Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNST01000599 Xanthomonas translucens strain XT-Rocky flattened_line_1197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000134 Xanthomonas translucens strain XT-Rocky flattened_line_266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000143 Xanthomonas translucens strain XT-Rocky flattened_line_284, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNST01000272 Xanthomonas translucens strain XT-Rocky flattened_line_544, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000530 Xanthomonas translucens strain XT-Rocky flattened_line_1060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000006 Xanthomonas translucens strain XT-Rocky flattened_line_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000596 Xanthomonas translucens strain XT-Rocky flattened_line_1191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000256 Xanthomonas translucens strain XT-Rocky flattened_line_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000369 Xanthomonas translucens strain XT-Rocky flattened_line_738, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000028 Xanthomonas translucens strain XT-Rocky flattened_line_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000261 Xanthomonas translucens strain XT-Rocky flattened_line_520, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000012 Xanthomonas translucens strain XT-Rocky flattened_line_22, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNST01000625 Xanthomonas translucens strain XT-Rocky flattened_line_1248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000619 Xanthomonas translucens strain XT-Rocky flattened_line_1236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000280 Xanthomonas translucens strain XT-Rocky flattened_line_560, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000380 Xanthomonas translucens strain XT-Rocky flattened_line_760, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000117 Xanthomonas translucens strain XT-Rocky flattened_line_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000375 Xanthomonas translucens strain XT-Rocky flattened_line_750, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000158 Xanthomonas translucens strain XT-Rocky flattened_line_314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000004 Xanthomonas translucens strain XT-Rocky flattened_line_6, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_LNST01000016 Xanthomonas translucens strain XT-Rocky flattened_line_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000452 Xanthomonas translucens strain XT-Rocky flattened_line_904, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000472 Xanthomonas translucens strain XT-Rocky flattened_line_944, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000579 Xanthomonas translucens strain XT-Rocky flattened_line_1157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000493 Xanthomonas translucens strain XT-Rocky flattened_line_986, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000347 Xanthomonas translucens strain XT-Rocky flattened_line_694, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000439 Xanthomonas translucens strain XT-Rocky flattened_line_878, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000527 Xanthomonas translucens strain XT-Rocky flattened_line_1054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000433 Xanthomonas translucens strain XT-Rocky flattened_line_866, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000121 Xanthomonas translucens strain XT-Rocky flattened_line_240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000264 Xanthomonas translucens strain XT-Rocky flattened_line_526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000446 Xanthomonas translucens strain XT-Rocky flattened_line_892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000126 Xanthomonas translucens strain XT-Rocky flattened_line_250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000263 Xanthomonas translucens strain XT-Rocky flattened_line_524, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000495 Xanthomonas translucens strain XT-Rocky flattened_line_990, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000471 Xanthomonas translucens strain XT-Rocky flattened_line_942, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000408 Xanthomonas translucens strain XT-Rocky flattened_line_816, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000061 Xanthomonas translucens strain XT-Rocky flattened_line_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000560 Xanthomonas translucens strain XT-Rocky flattened_line_1120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000480 Xanthomonas translucens strain XT-Rocky flattened_line_960, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000245 Xanthomonas translucens strain XT-Rocky flattened_line_488, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000235 Xanthomonas translucens strain XT-Rocky flattened_line_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000459 Xanthomonas translucens strain XT-Rocky flattened_line_918, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000431 Xanthomonas translucens strain XT-Rocky flattened_line_862, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000469 Xanthomonas translucens strain XT-Rocky flattened_line_938, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000411 Xanthomonas translucens strain XT-Rocky flattened_line_822, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000055 Xanthomonas translucens strain XT-Rocky flattened_line_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000428 Xanthomonas translucens strain XT-Rocky flattened_line_856, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000624 Xanthomonas translucens strain XT-Rocky flattened_line_1246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000473 Xanthomonas translucens strain XT-Rocky flattened_line_946, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000559 Xanthomonas translucens strain XT-Rocky flattened_line_1118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000572 Xanthomonas translucens strain XT-Rocky flattened_line_1144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000317 Xanthomonas translucens strain XT-Rocky flattened_line_634, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000595 Xanthomonas translucens strain XT-Rocky flattened_line_1189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000221 Xanthomonas translucens strain XT-Rocky flattened_line_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000349 Xanthomonas translucens strain XT-Rocky flattened_line_698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000337 Xanthomonas translucens strain XT-Rocky flattened_line_674, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNST01000242 Xanthomonas translucens strain XT-Rocky flattened_line_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000327 Xanthomonas translucens strain XT-Rocky flattened_line_654, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000629 Xanthomonas translucens strain XT-Rocky flattened_line_1256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000600 Xanthomonas translucens strain XT-Rocky flattened_line_1199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000409 Xanthomonas translucens strain XT-Rocky flattened_line_818, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000388 Xanthomonas translucens strain XT-Rocky flattened_line_776, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000002 Xanthomonas translucens strain XT-Rocky flattened_line_2, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNST01000571 Xanthomonas translucens strain XT-Rocky flattened_line_1142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000056 Xanthomonas translucens strain XT-Rocky flattened_line_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000301 Xanthomonas translucens strain XT-Rocky flattened_line_602, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000090 Xanthomonas translucens strain XT-Rocky flattened_line_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000391 Xanthomonas translucens strain XT-Rocky flattened_line_782, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000419 Xanthomonas translucens strain XT-Rocky flattened_line_838, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000420 Xanthomonas translucens strain XT-Rocky flattened_line_840, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000564 Xanthomonas translucens strain XT-Rocky flattened_line_1128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000286 Xanthomonas translucens strain XT-Rocky flattened_line_572, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000155 Xanthomonas translucens strain XT-Rocky flattened_line_308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000164 Xanthomonas translucens strain XT-Rocky flattened_line_326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000453 Xanthomonas translucens strain XT-Rocky flattened_line_906, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000118 Xanthomonas translucens strain XT-Rocky flattened_line_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000114 Xanthomonas translucens strain XT-Rocky flattened_line_226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000355 Xanthomonas translucens strain XT-Rocky flattened_line_710, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000451 Xanthomonas translucens strain XT-Rocky flattened_line_902, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000211 Xanthomonas translucens strain XT-Rocky flattened_line_420, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000022 Xanthomonas translucens strain XT-Rocky flattened_line_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000466 Xanthomonas translucens strain XT-Rocky flattened_line_932, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000590 Xanthomonas translucens strain XT-Rocky flattened_line_1179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000285 Xanthomonas translucens strain XT-Rocky flattened_line_570, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000427 Xanthomonas translucens strain XT-Rocky flattened_line_854, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000511 Xanthomonas translucens strain XT-Rocky flattened_line_1022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000542 Xanthomonas translucens strain XT-Rocky flattened_line_1084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000039 Xanthomonas translucens strain XT-Rocky flattened_line_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000093 Xanthomonas translucens strain XT-Rocky flattened_line_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000367 Xanthomonas translucens strain XT-Rocky flattened_line_734, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000432 Xanthomonas translucens strain XT-Rocky flattened_line_864, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000064 Xanthomonas translucens strain XT-Rocky flattened_line_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000251 Xanthomonas translucens strain XT-Rocky flattened_line_500, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000165 Xanthomonas translucens strain XT-Rocky flattened_line_328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000237 Xanthomonas translucens strain XT-Rocky flattened_line_472, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000435 Xanthomonas translucens strain XT-Rocky flattened_line_870, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000351 Xanthomonas translucens strain XT-Rocky flattened_line_702, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000345 Xanthomonas translucens strain XT-Rocky flattened_line_690, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000144 Xanthomonas translucens strain XT-Rocky flattened_line_286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000484 Xanthomonas translucens strain XT-Rocky flattened_line_968, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000007 Xanthomonas translucens strain XT-Rocky flattened_line_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000426 Xanthomonas translucens strain XT-Rocky flattened_line_852, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000464 Xanthomonas translucens strain XT-Rocky flattened_line_928, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000244 Xanthomonas translucens strain XT-Rocky flattened_line_486, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000573 Xanthomonas translucens strain XT-Rocky flattened_line_1146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000569 Xanthomonas translucens strain XT-Rocky flattened_line_1138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000008 Xanthomonas translucens strain XT-Rocky flattened_line_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000253 Xanthomonas translucens strain XT-Rocky flattened_line_504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000038 Xanthomonas translucens strain XT-Rocky flattened_line_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000593 Xanthomonas translucens strain XT-Rocky flattened_line_1185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000398 Xanthomonas translucens strain XT-Rocky flattened_line_796, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000390 Xanthomonas translucens strain XT-Rocky flattened_line_780, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000260 Xanthomonas translucens strain XT-Rocky flattened_line_518, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000333 Xanthomonas translucens strain XT-Rocky flattened_line_666, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000230 Xanthomonas translucens strain XT-Rocky flattened_line_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000374 Xanthomonas translucens strain XT-Rocky flattened_line_748, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000214 Xanthomonas translucens strain XT-Rocky flattened_line_426, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000334 Xanthomonas translucens strain XT-Rocky flattened_line_668, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000084 Xanthomonas translucens strain XT-Rocky flattened_line_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000302 Xanthomonas translucens strain XT-Rocky flattened_line_604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000518 Xanthomonas translucens strain XT-Rocky flattened_line_1036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000021 Xanthomonas translucens strain XT-Rocky flattened_line_40, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNST01000630 Xanthomonas translucens strain XT-Rocky flattened_line_1258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000138 Xanthomonas translucens strain XT-Rocky flattened_line_274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000568 Xanthomonas translucens strain XT-Rocky flattened_line_1136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000315 Xanthomonas translucens strain XT-Rocky flattened_line_630, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000169 Xanthomonas translucens strain XT-Rocky flattened_line_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000123 Xanthomonas translucens strain XT-Rocky flattened_line_244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000303 Xanthomonas translucens strain XT-Rocky flattened_line_606, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000602 Xanthomonas translucens strain XT-Rocky flattened_line_1203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000178 Xanthomonas translucens strain XT-Rocky flattened_line_354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000130 Xanthomonas translucens strain XT-Rocky flattened_line_258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000024 Xanthomonas translucens strain XT-Rocky flattened_line_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000281 Xanthomonas translucens strain XT-Rocky flattened_line_562, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000338 Xanthomonas translucens strain XT-Rocky flattened_line_676, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000153 Xanthomonas translucens strain XT-Rocky flattened_line_304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000157 Xanthomonas translucens strain XT-Rocky flattened_line_312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000532 Xanthomonas translucens strain XT-Rocky flattened_line_1064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000248 Xanthomonas translucens strain XT-Rocky flattened_line_494, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000335 Xanthomonas translucens strain XT-Rocky flattened_line_670, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000101 Xanthomonas translucens strain XT-Rocky flattened_line_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000035 Xanthomonas translucens strain XT-Rocky flattened_line_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000482 Xanthomonas translucens strain XT-Rocky flattened_line_964, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000137 Xanthomonas translucens strain XT-Rocky flattened_line_272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000283 Xanthomonas translucens strain XT-Rocky flattened_line_566, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000174 Xanthomonas translucens strain XT-Rocky flattened_line_346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000509 Xanthomonas translucens strain XT-Rocky flattened_line_1018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000044 Xanthomonas translucens strain XT-Rocky flattened_line_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000556 Xanthomonas translucens strain XT-Rocky flattened_line_1112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000531 Xanthomonas translucens strain XT-Rocky flattened_line_1062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000151 Xanthomonas translucens strain XT-Rocky flattened_line_300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000269 Xanthomonas translucens strain XT-Rocky flattened_line_538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000402 Xanthomonas translucens strain XT-Rocky flattened_line_804, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000108 Xanthomonas translucens strain XT-Rocky flattened_line_214, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNST01000329 Xanthomonas translucens strain XT-Rocky flattened_line_658, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000417 Xanthomonas translucens strain XT-Rocky flattened_line_834, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000314 Xanthomonas translucens strain XT-Rocky flattened_line_628, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000449 Xanthomonas translucens strain XT-Rocky flattened_line_898, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000622 Xanthomonas translucens strain XT-Rocky flattened_line_1242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000202 Xanthomonas translucens strain XT-Rocky flattened_line_402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000497 Xanthomonas translucens strain XT-Rocky flattened_line_994, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000135 Xanthomonas translucens strain XT-Rocky flattened_line_268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000275 Xanthomonas translucens strain XT-Rocky flattened_line_550, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000548 Xanthomonas translucens strain XT-Rocky flattened_line_1096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000387 Xanthomonas translucens strain XT-Rocky flattened_line_774, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000210 Xanthomonas translucens