNVT01000011|PILER-CR 56036-56069 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVT01000011_1 1.9|53756|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 53756-53790 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVT01000011_1 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55995-56028 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVT01000011_1 1.73|53763|35|NZ_LNVT01000011|PILER-CR 53763-53797 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVT01000011_1 1.107|56036|34|NZ_LNVT01000011|PILER-CR 56036-56069 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVT01000011_1 1.20|54475|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54475-54509 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVT01000011_1 1.84|54493|35|NZ_LNVT01000011|PILER-CR 54493-54527 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVT01000011_1 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 53888-53921 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVT01000011_1 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 53888-53921 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVT01000011_1 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 53888-53921 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVT01000011_1 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 53888-53921 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVT01000011_1 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54808-54842 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVT01000011_1 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54808-54842 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVT01000011_1 1.75|53897|34|NZ_LNVT01000011|PILER-CR 53897-53930 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVT01000011_1 1.75|53897|34|NZ_LNVT01000011|PILER-CR 53897-53930 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVT01000011_1 1.75|53897|34|NZ_LNVT01000011|PILER-CR 53897-53930 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVT01000011_1 1.75|53897|34|NZ_LNVT01000011|PILER-CR 53897-53930 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVT01000011_1 1.89|54831|35|NZ_LNVT01000011|PILER-CR 54831-54865 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVT01000011_1 1.89|54831|35|NZ_LNVT01000011|PILER-CR 54831-54865 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVT01000011_1 1.18|54343|36|NZ_LNVT01000011|CRT,CRISPRCasFinder 54343-54378 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVT01000011_1 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54410-54443 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVT01000011_1 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54410-54443 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVT01000011_1 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54410-54443 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVT01000011_1 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54607-54641 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVT01000011_1 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54941-54975 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVT01000011_1 1.39|55732|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 55732-55766 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVT01000011_1 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56127-56160 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVT01000011_1 1.82|54359|36|NZ_LNVT01000011|PILER-CR 54359-54394 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVT01000011_1 1.83|54427|34|NZ_LNVT01000011|PILER-CR 54427-54460 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVT01000011_1 1.83|54427|34|NZ_LNVT01000011|PILER-CR 54427-54460 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVT01000011_1 1.83|54427|34|NZ_LNVT01000011|PILER-CR 54427-54460 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVT01000011_1 1.86|54627|35|NZ_LNVT01000011|PILER-CR 54627-54661 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVT01000011_1 1.91|54966|35|NZ_LNVT01000011|PILER-CR 54966-55000 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVT01000011_1 1.103|55769|35|NZ_LNVT01000011|PILER-CR 55769-55803 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVT01000011_1 1.109|56170|34|NZ_LNVT01000011|PILER-CR 56170-56203 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVT01000011_1 1.16|54215|33|NZ_LNVT01000011|CRT,CRISPRCasFinder 54215-54247 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVT01000011_1 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54410-54443 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVT01000011_1 1.21|54541|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54541-54575 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVT01000011_1 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54607-54641 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVT01000011_1 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56127-56160 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVT01000011_1 1.47|56257|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56257-56290 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVT01000011_1 1.47|56257|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56257-56290 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVT01000011_1 1.57|56922|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56922-56955 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVT01000011_1 1.80|54229|33|NZ_LNVT01000011|PILER-CR 54229-54261 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVT01000011_1 1.83|54427|34|NZ_LNVT01000011|PILER-CR 54427-54460 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVT01000011_1 1.85|54560|35|NZ_LNVT01000011|PILER-CR 54560-54594 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVT01000011_1 1.86|54627|35|NZ_LNVT01000011|PILER-CR 54627-54661 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVT01000011_1 1.109|56170|34|NZ_LNVT01000011|PILER-CR 56170-56203 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVT01000011_1 1.111|56302|34|NZ_LNVT01000011|PILER-CR 56302-56335 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVT01000011_1 1.111|56302|34|NZ_LNVT01000011|PILER-CR 56302-56335 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVT01000011_1 1.121|56977|34|NZ_LNVT01000011|PILER-CR 56977-57010 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVT01000011_1 1.18|54343|36|NZ_LNVT01000011|CRT,CRISPRCasFinder 54343-54378 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVT01000011_1 1.24|54740|37|NZ_LNVT01000011|CRT,CRISPRCasFinder 54740-54776 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVT01000011_1 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54808-54842 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVT01000011_1 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55600-55633 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVT01000011_1 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55600-55633 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVT01000011_1 1.52|56590|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 56590-56624 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVT01000011_1 1.52|56590|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 56590-56624 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVT01000011_1 1.57|56922|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56922-56955 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVT01000011_1 1.82|54359|36|NZ_LNVT01000011|PILER-CR 54359-54394 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVT01000011_1 1.88|54762|37|NZ_LNVT01000011|PILER-CR 54762-54798 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVT01000011_1 1.89|54831|35|NZ_LNVT01000011|PILER-CR 54831-54865 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVT01000011_1 1.101|55635|34|NZ_LNVT01000011|PILER-CR 55635-55668 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVT01000011_1 1.101|55635|34|NZ_LNVT01000011|PILER-CR 55635-55668 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVT01000011_1 1.116|56640|35|NZ_LNVT01000011|PILER-CR 56640-56674 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVT01000011_1 1.116|56640|35|NZ_LNVT01000011|PILER-CR 56640-56674 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVT01000011_1 1.121|56977|34|NZ_LNVT01000011|PILER-CR 56977-57010 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVT01000011_1 1.6|53557|34|NZ_LNVT01000011|CRT 53557-53590 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVT01000011_1 1.14|54084|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 54084-54117 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVT01000011_1 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder 54607-54641 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVT01000011_1 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55600-55633 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVT01000011_1 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 55600-55633 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVT01000011_1 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56127-56160 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVT01000011_1 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 56127-56160 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVT01000011_1 1.59|57052|34|NZ_LNVT01000011|CRT,CRISPRCasFinder 57052-57085 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNVT01000011_1 1.70|53562|34|NZ_LNVT01000011|PILER-CR 53562-53595 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVT01000011_1 1.78|54096|34|NZ_LNVT01000011|PILER-CR 54096-54129 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVT01000011_1 1.86|54627|35|NZ_LNVT01000011|PILER-CR 54627-54661 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVT01000011_1 1.101|55635|34|NZ_LNVT01000011|PILER-CR 55635-55668 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVT01000011_1 1.101|55635|34|NZ_LNVT01000011|PILER-CR 55635-55668 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVT01000011_1 1.109|56170|34|NZ_LNVT01000011|PILER-CR 56170-56203 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVT01000011_1 1.109|56170|34|NZ_LNVT01000011|PILER-CR 56170-56203 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVT01000011_1 1.123|57109|34|NZ_LNVT01000011|PILER-CR 57109-57142 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676