strain XT-Rocky flattened_line_418, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNST01000582 Xanthomonas translucens strain XT-Rocky flattened_line_1163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000508 Xanthomonas translucens strain XT-Rocky flattened_line_1016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000541 Xanthomonas translucens strain XT-Rocky flattened_line_1082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000563 Xanthomonas translucens strain XT-Rocky flattened_line_1126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000604 Xanthomonas translucens strain XT-Rocky flattened_line_1207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000371 Xanthomonas translucens strain XT-Rocky flattened_line_742, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000561 Xanthomonas translucens strain XT-Rocky flattened_line_1122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000129 Xanthomonas translucens strain XT-Rocky flattened_line_256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000353 Xanthomonas translucens strain XT-Rocky flattened_line_706, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000079 Xanthomonas translucens strain XT-Rocky flattened_line_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000404 Xanthomonas translucens strain XT-Rocky flattened_line_808, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000180 Xanthomonas translucens strain XT-Rocky flattened_line_358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000186 Xanthomonas translucens strain XT-Rocky flattened_line_370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000018 Xanthomonas translucens strain XT-Rocky flattened_line_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000154 Xanthomonas translucens strain XT-Rocky flattened_line_306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000159 Xanthomonas translucens strain XT-Rocky flattened_line_316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000551 Xanthomonas translucens strain XT-Rocky flattened_line_1102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000519 Xanthomonas translucens strain XT-Rocky flattened_line_1038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000320 Xanthomonas translucens strain XT-Rocky flattened_line_640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000259 Xanthomonas translucens strain XT-Rocky flattened_line_516, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000229 Xanthomonas translucens strain XT-Rocky flattened_line_456, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000277 Xanthomonas translucens strain XT-Rocky flattened_line_554, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000356 Xanthomonas translucens strain XT-Rocky flattened_line_712, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000162 Xanthomonas translucens strain XT-Rocky flattened_line_322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000536 Xanthomonas translucens strain XT-Rocky flattened_line_1072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000381 Xanthomonas translucens strain XT-Rocky flattened_line_762, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000103 Xanthomonas translucens strain XT-Rocky flattened_line_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000195 Xanthomonas translucens strain XT-Rocky flattened_line_388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000073 Xanthomonas translucens strain XT-Rocky flattened_line_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000510 Xanthomonas translucens strain XT-Rocky flattened_line_1020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000543 Xanthomonas translucens strain XT-Rocky flattened_line_1086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000171 Xanthomonas translucens strain XT-Rocky flattened_line_340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000233 Xanthomonas translucens strain XT-Rocky flattened_line_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000607 Xanthomonas translucens strain XT-Rocky flattened_line_1212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000025 Xanthomonas translucens strain XT-Rocky flattened_line_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000197 Xanthomonas translucens strain XT-Rocky flattened_line_392, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000075 Xanthomonas translucens strain XT-Rocky flattened_line_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000219 Xanthomonas translucens strain XT-Rocky flattened_line_436, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000067 Xanthomonas translucens strain XT-Rocky flattened_line_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000623 Xanthomonas translucens strain XT-Rocky flattened_line_1244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000071 Xanthomonas translucens strain XT-Rocky flattened_line_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000098 Xanthomonas translucens strain XT-Rocky flattened_line_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000170 Xanthomonas translucens strain XT-Rocky flattened_line_338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000332 Xanthomonas translucens strain XT-Rocky flattened_line_664, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000594 Xanthomonas translucens strain XT-Rocky flattened_line_1187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000405 Xanthomonas translucens strain XT-Rocky flattened_line_810, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000608 Xanthomonas translucens strain XT-Rocky flattened_line_1214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000370 Xanthomonas translucens strain XT-Rocky flattened_line_740, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000223 Xanthomonas translucens strain XT-Rocky flattened_line_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000222 Xanthomonas translucens strain XT-Rocky flattened_line_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000276 Xanthomonas translucens strain XT-Rocky flattened_line_552, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000477 Xanthomonas translucens strain XT-Rocky flattened_line_954, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000100 Xanthomonas translucens strain XT-Rocky flattened_line_198, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNST01000029 Xanthomonas translucens strain XT-Rocky flattened_line_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000395 Xanthomonas translucens strain XT-Rocky flattened_line_790, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000068 Xanthomonas translucens strain XT-Rocky flattened_line_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000109 Xanthomonas translucens strain XT-Rocky flattened_line_216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000378 Xanthomonas translucens strain XT-Rocky flattened_line_756, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000421 Xanthomonas translucens strain XT-Rocky flattened_line_842, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000324 Xanthomonas translucens strain XT-Rocky flattened_line_648, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000113 Xanthomonas translucens strain XT-Rocky flattened_line_224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000273 Xanthomonas translucens strain XT-Rocky flattened_line_546, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000291 Xanthomonas translucens strain XT-Rocky flattened_line_582, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000406 Xanthomonas translucens strain XT-Rocky flattened_line_812, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000325 Xanthomonas translucens strain XT-Rocky flattened_line_650, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000575 Xanthomonas translucens strain XT-Rocky flattened_line_1150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000284 Xanthomonas translucens strain XT-Rocky flattened_line_568, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000438 Xanthomonas translucens strain XT-Rocky flattened_line_876, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000611 Xanthomonas translucens strain XT-Rocky flattened_line_1220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000228 Xanthomonas translucens strain XT-Rocky flattened_line_454, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000300 Xanthomonas translucens strain XT-Rocky flattened_line_600, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000515 Xanthomonas translucens strain XT-Rocky flattened_line_1030, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000632 Xanthomonas translucens strain XT-Rocky flattened_line_1262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000555 Xanthomonas translucens strain XT-Rocky flattened_line_1110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000243 Xanthomonas translucens strain XT-Rocky flattened_line_484, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000308 Xanthomonas translucens strain XT-Rocky flattened_line_616, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000566 Xanthomonas translucens strain XT-Rocky flattened_line_1132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000462 Xanthomonas translucens strain XT-Rocky flattened_line_924, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000401 Xanthomonas translucens strain XT-Rocky flattened_line_802, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000442 Xanthomonas translucens strain XT-Rocky flattened_line_884, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000268 Xanthomonas translucens strain XT-Rocky flattened_line_536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000616 Xanthomonas translucens strain XT-Rocky flattened_line_1230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000399 Xanthomonas translucens strain XT-Rocky flattened_line_798, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000576 Xanthomonas translucens strain XT-Rocky flattened_line_1152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000304 Xanthomonas translucens strain XT-Rocky flattened_line_608, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000343 Xanthomonas translucens strain XT-Rocky flattened_line_686, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000424 Xanthomonas translucens strain XT-Rocky flattened_line_848, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000293 Xanthomonas translucens strain XT-Rocky flattened_line_586, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000092 Xanthomonas translucens strain XT-Rocky flattened_line_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000053 Xanthomonas translucens strain XT-Rocky flattened_line_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000425 Xanthomonas translucens strain XT-Rocky flattened_line_850, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000626 Xanthomonas translucens strain XT-Rocky flattened_line_1250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000131 Xanthomonas translucens strain XT-Rocky flattened_line_260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000586 Xanthomonas translucens strain XT-Rocky flattened_line_1171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000489 Xanthomonas translucens strain XT-Rocky flattened_line_978, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000033 Xanthomonas translucens strain XT-Rocky flattened_line_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000140 Xanthomonas translucens strain XT-Rocky flattened_line_278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000514 Xanthomonas translucens strain XT-Rocky flattened_line_1028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000307 Xanthomonas translucens strain XT-Rocky flattened_line_614, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000239 Xanthomonas translucens strain XT-Rocky flattened_line_476, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000232 Xanthomonas translucens strain XT-Rocky flattened_line_462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000585 Xanthomonas translucens strain XT-Rocky flattened_line_1169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000058 Xanthomonas translucens strain XT-Rocky flattened_line_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000160 Xanthomonas translucens strain XT-Rocky flattened_line_318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000377 Xanthomonas translucens strain XT-Rocky flattened_line_754, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000613 Xanthomonas translucens strain XT-Rocky flattened_line_1224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000069 Xanthomonas translucens strain XT-Rocky flattened_line_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000342 Xanthomonas translucens strain XT-Rocky flattened_line_684, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000522 Xanthomonas translucens strain XT-Rocky flattened_line_1044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000271 Xanthomonas translucens strain XT-Rocky flattened_line_542, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000193 Xanthomonas translucens strain XT-Rocky flattened_line_384, whole genome shotgun sequence 1 crisprs NA 1 1 0 0
NZ_LNST01000588 Xanthomonas translucens strain XT-Rocky flattened_line_1175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000208 Xanthomonas translucens strain XT-Rocky flattened_line_414, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000106 Xanthomonas translucens strain XT-Rocky flattened_line_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000316 Xanthomonas translucens strain XT-Rocky flattened_line_632, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNST01000448 Xanthomonas translucens strain XT-Rocky flattened_line_896, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000066 Xanthomonas translucens strain XT-Rocky flattened_line_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000192 Xanthomonas translucens strain XT-Rocky flattened_line_382, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000191 Xanthomonas translucens strain XT-Rocky flattened_line_380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000105 Xanthomonas translucens strain XT-Rocky flattened_line_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000297 Xanthomonas translucens strain XT-Rocky flattened_line_594, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000478 Xanthomonas translucens strain XT-Rocky flattened_line_956, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000141 Xanthomonas translucens strain XT-Rocky flattened_line_280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000554 Xanthomonas translucens strain XT-Rocky flattened_line_1108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000583 Xanthomonas translucens strain XT-Rocky flattened_line_1165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000107 Xanthomonas translucens strain XT-Rocky flattened_line_212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000292 Xanthomonas translucens strain XT-Rocky flattened_line_584, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000463 Xanthomonas translucens strain XT-Rocky flattened_line_926, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000001 Xanthomonas translucens strain XT-Rocky flattened_line_0, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000152 Xanthomonas translucens strain XT-Rocky flattened_line_302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000088 Xanthomonas translucens strain XT-Rocky flattened_line_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000189 Xanthomonas translucens strain XT-Rocky flattened_line_376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000020 Xanthomonas translucens strain XT-Rocky flattened_line_38, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNST01000145 Xanthomonas translucens strain XT-Rocky flattened_line_288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000309 Xanthomonas translucens strain XT-Rocky flattened_line_618, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000331 Xanthomonas translucens strain XT-Rocky flattened_line_662, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000172 Xanthomonas translucens strain XT-Rocky flattened_line_342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000606 Xanthomonas translucens strain XT-Rocky flattened_line_1210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000305 Xanthomonas translucens strain XT-Rocky flattened_line_610, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000166 Xanthomonas translucens strain XT-Rocky flattened_line_330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000227 Xanthomonas translucens strain XT-Rocky flattened_line_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000042 Xanthomonas translucens strain XT-Rocky flattened_line_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000418 Xanthomonas translucens strain XT-Rocky flattened_line_836, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000040 Xanthomonas translucens strain XT-Rocky flattened_line_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000499 Xanthomonas translucens strain XT-Rocky flattened_line_998, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000326 Xanthomonas translucens strain XT-Rocky flattened_line_652, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000031 Xanthomonas translucens strain XT-Rocky flattened_line_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000376 Xanthomonas translucens strain XT-Rocky flattened_line_752, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000052 Xanthomonas translucens strain XT-Rocky flattened_line_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000011 Xanthomonas translucens strain XT-Rocky flattened_line_20, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 9 46 0 0
NZ_LNST01000526 Xanthomonas translucens strain XT-Rocky flattened_line_1052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000294 Xanthomonas translucens strain XT-Rocky flattened_line_588, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000274 Xanthomonas translucens strain XT-Rocky flattened_line_548, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000318 Xanthomonas translucens strain XT-Rocky flattened_line_636, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000465 Xanthomonas translucens strain XT-Rocky flattened_line_930, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000628 Xanthomonas translucens strain XT-Rocky flattened_line_1254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000077 Xanthomonas translucens strain XT-Rocky flattened_line_152, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNST01000383 Xanthomonas translucens strain XT-Rocky flattened_line_766, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000502 Xanthomonas translucens strain XT-Rocky flattened_line_1004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000360 Xanthomonas translucens strain XT-Rocky flattened_line_720, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000065 Xanthomonas translucens strain XT-Rocky flattened_line_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000124 Xanthomonas translucens strain XT-Rocky flattened_line_246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000483 Xanthomonas translucens strain XT-Rocky flattened_line_966, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000562 Xanthomonas translucens strain XT-Rocky flattened_line_1124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000258 Xanthomonas translucens strain XT-Rocky flattened_line_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000524 Xanthomonas translucens strain XT-Rocky flattened_line_1048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000631 Xanthomonas translucens strain XT-Rocky flattened_line_1260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000348 Xanthomonas translucens strain XT-Rocky flattened_line_696, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000581 Xanthomonas translucens strain XT-Rocky flattened_line_1161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000366 Xanthomonas translucens strain XT-Rocky flattened_line_732, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000447 Xanthomonas translucens strain XT-Rocky flattened_line_894, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000085 Xanthomonas translucens strain XT-Rocky flattened_line_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000255 Xanthomonas translucens strain XT-Rocky flattened_line_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000612 Xanthomonas translucens strain XT-Rocky flattened_line_1222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000410 Xanthomonas translucens strain XT-Rocky flattened_line_820, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000241 Xanthomonas translucens strain XT-Rocky flattened_line_480, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000036 Xanthomonas translucens strain XT-Rocky flattened_line_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000187 Xanthomonas translucens strain XT-Rocky flattened_line_372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000521 Xanthomonas translucens strain XT-Rocky flattened_line_1042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000081 Xanthomonas translucens strain XT-Rocky flattened_line_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000321 Xanthomonas translucens strain XT-Rocky flattened_line_642, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000584 Xanthomonas translucens strain XT-Rocky flattened_line_1167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000216 Xanthomonas translucens strain XT-Rocky flattened_line_430, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000132 Xanthomonas translucens strain XT-Rocky flattened_line_262, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNST01000535 Xanthomonas translucens strain XT-Rocky flattened_line_1070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000204 Xanthomonas translucens strain XT-Rocky flattened_line_406, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000009 Xanthomonas translucens strain XT-Rocky flattened_line_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000567 Xanthomonas translucens strain XT-Rocky flattened_line_1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000384 Xanthomonas translucens strain XT-Rocky flattened_line_768, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000072 Xanthomonas translucens strain XT-Rocky flattened_line_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000196 Xanthomonas translucens strain XT-Rocky flattened_line_390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000389 Xanthomonas translucens strain XT-Rocky flattened_line_778, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000396 Xanthomonas translucens strain XT-Rocky flattened_line_792, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000199 Xanthomonas translucens strain XT-Rocky flattened_line_396, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000372 Xanthomonas translucens strain XT-Rocky flattened_line_744, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000544 Xanthomonas translucens strain XT-Rocky flattened_line_1088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000597 Xanthomonas translucens strain XT-Rocky flattened_line_1193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000467 Xanthomonas translucens strain XT-Rocky flattened_line_934, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000167 Xanthomonas translucens strain XT-Rocky flattened_line_332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000050 Xanthomonas translucens strain XT-Rocky flattened_line_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000501 Xanthomonas translucens strain XT-Rocky flattened_line_1002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000393 Xanthomonas translucens strain XT-Rocky flattened_line_786, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000592 Xanthomonas translucens strain XT-Rocky flattened_line_1183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000116 Xanthomonas translucens strain XT-Rocky flattened_line_230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000182 Xanthomonas translucens strain XT-Rocky flattened_line_362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000076 Xanthomonas translucens strain XT-Rocky flattened_line_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000545 Xanthomonas translucens strain XT-Rocky flattened_line_1090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000620 Xanthomonas translucens strain XT-Rocky flattened_line_1238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000311 Xanthomonas translucens strain XT-Rocky flattened_line_622, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000147 Xanthomonas translucens strain XT-Rocky flattened_line_292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000461 Xanthomonas translucens strain XT-Rocky flattened_line_922, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000095 Xanthomonas translucens strain XT-Rocky flattened_line_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000032 Xanthomonas translucens strain XT-Rocky flattened_line_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000078 Xanthomonas translucens strain XT-Rocky flattened_line_154, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNST01000282 Xanthomonas translucens strain XT-Rocky flattened_line_564, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000468 Xanthomonas translucens strain XT-Rocky flattened_line_936, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000057 Xanthomonas translucens strain XT-Rocky flattened_line_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000362 Xanthomonas translucens strain XT-Rocky flattened_line_724, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000279 Xanthomonas translucens strain XT-Rocky flattened_line_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000014 Xanthomonas translucens strain XT-Rocky flattened_line_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000557 Xanthomonas translucens strain XT-Rocky flattened_line_1114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000083 Xanthomonas translucens strain XT-Rocky flattened_line_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000618 Xanthomonas translucens strain XT-Rocky flattened_line_1234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000491 Xanthomonas translucens strain XT-Rocky flattened_line_982, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000397 Xanthomonas translucens strain XT-Rocky flattened_line_794, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000455 Xanthomonas translucens strain XT-Rocky flattened_line_910, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000520 Xanthomonas translucens strain XT-Rocky flattened_line_1040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000512 Xanthomonas translucens strain XT-Rocky flattened_line_1024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000295 Xanthomonas translucens strain XT-Rocky flattened_line_590, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000150 Xanthomonas translucens strain XT-Rocky flattened_line_298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000181 Xanthomonas translucens strain XT-Rocky flattened_line_360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000205 Xanthomonas translucens strain XT-Rocky flattened_line_408, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000357 Xanthomonas translucens strain XT-Rocky flattened_line_714, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000250 Xanthomonas translucens strain XT-Rocky flattened_line_498, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000434 Xanthomonas translucens strain XT-Rocky flattened_line_868, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000240 Xanthomonas translucens strain XT-Rocky flattened_line_478, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000485 Xanthomonas translucens strain XT-Rocky flattened_line_970, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000049 Xanthomonas translucens strain XT-Rocky flattened_line_96, whole genome shotgun sequence 0 crisprs Cas9_archaeal 0 0 0 0
NZ_LNST01000238 Xanthomonas translucens strain XT-Rocky flattened_line_474, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000365 Xanthomonas translucens strain XT-Rocky flattened_line_730, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000479 Xanthomonas translucens strain XT-Rocky flattened_line_958, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000017 Xanthomonas translucens strain XT-Rocky flattened_line_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000414 Xanthomonas translucens strain XT-Rocky flattened_line_828, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000403 Xanthomonas translucens strain XT-Rocky flattened_line_806, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000030 Xanthomonas translucens strain XT-Rocky flattened_line_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000458 Xanthomonas translucens strain XT-Rocky flattened_line_916, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000212 Xanthomonas translucens strain XT-Rocky flattened_line_422, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000516 Xanthomonas translucens strain XT-Rocky flattened_line_1032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000534 Xanthomonas translucens strain XT-Rocky flattened_line_1068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000179 Xanthomonas translucens strain XT-Rocky flattened_line_356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000494 Xanthomonas translucens strain XT-Rocky flattened_line_988, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000111 Xanthomonas translucens strain XT-Rocky flattened_line_220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000565 Xanthomonas translucens strain XT-Rocky flattened_line_1130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000450 Xanthomonas translucens strain XT-Rocky flattened_line_900, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000416 Xanthomonas translucens strain XT-Rocky flattened_line_832, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000445 Xanthomonas translucens strain XT-Rocky flattened_line_890, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000633 Xanthomonas translucens strain XT-Rocky flattened_line_1264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000270 Xanthomonas translucens strain XT-Rocky flattened_line_540, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000127 Xanthomonas translucens strain XT-Rocky flattened_line_252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000503 Xanthomonas translucens strain XT-Rocky flattened_line_1006, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000185 Xanthomonas translucens strain XT-Rocky flattened_line_368, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000213 Xanthomonas translucens strain XT-Rocky flattened_line_424, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000003 Xanthomonas translucens strain XT-Rocky flattened_line_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000513 Xanthomonas translucens strain XT-Rocky flattened_line_1026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000015 Xanthomonas translucens strain XT-Rocky flattened_line_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000265 Xanthomonas translucens strain XT-Rocky flattened_line_528, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000062 Xanthomonas translucens strain XT-Rocky flattened_line_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000198 Xanthomonas translucens strain XT-Rocky flattened_line_394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000598 Xanthomonas translucens strain XT-Rocky flattened_line_1195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000122 Xanthomonas translucens strain XT-Rocky flattened_line_242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000125 Xanthomonas translucens strain XT-Rocky flattened_line_248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000614 Xanthomonas translucens strain XT-Rocky flattened_line_1226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000498 Xanthomonas translucens strain XT-Rocky flattened_line_996, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000617 Xanthomonas translucens strain XT-Rocky flattened_line_1232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000013 Xanthomonas translucens strain XT-Rocky flattened_line_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000200 Xanthomonas translucens strain XT-Rocky flattened_line_398, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000231 Xanthomonas translucens strain XT-Rocky flattened_line_460, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000330 Xanthomonas translucens strain XT-Rocky flattened_line_660, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000041 Xanthomonas translucens strain XT-Rocky flattened_line_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000476 Xanthomonas translucens strain XT-Rocky flattened_line_952, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000136 Xanthomonas translucens strain XT-Rocky flattened_line_270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000407 Xanthomonas translucens strain XT-Rocky flattened_line_814, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000580 Xanthomonas translucens strain XT-Rocky flattened_line_1159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000262 Xanthomonas translucens strain XT-Rocky flattened_line_522, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000278 Xanthomonas translucens strain XT-Rocky flattened_line_556, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000340 Xanthomonas translucens strain XT-Rocky flattened_line_680, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000156 Xanthomonas translucens strain XT-Rocky flattened_line_310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000346 Xanthomonas translucens strain XT-Rocky flattened_line_692, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000306 Xanthomonas translucens strain XT-Rocky flattened_line_612, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000386 Xanthomonas translucens strain XT-Rocky flattened_line_772, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000139 Xanthomonas translucens strain XT-Rocky flattened_line_276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000436 Xanthomonas translucens strain XT-Rocky flattened_line_872, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000063 Xanthomonas translucens strain XT-Rocky flattened_line_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000322 Xanthomonas translucens strain XT-Rocky flattened_line_644, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000373 Xanthomonas translucens strain XT-Rocky flattened_line_746, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000146 Xanthomonas translucens strain XT-Rocky flattened_line_290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000298 Xanthomonas translucens strain XT-Rocky flattened_line_596, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000051 Xanthomonas translucens strain XT-Rocky flattened_line_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000610 Xanthomonas translucens strain XT-Rocky flattened_line_1218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000060 Xanthomonas translucens strain XT-Rocky flattened_line_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000603 Xanthomonas translucens strain XT-Rocky flattened_line_1205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000529 Xanthomonas translucens strain XT-Rocky flattened_line_1058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000488 Xanthomonas translucens strain XT-Rocky flattened_line_976, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000538 Xanthomonas translucens strain XT-Rocky flattened_line_1076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000266 Xanthomonas translucens strain XT-Rocky flattened_line_530, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000350 Xanthomonas translucens strain XT-Rocky flattened_line_700, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000086 Xanthomonas translucens strain XT-Rocky flattened_line_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000119 Xanthomonas translucens strain XT-Rocky flattened_line_236, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNST01000615 Xanthomonas translucens strain XT-Rocky flattened_line_1228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000609 Xanthomonas translucens strain XT-Rocky flattened_line_1216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000112 Xanthomonas translucens strain XT-Rocky flattened_line_222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000363 Xanthomonas translucens strain XT-Rocky flattened_line_726, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000257 Xanthomonas translucens strain XT-Rocky flattened_line_512, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000523 Xanthomonas translucens strain XT-Rocky flattened_line_1046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000634 Xanthomonas translucens strain XT-Rocky flattened_line_1266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000236 Xanthomonas translucens strain XT-Rocky flattened_line_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000128 Xanthomonas translucens strain XT-Rocky flattened_line_254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000234 Xanthomonas translucens strain XT-Rocky flattened_line_466, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000215 Xanthomonas translucens strain XT-Rocky flattened_line_428, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000394 Xanthomonas translucens strain XT-Rocky flattened_line_788, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000296 Xanthomonas translucens strain XT-Rocky flattened_line_592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000046 Xanthomonas translucens strain XT-Rocky flattened_line_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000104 Xanthomonas translucens strain XT-Rocky flattened_line_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000339 Xanthomonas translucens strain XT-Rocky flattened_line_678, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000539 Xanthomonas translucens strain XT-Rocky flattened_line_1078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000217 Xanthomonas translucens strain XT-Rocky flattened_line_432, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000218 Xanthomonas translucens strain XT-Rocky flattened_line_434, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000537 Xanthomonas translucens strain XT-Rocky flattened_line_1074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000457 Xanthomonas translucens strain XT-Rocky flattened_line_914, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000422 Xanthomonas translucens strain XT-Rocky flattened_line_844, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000379 Xanthomonas translucens strain XT-Rocky flattened_line_758, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000203 Xanthomonas translucens strain XT-Rocky flattened_line_404, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000010 Xanthomonas translucens strain XT-Rocky flattened_line_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000437 Xanthomonas translucens strain XT-Rocky flattened_line_874, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000500 Xanthomonas translucens strain XT-Rocky flattened_line_1000, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000492 Xanthomonas translucens strain XT-Rocky flattened_line_984, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000206 Xanthomonas translucens strain XT-Rocky flattened_line_410, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000254 Xanthomonas translucens strain XT-Rocky flattened_line_506, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000188 Xanthomonas translucens strain XT-Rocky flattened_line_374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000359 Xanthomonas translucens strain XT-Rocky flattened_line_718, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000601 Xanthomonas translucens strain XT-Rocky flattened_line_1201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000161 Xanthomonas translucens strain XT-Rocky flattened_line_320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000635 Xanthomonas translucens strain XT-Rocky flattened_line_1268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000454 Xanthomonas translucens strain XT-Rocky flattened_line_908, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000312 Xanthomonas translucens strain XT-Rocky flattened_line_624, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000525 Xanthomonas translucens strain XT-Rocky flattened_line_1050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000246 Xanthomonas translucens strain XT-Rocky flattened_line_490, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000487 Xanthomonas translucens strain XT-Rocky flattened_line_974, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000490 Xanthomonas translucens strain XT-Rocky flattened_line_980, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000096 Xanthomonas translucens strain XT-Rocky flattened_line_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000621 Xanthomonas translucens strain XT-Rocky flattened_line_1240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000249 Xanthomonas translucens strain XT-Rocky flattened_line_496, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000415 Xanthomonas translucens strain XT-Rocky flattened_line_830, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000423 Xanthomonas translucens strain XT-Rocky flattened_line_846, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNST01000319 Xanthomonas translucens strain XT-Rocky flattened_line_638, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000148 Xanthomonas translucens strain XT-Rocky flattened_line_294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000089 Xanthomonas translucens strain XT-Rocky flattened_line_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000430 Xanthomonas translucens strain XT-Rocky flattened_line_860, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000070 Xanthomonas translucens strain XT-Rocky flattened_line_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000289 Xanthomonas translucens strain XT-Rocky flattened_line_578, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000358 Xanthomonas translucens strain XT-Rocky flattened_line_716, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000328 Xanthomonas translucens strain XT-Rocky flattened_line_656, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000176 Xanthomonas translucens strain XT-Rocky flattened_line_350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000247 Xanthomonas translucens strain XT-Rocky flattened_line_492, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000443 Xanthomonas translucens strain XT-Rocky flattened_line_886, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000368 Xanthomonas translucens strain XT-Rocky flattened_line_736, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000019 Xanthomonas translucens strain XT-Rocky flattened_line_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000074 Xanthomonas translucens strain XT-Rocky flattened_line_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000177 Xanthomonas translucens strain XT-Rocky flattened_line_352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000486 Xanthomonas translucens strain XT-Rocky flattened_line_972, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000413 Xanthomonas translucens strain XT-Rocky flattened_line_826, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000054 Xanthomonas translucens strain XT-Rocky flattened_line_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000120 Xanthomonas translucens strain XT-Rocky flattened_line_238, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNST01000400 Xanthomonas translucens strain XT-Rocky flattened_line_800, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000047 Xanthomonas translucens strain XT-Rocky flattened_line_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000115 Xanthomonas translucens strain XT-Rocky flattened_line_228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000037 Xanthomonas translucens strain XT-Rocky flattened_line_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000226 Xanthomonas translucens strain XT-Rocky flattened_line_450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000183 Xanthomonas translucens strain XT-Rocky flattened_line_364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000149 Xanthomonas translucens strain XT-Rocky flattened_line_296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000533 Xanthomonas translucens strain XT-Rocky flattened_line_1066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000209 Xanthomonas translucens strain XT-Rocky flattened_line_416, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000456 Xanthomonas translucens strain XT-Rocky flattened_line_912, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000504 Xanthomonas translucens strain XT-Rocky flattened_line_1008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000097 Xanthomonas translucens strain XT-Rocky flattened_line_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000194 Xanthomonas translucens strain XT-Rocky flattened_line_386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000506 Xanthomonas translucens strain XT-Rocky flattened_line_1012, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNST01000429 Xanthomonas translucens strain XT-Rocky flattened_line_858, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNST01000184 Xanthomonas translucens strain XT-Rocky flattened_line_366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000201 Xanthomonas translucens strain XT-Rocky flattened_line_400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000299 Xanthomonas translucens strain XT-Rocky flattened_line_598, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000225 Xanthomonas translucens strain XT-Rocky flattened_line_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000553 Xanthomonas translucens strain XT-Rocky flattened_line_1106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000382 Xanthomonas translucens strain XT-Rocky flattened_line_764, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000099 Xanthomonas translucens strain XT-Rocky flattened_line_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000344 Xanthomonas translucens strain XT-Rocky flattened_line_688, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000252 Xanthomonas translucens strain XT-Rocky flattened_line_502, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000552 Xanthomonas translucens strain XT-Rocky flattened_line_1104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000517 Xanthomonas translucens strain XT-Rocky flattened_line_1034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000082 Xanthomonas translucens strain XT-Rocky flattened_line_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000605 Xanthomonas translucens strain XT-Rocky flattened_line_1208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000546 Xanthomonas translucens strain XT-Rocky flattened_line_1092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000570 Xanthomonas translucens strain XT-Rocky flattened_line_1140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000540 Xanthomonas translucens strain XT-Rocky flattened_line_1080, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000574 Xanthomonas translucens strain XT-Rocky flattened_line_1148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000173 Xanthomonas translucens strain XT-Rocky flattened_line_344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000220 Xanthomonas translucens strain XT-Rocky flattened_line_438, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000224 Xanthomonas translucens strain XT-Rocky flattened_line_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000005 Xanthomonas translucens strain XT-Rocky flattened_line_8, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000290 Xanthomonas translucens strain XT-Rocky flattened_line_580, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000507 Xanthomonas translucens strain XT-Rocky flattened_line_1014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000288 Xanthomonas translucens strain XT-Rocky flattened_line_576, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000392 Xanthomonas translucens strain XT-Rocky flattened_line_784, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000627 Xanthomonas translucens strain XT-Rocky flattened_line_1252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000027 Xanthomonas translucens strain XT-Rocky flattened_line_52, whole genome shotgun sequence 3 crisprs NA 1 55 0 0
NZ_LNST01000168 Xanthomonas translucens strain XT-Rocky flattened_line_334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000547 Xanthomonas translucens strain XT-Rocky flattened_line_1094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000475 Xanthomonas translucens strain XT-Rocky flattened_line_950, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000110 Xanthomonas translucens strain XT-Rocky flattened_line_218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000440 Xanthomonas translucens strain XT-Rocky flattened_line_880, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000385 Xanthomonas translucens strain XT-Rocky flattened_line_770, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000444 Xanthomonas translucens strain XT-Rocky flattened_line_888, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000352 Xanthomonas translucens strain XT-Rocky flattened_line_704, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000045 Xanthomonas translucens strain XT-Rocky flattened_line_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000034 Xanthomonas translucens strain XT-Rocky flattened_line_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000354 Xanthomonas translucens strain XT-Rocky flattened_line_708, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000550 Xanthomonas translucens strain XT-Rocky flattened_line_1100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000481 Xanthomonas translucens strain XT-Rocky flattened_line_962, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000267 Xanthomonas translucens strain XT-Rocky flattened_line_532, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000142 Xanthomonas translucens strain XT-Rocky flattened_line_282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000059 Xanthomonas translucens strain XT-Rocky flattened_line_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000558 Xanthomonas translucens strain XT-Rocky flattened_line_1116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000323 Xanthomonas translucens strain XT-Rocky flattened_line_646, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000496 Xanthomonas translucens strain XT-Rocky flattened_line_992, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000587 Xanthomonas translucens strain XT-Rocky flattened_line_1173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000043 Xanthomonas translucens strain XT-Rocky flattened_line_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000460 Xanthomonas translucens strain XT-Rocky flattened_line_920, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000470 Xanthomonas translucens strain XT-Rocky flattened_line_940, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000091 Xanthomonas translucens strain XT-Rocky flattened_line_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000207 Xanthomonas translucens strain XT-Rocky flattened_line_412, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000364 Xanthomonas translucens strain XT-Rocky flattened_line_728, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000549 Xanthomonas translucens strain XT-Rocky flattened_line_1098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000102 Xanthomonas translucens strain XT-Rocky flattened_line_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000412 Xanthomonas translucens strain XT-Rocky flattened_line_824, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000048 Xanthomonas translucens strain XT-Rocky flattened_line_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000175 Xanthomonas translucens strain XT-Rocky flattened_line_348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000577 Xanthomonas translucens strain XT-Rocky flattened_line_1154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000528 Xanthomonas translucens strain XT-Rocky flattened_line_1056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000080 Xanthomonas translucens strain XT-Rocky flattened_line_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000341 Xanthomonas translucens strain XT-Rocky flattened_line_682, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000163 Xanthomonas translucens strain XT-Rocky flattened_line_324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000505 Xanthomonas translucens strain XT-Rocky flattened_line_1010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000023 Xanthomonas translucens strain XT-Rocky flattened_line_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000133 Xanthomonas translucens strain XT-Rocky flattened_line_264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000589 Xanthomonas translucens strain XT-Rocky flattened_line_1177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000310 Xanthomonas translucens strain XT-Rocky flattened_line_620, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000313 Xanthomonas translucens strain XT-Rocky flattened_line_626, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000441 Xanthomonas translucens strain XT-Rocky flattened_line_882, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000026 Xanthomonas translucens strain XT-Rocky flattened_line_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000591 Xanthomonas translucens strain XT-Rocky flattened_line_1181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000361 Xanthomonas translucens strain XT-Rocky flattened_line_722, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000087 Xanthomonas translucens strain XT-Rocky flattened_line_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000094 Xanthomonas translucens strain XT-Rocky flattened_line_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000190 Xanthomonas translucens strain XT-Rocky flattened_line_378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000578 Xanthomonas translucens strain XT-Rocky flattened_line_1156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000336 Xanthomonas translucens strain XT-Rocky flattened_line_672, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000287 Xanthomonas translucens strain XT-Rocky flattened_line_574, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNST01000474 Xanthomonas translucens strain XT-Rocky flattened_line_948, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LNST01000261
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNST01000143
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000143_1 6312-6455 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LNST01000114
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LNST01000119
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000119_1 8526-8628 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_LNST01000256
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LNST01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_LNST01000012
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_LNST01000164
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_LNST01000348
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_LNST01000104
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_LNST01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8876 : 32785 30 Siphoviridae_environmental_samples(38.1%) terminase,tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNST01000004.1|WP_058195519.1|6425_6710_+|hypothetical-protein 6425_6710_+ 94 aa aa AcrIC10 NA NA No NA
NZ_LNST01000004.1|WP_058195507.1|22014_22353_-|hypothetical-protein 22014_22353_- 112 aa aa NA NA NA 8876-32785 yes
12. NZ_LNST01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_LNST01000320
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_LNST01000321
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_LNST01000193
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000193_1 7427-7491 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000316.1 3176-3194 1 0.947
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000038.1 2185-2203 1 0.947
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000049.1 8791-8809 1 0.947
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000083.1 7267-7285 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000010.1 1338-1356 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000094.1 9682-9700 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000095.1 11918-11936 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000097.1 11366-11384 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000097.1 11585-11603 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000104.1 10093-10111 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000012.1 20209-20227 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000114.1 15-33 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000138.1 7347-7365 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000163.1 4837-4855 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000164.1 3477-3495 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000187.1 890-908 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000020.1 17477-17495 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000024.1 11663-11681 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000026.1 6075-6093 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000026.1 7259-7277 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000026.1 7312-7330 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000261.1 5358-5376 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000032.1 21011-21029 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000335.1 3542-3560 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000348.1 1379-1397 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000362.1 1563-1581 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000386.1 2357-2375 2 0.895
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000090.1 6884-6902 7 0.632
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000248.1 5425-5443 7 0.632
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NZ_LNST01000193.1 5034-5052 8 0.579

1. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 3176-3194, mismatch: 1, identity: 0.947

cggccaagccggcgccggc	CRISPR spacer
cggccaagccggcgcaggc	Protospacer
*************** ***

2. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 2185-2203, mismatch: 1, identity: 0.947

cggccaagccggcgccggc	CRISPR spacer
cggtcaagccggcgccggc	Protospacer
***.***************

3. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 8791-8809, mismatch: 1, identity: 0.947

cggccaagccggcgccggc	CRISPR spacer
cggccacgccggcgccggc	Protospacer
****** ************

4. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 7267-7285, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccgagtcggcgccggc	Protospacer
*****.**.**********

5. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 1338-1356, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaggccggcgacggc	Protospacer
******.******* ****

6. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 9682-9700, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaacgcggcgccggc	Protospacer
*******  **********

7. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 11918-11936, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaaccaggcgccggc	Protospacer
******* * *********

8. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 11366-11384, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaggccgacgccggc	Protospacer
******.****.*******

9. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 11585-11603, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggcgaagccggcgtcggc	Protospacer
**** *********.****

10. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 10093-10111, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccgcgccggcgccggc	Protospacer
*****. ************

11. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 20209-20227, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaggccggcgccagc	Protospacer
******.*********.**

12. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 15-33, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cgcccaagccggcgctggc	Protospacer
** ************.***

13. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 7347-7365, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaagccggctgcggc	Protospacer
*************  ****

14. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 4837-4855, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccattccggcgccggc	Protospacer
******  ***********

15. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 3477-3495, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccatgccggcgctggc	Protospacer
****** ********.***

16. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 890-908, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaagccggcttcggc	Protospacer
************* .****

17. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 17477-17495, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaagaaggcgccggc	Protospacer
********  *********

18. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 11663-11681, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cgccgaagccggcgccggc	Protospacer
** * **************

19. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 6075-6093, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccagaccggcgccggc	Protospacer
******..***********

20. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 7259-7277, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccgaggcggcgccggc	Protospacer
*****.** **********

21. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 7312-7330, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaagccgatgccggc	Protospacer
***********..******

22. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 5358-5376, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggcgaaaccggcgccggc	Protospacer
**** **.***********

23. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 21011-21029, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaggccggcgacggc	Protospacer
******.******* ****

24. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 3542-3560, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccgcgccggcgccggc	Protospacer
*****. ************

25. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 1379-1397, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggcgatgccggcgccggc	Protospacer
**** * ************

26. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 1563-1581, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccatgccggcggcggc	Protospacer
****** ******* ****

27. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 2357-2375, mismatch: 2, identity: 0.895

cggccaagccggcgccggc	CRISPR spacer
cggccaggccagcgccggc	Protospacer
******.***.********

28. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 6884-6902, mismatch: 7, identity: 0.632

cggccaagccggcgccggc-------	CRISPR spacer
-------gccggcgccggcgcggccg	Protospacer
       ************       

29. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 5425-5443, mismatch: 7, identity: 0.632

cggccaagccggcgccggc-------	CRISPR spacer
-------gccggcgccggccaggccg	Protospacer
       ************       

30. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to position: 5034-5052, mismatch: 8, identity: 0.579

cggccaagccggcgccggc-------	CRISPR spacer
-------gccggcgccgggttgcccg	Protospacer
       ***********        

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 550101-550119 0 1.0
NZ_LNST01000193_1 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder 7450-7468 19 MN304823 Phage 65_10, complete genome 22635-22653 0 1.0

1. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 0, identity: 1.0

cggccaagccggcgccggc	CRISPR spacer
cggccaagccggcgccggc	Protospacer
*******************

2. spacer 1.1|7450|19|NZ_LNST01000193|CRISPRCasFinder matches to MN304823 (Phage 65_10, complete genome) position: , mismatch: 0, identity: 1.0

cggccaagccggcgccggc	CRISPR spacer
cggccaagccggcgccggc	Protospacer
*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_LNST01000038
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_LNST01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15977 : 22322 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_LNST01000316
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_LNST01000362
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_LNST01000489
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_LNST01000027
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000027_1 4334-7139 Orphan NA
58 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000027_2 7495-7590 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000027_3 7687-8117 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000011.1 29691-29702 1 0.917
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000222.1 2781-2792 1 0.917
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000256.1 5294-5305 1 0.917
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000305.1 1278-1289 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000032.1 14363-14374 1 0.917
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000320.1 1009-1020 1 0.917
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000320.1 3348-3359 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000321.1 4098-4109 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000325.1 2969-2980 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000429.1 625-636 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000441.1 1799-1810 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000478.1 649-660 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000489.1 609-620 2 0.833
NZ_LNST01000027_1 1.60|4622|12|NZ_LNST01000027|PILER-CR 4622-4633 12 NZ_LNST01000489.1 880-891 2 0.833

1. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 29691-29702, mismatch: 1, identity: 0.917

gcgagagttcct	CRISPR spacer
gcgagagttgct	Protospacer
********* **

2. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 2781-2792, mismatch: 1, identity: 0.917

gcgagagttcct	CRISPR spacer
gcgcgagttcct	Protospacer
*** ********

3. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 5294-5305, mismatch: 1, identity: 0.917

gcgagagttcct	CRISPR spacer
gcgcgagttcct	Protospacer
*** ********

4. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 1278-1289, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcgccagttcct	Protospacer
***  *******

5. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 14363-14374, mismatch: 1, identity: 0.917

gcgagagttcct	CRISPR spacer
gcgcgagttcct	Protospacer
*** ********

6. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 1009-1020, mismatch: 1, identity: 0.917

gcgagagttcct	CRISPR spacer
gcgacagttcct	Protospacer
**** *******

7. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 3348-3359, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcggcagttcct	Protospacer
***. *******

8. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 4098-4109, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcaacagttcct	Protospacer
**.* *******

9. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 2969-2980, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gccatagttcct	Protospacer
** * *******

10. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 625-636, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcgccagttcct	Protospacer
***  *******

11. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 1799-1810, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcgccagttcct	Protospacer
***  *******

12. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 649-660, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcgagagcgcct	Protospacer
*******. ***

13. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 609-620, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcgcaagttcct	Protospacer
*** .*******

14. spacer 1.60|4622|12|NZ_LNST01000027|PILER-CR matches to position: 880-891, mismatch: 2, identity: 0.833

gcgagagttcct	CRISPR spacer
gcggcagttcct	Protospacer
***. *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 2 0.923
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 2 0.923
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 3 0.885
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 3 0.885
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 3 0.885
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 520146-520171 3 0.885
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 17268-17293 3 0.885
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 533379-533404 3 0.885
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 222780-222805 3 0.885
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 3 0.885
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 3 0.885
NZ_LNST01000027_1 1.17|5124|26|NZ_LNST01000027|CRT 5124-5149 26 NZ_CP010682 Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence 206583-206608 3 0.885
NZ_LNST01000027_1 1.17|5124|26|NZ_LNST01000027|CRT 5124-5149 26 NZ_CP010644 Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence 206685-206710 3 0.885
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNST01000027_1 1.27|5604|26|NZ_LNST01000027|CRT 5604-5629 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNST01000027_1 1.30|5748|26|NZ_LNST01000027|CRT 5748-5773 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 370642-370667 3 0.885
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 302074-302099 3 0.885
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 267010-267035 3 0.885
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 370629-370654 3 0.885
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 140314-140339 3 0.885
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 113352-113377 3 0.885
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 3 0.885
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 546047-546072 3 0.885
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 342233-342258 3 0.885
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MT889372 Microbacterium phage Avocadoman, complete genome 23120-23144 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MT639649 Microbacterium phage Burritobowl, complete genome 23512-23536 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MN062714 Microbacterium Phage DirtyBubble, complete genome 24364-24388 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MT889389 Microbacterium phage DickRichards, complete genome 23841-23865 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MT024860 Microbacterium phage Stromboli, complete genome 24734-24758 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 281166-281190 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 766061-766085 3 0.88
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 194425-194449 3 0.88
NZ_LNST01000027_3 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder 8070-8094 25 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 328038-328062 3 0.88
NZ_LNST01000027_3 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder 8070-8094 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1960062-1960086 3 0.88
NZ_LNST01000027_3 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder 8070-8094 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1125643-1125667 3 0.88
NZ_LNST01000027_1 1.3|4452|26|NZ_LNST01000027|CRT 4452-4477 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 387646-387671 4 0.846
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 4 0.846
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 154155-154180 4 0.846
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 621505-621530 4 0.846
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 4 0.846
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 268728-268753 4 0.846
NZ_LNST01000027_1 1.10|4788|26|NZ_LNST01000027|CRT 4788-4813 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNST01000027_1 1.13|4932|26|NZ_LNST01000027|CRT 4932-4957 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 4 0.846
NZ_LNST01000027_1 1.13|4932|26|NZ_LNST01000027|CRT 4932-4957 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 4 0.846
NZ_LNST01000027_1 1.14|4980|26|NZ_LNST01000027|CRT 4980-5005 26 NZ_CP013482 Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence 48902-48927 4 0.846
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP031960 Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence 15787-15812 4 0.846
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 108240-108265 4 0.846
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 126397-126422 4 0.846
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 108237-108262 4 0.846
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 176590-176615 4 0.846
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNST01000027_1 1.18|5172|26|NZ_LNST01000027|CRT 5172-5197 26 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 265342-265367 4 0.846
NZ_LNST01000027_1 1.18|5172|26|NZ_LNST01000027|CRT 5172-5197 26 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 337760-337785 4 0.846
NZ_LNST01000027_1 1.18|5172|26|NZ_LNST01000027|CRT 5172-5197 26 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 340582-340607 4 0.846
NZ_LNST01000027_1 1.20|5268|26|NZ_LNST01000027|CRT 5268-5293 26 MN035618 Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds 390-415 4 0.846
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1260828-1260853 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNST01000027_1 1.27|5604|26|NZ_LNST01000027|CRT 5604-5629 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNST01000027_1 1.29|5700|26|NZ_LNST01000027|CRT 5700-5725 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNST01000027_1 1.29|5700|26|NZ_LNST01000027|CRT 5700-5725 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNST01000027_1 1.29|5700|26|NZ_LNST01000027|CRT 5700-5725 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNST01000027_1 1.29|5700|26|NZ_LNST01000027|CRT 5700-5725 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNST01000027_1 1.30|5748|26|NZ_LNST01000027|CRT 5748-5773 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 386159-386184 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 90478-90503 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 321672-321697 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 60637-60662 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 213942-213967 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 495119-495144 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 843111-843136 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 691120-691145 4 0.846
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 157091-157116 4 0.846
NZ_LNST01000027_1 1.32|5844|26|NZ_LNST01000027|CRT 5844-5869 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNST01000027_1 1.32|5844|26|NZ_LNST01000027|CRT 5844-5869 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNST01000027_1 1.32|5844|26|NZ_LNST01000027|CRT 5844-5869 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNST01000027_1 1.32|5844|26|NZ_LNST01000027|CRT 5844-5869 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNST01000027_1 1.35|5988|26|NZ_LNST01000027|CRT 5988-6013 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNST01000027_1 1.35|5988|26|NZ_LNST01000027|CRT 5988-6013 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNST01000027_1 1.35|5988|26|NZ_LNST01000027|CRT 5988-6013 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNST01000027_1 1.35|5988|26|NZ_LNST01000027|CRT 5988-6013 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNST01000027_1 1.36|6036|26|NZ_LNST01000027|CRT 6036-6061 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1148986-1149011 4 0.846
NZ_LNST01000027_1 1.37|6084|26|NZ_LNST01000027|CRT 6084-6109 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNST01000027_1 1.37|6084|26|NZ_LNST01000027|CRT 6084-6109 26 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 379093-379118 4 0.846
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 80122-80147 4 0.846
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 774222-774247 4 0.846
NZ_LNST01000027_1 1.39|6180|26|NZ_LNST01000027|CRT 6180-6205 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNST01000027_1 1.39|6180|26|NZ_LNST01000027|CRT 6180-6205 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNST01000027_1 1.39|6180|26|NZ_LNST01000027|CRT 6180-6205 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNST01000027_1 1.41|6276|26|NZ_LNST01000027|CRT 6276-6301 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNST01000027_1 1.41|6276|26|NZ_LNST01000027|CRT 6276-6301 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNST01000027_1 1.42|6324|26|NZ_LNST01000027|CRT 6324-6349 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNST01000027_1 1.42|6324|26|NZ_LNST01000027|CRT 6324-6349 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNST01000027_1 1.42|6324|26|NZ_LNST01000027|CRT 6324-6349 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 4 0.846
NZ_LNST01000027_1 1.44|6420|26|NZ_LNST01000027|CRT 6420-6445 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNST01000027_1 1.45|6468|26|NZ_LNST01000027|CRT 6468-6493 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNST01000027_1 1.45|6468|26|NZ_LNST01000027|CRT 6468-6493 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNST01000027_1 1.45|6468|26|NZ_LNST01000027|CRT 6468-6493 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 83523-83548 4 0.846
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 4 0.846
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1130149-1130174 4 0.846
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 987306-987331 4 0.846
NZ_LNST01000027_1 1.47|6564|26|NZ_LNST01000027|CRT 6564-6589 26 NZ_CP045406 Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence 5141-5166 4 0.846
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555871-1555896 4 0.846
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 618528-618553 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 61582-61607 4 0.846
NZ_LNST01000027_1 1.51|6756|26|NZ_LNST01000027|CRT 6756-6781 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNST01000027_1 1.51|6756|26|NZ_LNST01000027|CRT 6756-6781 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNST01000027_1 1.51|6756|26|NZ_LNST01000027|CRT 6756-6781 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNST01000027_1 1.54|6900|26|NZ_LNST01000027|CRT 6900-6925 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNST01000027_1 1.54|6900|26|NZ_LNST01000027|CRT 6900-6925 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNST01000027_1 1.54|6900|26|NZ_LNST01000027|CRT 6900-6925 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 548034-548059 4 0.846
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP007256 Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence 70971-70996 4 0.846
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 6332-6357 4 0.846
NZ_LNST01000027_1 1.57|7044|26|NZ_LNST01000027|CRT 7044-7069 26 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 436690-436715 4 0.846
NZ_LNST01000027_1 1.57|7044|26|NZ_LNST01000027|CRT 7044-7069 26 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 614174-614199 4 0.846
NZ_LNST01000027_1 1.58|7092|26|NZ_LNST01000027|CRT 7092-7117 26 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 195900-195925 4 0.846
NZ_LNST01000027_1 1.59|4559|26|NZ_LNST01000027|PILER-CR 4559-4584 26 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1493204-1493229 4 0.846
NZ_LNST01000027_1 1.59|4559|26|NZ_LNST01000027|PILER-CR 4559-4584 26 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 320062-320087 4 0.846
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 351846-351870 4 0.84
NZ_LNST01000027_3 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder 7878-7902 25 MK757446 Mycobacterium phage Candle, complete genome 9162-9186 4 0.84
NZ_LNST01000027_3 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder 7878-7902 25 KY969628 Mycobacterium phage Zenon, complete genome 9164-9188 4 0.84
NZ_LNST01000027_3 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder 7878-7902 25 MH926059 Mycobacterium phage Riparian, complete genome 8620-8644 4 0.84
NZ_LNST01000027_3 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder 7878-7902 25 JF704112 Mycobacterium phage Send513, complete sequence 9162-9186 4 0.84
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 884327-884351 4 0.84
NZ_LNST01000027_3 3.6|7974|25|NZ_LNST01000027|CRISPRCasFinder 7974-7998 25 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1379972-1379996 4 0.84
NZ_LNST01000027_3 3.6|7974|25|NZ_LNST01000027|CRISPRCasFinder 7974-7998 25 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1379950-1379974 4 0.84
NZ_LNST01000027_3 3.7|8022|25|NZ_LNST01000027|CRISPRCasFinder 8022-8046 25 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 60660-60684 4 0.84
NZ_LNST01000027_3 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder 8070-8094 25 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 19015-19039 4 0.84
NZ_LNST01000027_1 1.1|4356|26|NZ_LNST01000027|CRT 4356-4381 26 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 14156-14181 5 0.808
NZ_LNST01000027_1 1.3|4452|26|NZ_LNST01000027|CRT 4452-4477 26 NZ_CP047178 Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence 11775-11800 5 0.808
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 9301-9326 5 0.808
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 45532-45557 5 0.808
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 53542-53567 5 0.808
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 58047-58072 5 0.808
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 67068-67093 5 0.808
NZ_LNST01000027_1 1.5|4548|26|NZ_LNST01000027|CRT 4548-4573 26 NC_015057 Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence 208837-208862 5 0.808
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNST01000027_1 1.7|4644|26|NZ_LNST01000027|CRT 4644-4669 26 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 294347-294372 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 899336-899361 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 295595-295620 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 501105-501130 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 158361-158386 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 MF375456 Xanthomonas phage phi Xc10, complete genome 25609-25634 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NC_030937 Xanthomonas phage f30-Xaj, complete genome 11639-11664 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 MK903278 Xanthomonas phage Pagan, complete genome 25833-25858 5 0.808
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 NC_030928 Xanthomonas phage f20-Xaj, complete genome 25560-25585 5 0.808
NZ_LNST01000027_1 1.10|4788|26|NZ_LNST01000027|CRT 4788-4813 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.10|4788|26|NZ_LNST01000027|CRT 4788-4813 26 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 269956-269981 5 0.808
NZ_LNST01000027_1 1.10|4788|26|NZ_LNST01000027|CRT 4788-4813 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.12|4884|26|NZ_LNST01000027|CRT 4884-4909 26 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 595383-595408 5 0.808
NZ_LNST01000027_1 1.12|4884|26|NZ_LNST01000027|CRT 4884-4909 26 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 180300-180325 5 0.808
NZ_LNST01000027_1 1.13|4932|26|NZ_LNST01000027|CRT 4932-4957 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 5 0.808
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 134799-134824 5 0.808
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 4571-4596 5 0.808
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 5 0.808
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4359911-4359936 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNST01000027_1 1.29|5700|26|NZ_LNST01000027|CRT 5700-5725 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNST01000027_1 1.31|5796|26|NZ_LNST01000027|CRT 5796-5821 26 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 6045-6070 5 0.808
NZ_LNST01000027_1 1.32|5844|26|NZ_LNST01000027|CRT 5844-5869 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNST01000027_1 1.35|5988|26|NZ_LNST01000027|CRT 5988-6013 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNST01000027_1 1.37|6084|26|NZ_LNST01000027|CRT 6084-6109 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNST01000027_1 1.39|6180|26|NZ_LNST01000027|CRT 6180-6205 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNST01000027_1 1.39|6180|26|NZ_LNST01000027|CRT 6180-6205 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNST01000027_1 1.41|6276|26|NZ_LNST01000027|CRT 6276-6301 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 5 0.808
NZ_LNST01000027_1 1.42|6324|26|NZ_LNST01000027|CRT 6324-6349 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 5 0.808
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 5 0.808
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNST01000027_1 1.44|6420|26|NZ_LNST01000027|CRT 6420-6445 26 NZ_CP035502 Sphingosinicella sp. BN140058 plasmid p1, complete sequence 159356-159381 5 0.808
NZ_LNST01000027_1 1.44|6420|26|NZ_LNST01000027|CRT 6420-6445 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNST01000027_1 1.44|6420|26|NZ_LNST01000027|CRT 6420-6445 26 MT498057 Microbacterium phage Cicada, complete genome 22953-22978 5 0.808
NZ_LNST01000027_1 1.45|6468|26|NZ_LNST01000027|CRT 6468-6493 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNST01000027_1 1.45|6468|26|NZ_LNST01000027|CRT 6468-6493 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1389298-1389323 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 299573-299598 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_CP022416 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence 228968-228993 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 26605-26630 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 224229-224254 5 0.808
NZ_LNST01000027_1 1.46|6516|26|NZ_LNST01000027|CRT 6516-6541 26 MK376351 Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence 57727-57752 5 0.808
NZ_LNST01000027_1 1.47|6564|26|NZ_LNST01000027|CRT 6564-6589 26 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 102633-102658 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1839450-1839475 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 754600-754625 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 752536-752561 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1171297-1171322 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 849514-849539 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 803210-803235 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 899399-899424 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 751676-751701 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP021043 Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence 8997-9022 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 649783-649808 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 717478-717503 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP010676 Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence 8986-9011 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 874639-874664 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NC_023139 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence 9144-9169 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1171426-1171451 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 899391-899416 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 630477-630502 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 667645-667670 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1226801-1226826 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 899406-899431 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 791469-791494 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 234551-234576 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 878985-879010 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 725022-725047 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1202238-1202263 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 806702-806727 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 706034-706059 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 648898-648923 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 651732-651757 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 651722-651747 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 805303-805328 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 992401-992426 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1171031-1171056 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 649771-649796 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 649789-649814 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 649768-649793 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 277028-277053 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1182790-1182815 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 132453-132478 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 878974-878999 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 992368-992393 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 992369-992394 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1170976-1171001 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 773107-773132 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 659609-659634 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1158931-1158956 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 807848-807873 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 788541-788566 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 842775-842800 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 879657-879682 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1271951-1271976 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 925031-925056 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 992367-992392 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 913217-913242 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 992393-992418 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP010591 Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence 8986-9011 5 0.808
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 754650-754675 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNST01000027_1 1.50|6708|26|NZ_LNST01000027|CRT 6708-6733 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNST01000027_1 1.51|6756|26|NZ_LNST01000027|CRT 6756-6781 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_KX426227 Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence 168483-168508 5 0.808
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 CP033569 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence 150546-150571 5 0.808
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 318096-318121 5 0.808
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_CP029396 Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence 308932-308957 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 5 0.808
NZ_LNST01000027_1 1.53|6852|26|NZ_LNST01000027|CRT 6852-6877 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 5 0.808
NZ_LNST01000027_1 1.54|6900|26|NZ_LNST01000027|CRT 6900-6925 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 4813-4838 5 0.808
NZ_LNST01000027_1 1.55|6948|26|NZ_LNST01000027|CRT 6948-6973 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 114089-114114 5 0.808
NZ_LNST01000027_1 1.58|7092|26|NZ_LNST01000027|CRT 7092-7117 26 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 33473-33498 5 0.808
NZ_LNST01000027_1 1.58|7092|26|NZ_LNST01000027|CRT 7092-7117 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 146106-146131 5 0.808
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5288431-5288455 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 15910-15934 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 68354-68378 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 528593-528617 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 409238-409262 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 MN444870 Gordonia phage Syleon, complete genome 28799-28823 5 0.8
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 MH976515 Gordonia phage Octobien14, complete genome 29393-29417 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MH727545 Mycobacterium phage DismalStressor, complete genome 39161-39185 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NC_026598 Mycobacterium phage Milly, complete genome 39134-39158 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MH834601 Mycobacterium phage BoostSeason, complete genome 38730-38754 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 KX688047 Mycobacterium phage Marcoliusprime, complete genome 39161-39185 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 NC_028759 Mycobacterium phage Mufasa, complete genome 38715-38739 5 0.8
NZ_LNST01000027_3 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder 7926-7950 25 MF140408 Mycobacterium phage DismalFunk, complete genome 39161-39185 5 0.8
NZ_LNST01000027_1 1.8|4692|26|NZ_LNST01000027|CRT 4692-4717 26 MN585989 Mycobacterium phage Superchunk, complete genome 5292-5317 6 0.769
NZ_LNST01000027_1 1.10|4788|26|NZ_LNST01000027|CRT 4788-4813 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNST01000027_1 1.11|4836|26|NZ_LNST01000027|CRT 4836-4861 26 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 352474-352499 6 0.769
NZ_LNST01000027_1 1.11|4836|26|NZ_LNST01000027|CRT 4836-4861 26 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 352461-352486 6 0.769
NZ_LNST01000027_1 1.12|4884|26|NZ_LNST01000027|CRT 4884-4909 26 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 168561-168586 6 0.769
NZ_LNST01000027_1 1.12|4884|26|NZ_LNST01000027|CRT 4884-4909 26 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 168561-168586 6 0.769
NZ_LNST01000027_1 1.14|4980|26|NZ_LNST01000027|CRT 4980-5005 26 CP000618 Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence 44311-44336 6 0.769
NZ_LNST01000027_1 1.15|5028|26|NZ_LNST01000027|CRT 5028-5053 26 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 91995-92020 6 0.769
NZ_LNST01000027_1 1.16|5076|26|NZ_LNST01000027|CRT 5076-5101 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 6 0.769
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 481667-481692 6 0.769
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 436572-436597 6 0.769
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 481703-481728 6 0.769
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 481702-481727 6 0.769
NZ_LNST01000027_1 1.23|5412|26|NZ_LNST01000027|CRT 5412-5437 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 481694-481719 6 0.769
NZ_LNST01000027_1 1.25|5508|26|NZ_LNST01000027|CRT 5508-5533 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNST01000027_1 1.28|5652|26|NZ_LNST01000027|CRT 5652-5677 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNST01000027_1 1.34|5940|26|NZ_LNST01000027|CRT 5940-5965 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNST01000027_1 1.36|6036|26|NZ_LNST01000027|CRT 6036-6061 26 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 593315-593340 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 NC_016591 Burkholderia sp. YI23 plasmid byi_2p, complete sequence 124119-124144 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 CP000617 Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence 313274-313299 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555147 Caulobacter phage Ccr34, complete genome 28484-28509 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555145 Caulobacter phage Ccr29, complete genome 31131-31156 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555143 Caulobacter phage Ccr2, complete genome 28964-28989 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555146 Caulobacter phage Ccr32, complete genome 28485-28510 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555144 Caulobacter phage Ccr5, complete genome 28359-28384 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 JX163858 Caulobacter phage phiCbK, complete genome 179347-179372 6 0.769
NZ_LNST01000027_1 1.38|6132|26|NZ_LNST01000027|CRT 6132-6157 26 KY555142 Caulobacter phage Ccr10, complete genome 28489-28514 6 0.769
NZ_LNST01000027_1 1.40|6228|26|NZ_LNST01000027|CRT 6228-6253 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 6 0.769
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNST01000027_1 1.43|6372|26|NZ_LNST01000027|CRT 6372-6397 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 6 0.769
NZ_LNST01000027_1 1.48|6612|26|NZ_LNST01000027|CRT 6612-6637 26 NZ_CP020717 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence 21091-21116 6 0.769
NZ_LNST01000027_1 1.49|6660|26|NZ_LNST01000027|CRT 6660-6685 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 64151-64176 6 0.769
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 NC_019408 Caulobacter phage CcrRogue, complete genome 64287-64311 6 0.76
NZ_LNST01000027_3 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder 7830-7854 25 MT684599 Gordonia Phage Sephiroth, complete genome 28877-28901 6 0.76
NZ_LNST01000027_3 3.7|8022|25|NZ_LNST01000027|CRISPRCasFinder 8022-8046 25 NZ_CP022581 Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence 8354-8378 6 0.76
NZ_LNST01000027_1 1.4|4500|26|NZ_LNST01000027|CRT 4500-4525 26 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 103494-103519 7 0.731
NZ_LNST01000027_1 1.52|6804|26|NZ_LNST01000027|CRT 6804-6829 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 135275-135300 7 0.731

1. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

2. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

3. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.******************

4. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

5. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

6. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

7. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

8. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

9. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

10. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

11. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

12. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

13. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

14. spacer 1.17|5124|26|NZ_LNST01000027|CRT matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 3, identity: 0.885

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

15. spacer 1.17|5124|26|NZ_LNST01000027|CRT matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 3, identity: 0.885

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

16. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

17. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

18. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

19. spacer 1.27|5604|26|NZ_LNST01000027|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** ** 

20. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.******* 

21. spacer 1.30|5748|26|NZ_LNST01000027|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** ** 

22. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

23. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

24. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

25. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

26. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.******* 

27. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 3, identity: 0.885

cgcg-ggcgcggacagcaccttgatcg	CRISPR spacer
-gcgcggcgaggacagcaccttgatct	Protospacer
 *** **** **************** 

28. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

29. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

30. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

31. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
ctcgcgccagggcaccgacatgaccg	Protospacer
* ***** ****** ***********

32. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

33. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

34. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

35. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
************* ********  **

36. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 3, identity: 0.885

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcacaacagggcagcgacatcaccg	Protospacer
 ****..*******************

37. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcagcagggcagcgacatcaccg	Protospacer
 **.*.********************

38. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MT889372 (Microbacterium phage Avocadoman, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

39. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MT639649 (Microbacterium phage Burritobowl, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

40. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

41. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MT889389 (Microbacterium phage DickRichards, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

42. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

43. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

44. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

45. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gttgctcgcgggcgccgaaagcacc	Protospacer
*.** ************* ******

46. spacer 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
cctgaacgccggcaagtacagcgtg	Protospacer
 **** ********** ********

47. spacer 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

48. spacer 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

49. spacer 1.3|4452|26|NZ_LNST01000027|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
tgccgcggtcgggagcacgctcacgc	Protospacer
******** *.*************  

50. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** *.

51. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cctgcgcaagggcagctacaacaccg	Protospacer
* .************* *** *****

52. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
catgcgcaagggcagcgacaacgccg	Protospacer
*..***************** *.***

53. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
*.***** *.***************.

54. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggacagcgggtcgagca	Protospacer
***************** **.** *.

55. spacer 1.10|4788|26|NZ_LNST01000027|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

56. spacer 1.13|4932|26|NZ_LNST01000027|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

57. spacer 1.13|4932|26|NZ_LNST01000027|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

58. spacer 1.14|4980|26|NZ_LNST01000027|CRT matches to NZ_CP013482 (Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence) position: , mismatch: 4, identity: 0.846

tgccggtgcggacagcacgctgatcg	CRISPR spacer
tgccggcgcggccagcacgctgaggg	Protospacer
******.**** ***********  *

59. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP031960 (Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

60. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

61. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

62. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

63. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

64. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.****************.*

65. spacer 1.18|5172|26|NZ_LNST01000027|CRT matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

66. spacer 1.18|5172|26|NZ_LNST01000027|CRT matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

67. spacer 1.18|5172|26|NZ_LNST01000027|CRT matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

68. spacer 1.20|5268|26|NZ_LNST01000027|CRT matches to MN035618 (Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds) position: , mismatch: 4, identity: 0.846

ggcgggtcacgacagttcgctgatcg	CRISPR spacer
ggtttgtcacgacagctcgctgatcg	Protospacer
**.  **********.**********

69. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggtgccgacagtacgctgatcg	CRISPR spacer
cctcggtgccgatggtacgctgatcg	Protospacer
* .*********..************

70. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

71. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

72. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

73. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

74. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

75. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

76. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

77. spacer 1.27|5604|26|NZ_LNST01000027|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

78. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

79. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

80. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

81. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

82. spacer 1.29|5700|26|NZ_LNST01000027|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

83. spacer 1.29|5700|26|NZ_LNST01000027|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

84. spacer 1.29|5700|26|NZ_LNST01000027|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

85. spacer 1.29|5700|26|NZ_LNST01000027|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

86. spacer 1.30|5748|26|NZ_LNST01000027|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

87. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

88. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

89. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

90. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

91. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

92. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

93. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
ccagcgcaccggcagcgatgtcaccg	Protospacer
*  *****  ****************

94. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
caggcgcaagggcatcgatgtctccg	Protospacer
*. *********** ******* ***

95. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
cgcgcgcaagggcagcgatctggacg	Protospacer
******************* * . **

96. spacer 1.32|5844|26|NZ_LNST01000027|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

97. spacer 1.32|5844|26|NZ_LNST01000027|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

98. spacer 1.32|5844|26|NZ_LNST01000027|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

99. spacer 1.32|5844|26|NZ_LNST01000027|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

100. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

101. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

102. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

103. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

104. spacer 1.35|5988|26|NZ_LNST01000027|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

105. spacer 1.35|5988|26|NZ_LNST01000027|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

106. spacer 1.35|5988|26|NZ_LNST01000027|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

107. spacer 1.35|5988|26|NZ_LNST01000027|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

108. spacer 1.36|6036|26|NZ_LNST01000027|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggacagcgacagttcgcggacgg	Protospacer
 .***.************** *****

109. spacer 1.37|6084|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.*************.****

110. spacer 1.37|6084|26|NZ_LNST01000027|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
catgcgcaagggcagcgacaatgccg	Protospacer
*..***************** *.***

111. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ctgggccgcgtacagcaccttgatcg	Protospacer
*  ** **** ***************

112. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

113. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ggggcgcgcgaacagcaccttgatcg	Protospacer
 * * *****.***************

114. spacer 1.39|6180|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

115. spacer 1.39|6180|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

116. spacer 1.39|6180|26|NZ_LNST01000027|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

117. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

118. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

119. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

120. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

121. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

122. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

123. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

124. spacer 1.41|6276|26|NZ_LNST01000027|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

125. spacer 1.41|6276|26|NZ_LNST01000027|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

126. spacer 1.42|6324|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

127. spacer 1.42|6324|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

128. spacer 1.42|6324|26|NZ_LNST01000027|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

129. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 4, identity: 0.846

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
.******.*********.******* 

130. spacer 1.44|6420|26|NZ_LNST01000027|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

131. spacer 1.45|6468|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

132. spacer 1.45|6468|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

133. spacer 1.45|6468|26|NZ_LNST01000027|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

134. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gtcgcgcaagggcagcgacacggccg	Protospacer
  ******************.*.***

135. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******* .*.

136. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.************* ****

137. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.* 

138. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.* 

139. spacer 1.47|6564|26|NZ_LNST01000027|CRT matches to NZ_CP045406 (Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggttatcaccttgatgc	Protospacer
*********** ** *********  

140. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.846

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

141. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.846

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

142. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

143. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

144. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

145. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

146. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

147. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

148. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

149. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  **

150. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ****************** 

151. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

152. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

153. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

154. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

155. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

156. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

157. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ****************** 

158. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

159. spacer 1.51|6756|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

160. spacer 1.51|6756|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

161. spacer 1.51|6756|26|NZ_LNST01000027|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

162. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
.* ****** **** ***********

163. spacer 1.54|6900|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

164. spacer 1.54|6900|26|NZ_LNST01000027|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

165. spacer 1.54|6900|26|NZ_LNST01000027|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

166. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

167. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP007256 (Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

168. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
gcaacggctgggcagcgacaacaccg	Protospacer
*  ***** *********** *****

169. spacer 1.57|7044|26|NZ_LNST01000027|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgcctacgacagcaacctcatca	Protospacer
***** *****************...

170. spacer 1.57|7044|26|NZ_LNST01000027|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgactacgacagcgacctcacca	Protospacer
*****.**********.*******..

171. spacer 1.58|7092|26|NZ_LNST01000027|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
cgtgcgcgaggacagcgcgctcaccg	Protospacer
 *.************* *******.*

172. spacer 1.59|4559|26|NZ_LNST01000027|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.846

tgcgaccagcggttctgacagcgcgg	CRISPR spacer
ggagaccagcggttcccacagcgcgg	Protospacer
 * ************. *********

173. spacer 1.59|4559|26|NZ_LNST01000027|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.846

tgcgaccagcggttctgacagcgcgg	CRISPR spacer
ggagaccagcggttcccacagcgcgg	Protospacer
 * ************. *********

174. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagtcag	Protospacer
****** ***************.  

175. spacer 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder matches to MK757446 (Mycobacterium phage Candle, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

176. spacer 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder matches to KY969628 (Mycobacterium phage Zenon, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

177. spacer 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder matches to MH926059 (Mycobacterium phage Riparian, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

178. spacer 3.4|7878|25|NZ_LNST01000027|CRISPRCasFinder matches to JF704112 (Mycobacterium phage Send513, complete sequence) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

179. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgtgatcgcggtcgccgacagcagc	Protospacer
  ********* *********** *

180. spacer 3.6|7974|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

181. spacer 3.6|7974|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

182. spacer 3.7|8022|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcgacgacagtacg	CRISPR spacer
gctgcccgccggcgacgaccgtaaa	Protospacer
**** ************** *** .

183. spacer 3.8|8070|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcaagaacagcgtg	CRISPR spacer
gctgaccgcgggcaagaacatcgaa	Protospacer
********* ********** ** .

184. spacer 1.1|4356|26|NZ_LNST01000027|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 5, identity: 0.808

cgcaggcgatcacagcgatctgatcg	CRISPR spacer
cgcaggcgatcacaacgatctggcga	Protospacer
**************.*******.. .

185. spacer 1.3|4452|26|NZ_LNST01000027|CRT matches to NZ_CP047178 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
ttccgcggacaggagcacgctcatgt	Protospacer
* ******.**************.  

186. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

187. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

188. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

189. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

190. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

191. spacer 1.5|4548|26|NZ_LNST01000027|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 5, identity: 0.808

cagcggttctgacagcgcggtgatct	CRISPR spacer
cagcggttctgacagctccgtgactc	Protospacer
**************** * ****...

192. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

193. spacer 1.7|4644|26|NZ_LNST01000027|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
ttggcgcaaggacagcggcatcaccg	Protospacer
.  ********.*****.********

194. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

195. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcgtgcagcc	Protospacer
 *******************  * * 

196. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

197. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

198. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to MF375456 (Xanthomonas phage phi Xc10, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

199. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

200. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to MK903278 (Xanthomonas phage Pagan, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

201. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

202. spacer 1.10|4788|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

203. spacer 1.10|4788|26|NZ_LNST01000027|CRT matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
tcgacgcaacggcagcgacgttaccg	Protospacer
.  ****** ***********.****

204. spacer 1.10|4788|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

205. spacer 1.12|4884|26|NZ_LNST01000027|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

206. spacer 1.12|4884|26|NZ_LNST01000027|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

207. spacer 1.13|4932|26|NZ_LNST01000027|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
 .**** ***********.******.

208. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.808

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ctcggacagcgacagctcgctttgcg	Protospacer
*****.***************    *

209. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ctcgggcagcgacagctcgctgacag	CRISPR spacer
tacggtcagcgacacctcgctgacat	Protospacer
. *** ******** ********** 

210. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** ..

211. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808

cgccggtgccgacagtacgctgatcg	CRISPR spacer
gttcggtgccgacaggacgccgatcg	Protospacer
  .************ ****.*****

212. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

213. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

214. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

215. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

216. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

217. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

218. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

219. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

220. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

221. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

222. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

223. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

224. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

225. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

226. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

227. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

228. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

229. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

230. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

231. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

232. spacer 1.29|5700|26|NZ_LNST01000027|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

233. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

234. spacer 1.31|5796|26|NZ_LNST01000027|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tacgcgccagggcatcgatgtcacca	Protospacer
..***** ****** **********.

235. spacer 1.32|5844|26|NZ_LNST01000027|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

236. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

237. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

238. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

239. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

240. spacer 1.35|5988|26|NZ_LNST01000027|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

241. spacer 1.37|6084|26|NZ_LNST01000027|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

242. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

243. spacer 1.39|6180|26|NZ_LNST01000027|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

244. spacer 1.39|6180|26|NZ_LNST01000027|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

245. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

246. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

247. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

248. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

249. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

250. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

251. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

252. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

253. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

254. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

255. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

256. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

257. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

258. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

259. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

260. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

261. spacer 1.41|6276|26|NZ_LNST01000027|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgggcgcggacagcaccctgatct	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  * 

262. spacer 1.42|6324|26|NZ_LNST01000027|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

263. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
.. ****.***********.******

264. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
. * *** *****************.

265. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

266. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
. .************* *** *****

267. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

268. spacer 1.44|6420|26|NZ_LNST01000027|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
tttggctgcggacagccccttgatcg	Protospacer
. .** ********** *********

269. spacer 1.44|6420|26|NZ_LNST01000027|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

270. spacer 1.44|6420|26|NZ_LNST01000027|CRT matches to MT498057 (Microbacterium phage Cicada, complete genome) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
ggcgggtgcggaaagcacctcgatgt	Protospacer
 *********** *******.***  

271. spacer 1.45|6468|26|NZ_LNST01000027|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

272. spacer 1.45|6468|26|NZ_LNST01000027|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

273. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gaagcgcacgggcagcgacatgagcg	Protospacer
 . ***** ************** **

274. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

275. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

276. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

277. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

278. spacer 1.46|6516|26|NZ_LNST01000027|CRT matches to MK376351 (Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

279. spacer 1.47|6564|26|NZ_LNST01000027|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggatagcaccgggcctg	Protospacer
*******************  * ..*

280. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

281. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

282. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

283. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

284. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

285. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

286. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

287. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

288. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP021043 (Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

289. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

290. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

291. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP010676 (Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

292. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

293. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NC_023139 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

294. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

295. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

296. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

297. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

298. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

299. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

300. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

301. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

302. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

303. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

304. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

305. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

306. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

307. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

308. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

309. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

310. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

311. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

312. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

313. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

314. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

315. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

316. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

317. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

318. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
atccggcagcgacggctcggtgacca	Protospacer
.************.***** **** .

319. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

320. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

321. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

322. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

323. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

324. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

325. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

326. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

327. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

328. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

329. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

330. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

331. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

332. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

333. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

334. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

335. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

336. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

337. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

338. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

339. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

340. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

341. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

342. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

343. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

344. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

345. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

346. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

347. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

348. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

349. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

350. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

351. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

352. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

353. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

354. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

355. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP010591 (Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

356. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

357. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

358. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

359. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

360. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

361. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

362. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

363. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

364. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

365. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

366. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

367. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

368. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

369. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

370. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

371. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

372. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

373. spacer 1.50|6708|26|NZ_LNST01000027|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
  .**** ***************.**

374. spacer 1.51|6756|26|NZ_LNST01000027|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

375. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

376. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to CP033569 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

377. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
  * ** ******************.

378. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

379. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_CP029396 (Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

380. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
. .**** ***************.**

381. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ****************** 

382. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

383. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

384. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

385. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

386. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

387. spacer 1.53|6852|26|NZ_LNST01000027|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ****************** 

388. spacer 1.54|6900|26|NZ_LNST01000027|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

389. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

390. spacer 1.55|6948|26|NZ_LNST01000027|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

391. spacer 1.58|7092|26|NZ_LNST01000027|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgaggacagcacgctggccc	Protospacer
**************** **** .*. 

392. spacer 1.58|7092|26|NZ_LNST01000027|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgtggacagctcgcttgcgc	Protospacer
******** ************..*  

393. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggtgatcgcgggcaagggcagggcg	Protospacer
* *******************  . 

394. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatctcgggcaagggcagcacg	Protospacer
******* *************. . 

395. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagccag	Protospacer
****** **************..  

396. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cgtgatcgcgggcaatggcagttct	Protospacer
  ************* *******..

397. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggagatcgcgggcaagggcagtcat	Protospacer
*  *******************. .

398. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to MN444870 (Gordonia phage Syleon, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

399. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

400. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

401. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

402. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

403. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

404. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

405. spacer 3.5|7926|25|NZ_LNST01000027|CRISPRCasFinder matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

406. spacer 1.8|4692|26|NZ_LNST01000027|CRT matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 6, identity: 0.769

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
gcgtcggtcggacagcgcgttgatgt	Protospacer
*  . *******************  

407. spacer 1.10|4788|26|NZ_LNST01000027|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

408. spacer 1.11|4836|26|NZ_LNST01000027|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 6, identity: 0.769

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

409. spacer 1.11|4836|26|NZ_LNST01000027|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 6, identity: 0.769

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

410. spacer 1.12|4884|26|NZ_LNST01000027|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.769

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

411. spacer 1.12|4884|26|NZ_LNST01000027|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.769

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

412. spacer 1.14|4980|26|NZ_LNST01000027|CRT matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 6, identity: 0.769

tgccggtgcggacagcacgctgatcg	CRISPR spacer
gagcggtgcggccagcacgctgatgt	Protospacer
 . ******** ************  

413. spacer 1.15|5028|26|NZ_LNST01000027|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ttcgggcagcgacagctcgcggcgct	Protospacer
.******************* *    

414. spacer 1.16|5076|26|NZ_LNST01000027|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  ...

415. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

416. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

417. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

418. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

419. spacer 1.23|5412|26|NZ_LNST01000027|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

420. spacer 1.25|5508|26|NZ_LNST01000027|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

421. spacer 1.28|5652|26|NZ_LNST01000027|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

422. spacer 1.34|5940|26|NZ_LNST01000027|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

423. spacer 1.36|6036|26|NZ_LNST01000027|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.769

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggccagcgacagttcgctgagct	Protospacer
 .*** *****************   

424. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

425. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

426. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

427. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

428. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

429. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

430. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

431. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

432. spacer 1.38|6132|26|NZ_LNST01000027|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

433. spacer 1.40|6228|26|NZ_LNST01000027|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

434. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

435. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

436. spacer 1.43|6372|26|NZ_LNST01000027|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

437. spacer 1.48|6612|26|NZ_LNST01000027|CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.769

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caacggcagcgacaactcgctgacca	Protospacer
   ***********.********* .

438. spacer 1.49|6660|26|NZ_LNST01000027|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

439. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.769

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
gttcgtccagggcagcgacgtcaccg	Protospacer
* .    *******************

440. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cctgatcgcgggcaagggcaaggaa	Protospacer
 *******************.    

441. spacer 3.3|7830|25|NZ_LNST01000027|CRISPRCasFinder matches to MT684599 (Gordonia Phage Sephiroth, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgca	Protospacer
******************* .. . 

442. spacer 3.7|8022|25|NZ_LNST01000027|CRISPRCasFinder matches to NZ_CP022581 (Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence) position: , mismatch: 6, identity: 0.76

gctgaccgccggcgacgacagtacg	CRISPR spacer
cctgaccgccggcgacgacacgggc	Protospacer
 *******************  .  

443. spacer 1.4|4500|26|NZ_LNST01000027|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.731

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggcagccgtcgggtaa	Protospacer
.*******************  ..  

444. spacer 1.52|6804|26|NZ_LNST01000027|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.731

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
attcatccagggcagcgacgtcaccg	Protospacer
. .    *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_LNST01000478
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
23. NZ_LNST01000138
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_LNST01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
25. NZ_LNST01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
26. NZ_LNST01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
27. NZ_LNST01000011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000011_1 4788-9099 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNST01000011_1 1.1|4819|35|NZ_LNST01000011|CRISPRCasFinder,CRT 4819-4853 35 NZ_LNST01000004.1 13098-13132 1 0.971
NZ_LNST01000011_1 1.2|4885|33|NZ_LNST01000011|CRISPRCasFinder,CRT 4885-4917 33 NZ_LNST01000004.1 17925-17957 0 1.0
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_LNST01000004.1 37683-37716 0 1.0
NZ_LNST01000011_1 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder 6001-6034 34 NZ_LNST01000004.1 34225-34258 0 1.0
NZ_LNST01000011_1 1.21|6132|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6132-6166 35 NZ_LNST01000004.1 31907-31941 0 1.0
NZ_LNST01000011_1 1.66|4886|33|NZ_LNST01000011|PILER-CR 4886-4918 33 NZ_LNST01000004.1 17925-17957 0 1.0
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_LNST01000004.1 37683-37716 0 1.0
NZ_LNST01000011_1 1.83|6018|34|NZ_LNST01000011|PILER-CR 6018-6051 34 NZ_LNST01000004.1 34225-34258 0 1.0
NZ_LNST01000011_1 1.85|6151|35|NZ_LNST01000011|PILER-CR 6151-6185 35 NZ_LNST01000004.1 31907-31941 0 1.0

1. spacer 1.1|4819|35|NZ_LNST01000011|CRISPRCasFinder,CRT matches to position: 13098-13132, mismatch: 1, identity: 0.971

gatgtcgagtggcgccgggacgacatggcatgggt	CRISPR spacer
gatgtcgagtggcgccgggacgacatggcttgggt	Protospacer
***************************** *****

2. spacer 1.2|4885|33|NZ_LNST01000011|CRISPRCasFinder,CRT matches to position: 17925-17957, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

3. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to position: 37683-37716, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

4. spacer 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to position: 34225-34258, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

5. spacer 1.21|6132|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to position: 31907-31941, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

6. spacer 1.66|4886|33|NZ_LNST01000011|PILER-CR matches to position: 17925-17957, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

7. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to position: 37683-37716, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

8. spacer 1.83|6018|34|NZ_LNST01000011|PILER-CR matches to position: 34225-34258, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

9. spacer 1.85|6151|35|NZ_LNST01000011|PILER-CR matches to position: 31907-31941, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNST01000011_1 1.36|7126|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7126-7159 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNST01000011_1 1.36|7126|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7126-7159 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNST01000011_1 1.100|7160|34|NZ_LNST01000011|PILER-CR 7160-7193 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNST01000011_1 1.100|7160|34|NZ_LNST01000011|PILER-CR 7160-7193 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNST01000011_1 1.49|7980|36|NZ_LNST01000011|CRT,CRISPRCasFinder 7980-8015 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNST01000011_1 1.49|7980|36|NZ_LNST01000011|CRT,CRISPRCasFinder 7980-8015 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNST01000011_1 1.113|