1. spacer 1.36|55535|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

2. spacer 1.36|55535|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

3. spacer 1.100|55569|34|NZ_LNVT01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

4. spacer 1.100|55569|34|NZ_LNVT01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

5. spacer 1.49|56389|36|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

6. spacer 1.49|56389|36|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

7. spacer 1.113|56436|36|NZ_LNVT01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

8. spacer 1.113|56436|36|NZ_LNVT01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

9. spacer 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

10. spacer 1.107|56036|34|NZ_LNVT01000011|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

11. spacer 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

12. spacer 1.107|56036|34|NZ_LNVT01000011|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

13. spacer 1.9|53756|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

14. spacer 1.43|55995|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

15. spacer 1.73|53763|35|NZ_LNVT01000011|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

16. spacer 1.107|56036|34|NZ_LNVT01000011|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

17. spacer 1.20|54475|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

18. spacer 1.84|54493|35|NZ_LNVT01000011|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

19. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

20. spacer 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

21. spacer 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

22. spacer 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

23. spacer 1.11|53888|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

24. spacer 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

25. spacer 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

26. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

27. spacer 1.75|53897|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

28. spacer 1.75|53897|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

29. spacer 1.75|53897|34|NZ_LNVT01000011|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

30. spacer 1.75|53897|34|NZ_LNVT01000011|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

31. spacer 1.89|54831|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

32. spacer 1.89|54831|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

33. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

34. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

35. spacer 1.18|54343|36|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

36. spacer 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

37. spacer 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

38. spacer 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

39. spacer 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

40. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

41. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

42. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

43. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

44. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

45. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

46. spacer 1.27|54941|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

47. spacer 1.39|55732|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

48. spacer 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

49. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

50. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

51. spacer 1.82|54359|36|NZ_LNVT01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

52. spacer 1.83|54427|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

53. spacer 1.83|54427|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

54. spacer 1.83|54427|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

55. spacer 1.86|54627|35|NZ_LNVT01000011|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

56. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

57. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

58. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

59. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

60. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

61. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

62. spacer 1.91|54966|35|NZ_LNVT01000011|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

63. spacer 1.103|55769|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

64. spacer 1.109|56170|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

65. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

66. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

67. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

68. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

69. spacer 1.16|54215|33|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

70. spacer 1.19|54410|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

71. spacer 1.21|54541|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

72. spacer 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

73. spacer 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

74. spacer 1.47|56257|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

75. spacer 1.47|56257|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

76. spacer 1.57|56922|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

77. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

78. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

79. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

80. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

81. spacer 1.80|54229|33|NZ_LNVT01000011|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

82. spacer 1.83|54427|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

83. spacer 1.85|54560|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

84. spacer 1.86|54627|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

85. spacer 1.109|56170|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

86. spacer 1.111|56302|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

87. spacer 1.111|56302|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

88. spacer 1.121|56977|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

89. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

90. spacer 1.18|54343|36|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

91. spacer 1.24|54740|37|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

92. spacer 1.25|54808|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

93. spacer 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

94. spacer 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

95. spacer 1.52|56590|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

96. spacer 1.52|56590|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

97. spacer 1.57|56922|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

98. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

99. spacer 1.82|54359|36|NZ_LNVT01000011|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

100. spacer 1.88|54762|37|NZ_LNVT01000011|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

101. spacer 1.89|54831|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

102. spacer 1.101|55635|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

103. spacer 1.101|55635|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

104. spacer 1.116|56640|35|NZ_LNVT01000011|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

105. spacer 1.116|56640|35|NZ_LNVT01000011|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

106. spacer 1.121|56977|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

107. spacer 1.6|53557|34|NZ_LNVT01000011|CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

108. spacer 1.14|54084|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

109. spacer 1.22|54607|35|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

110. spacer 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

111. spacer 1.37|55600|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

112. spacer 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

113. spacer 1.45|56127|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

114. spacer 1.59|57052|34|NZ_LNVT01000011|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

115. spacer 1.70|53562|34|NZ_LNVT01000011|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

116. spacer 1.78|54096|34|NZ_LNVT01000011|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

117. spacer 1.86|54627|35|NZ_LNVT01000011|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

118. spacer 1.101|55635|34|NZ_LNVT01000011|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

119. spacer 1.101|55635|34|NZ_LNVT01000011|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

120. spacer 1.109|56170|34|NZ_LNVT01000011|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

121. spacer 1.109|56170|34|NZ_LNVT01000011|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

122. spacer 1.123|57109|34|NZ_LNVT01000011|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage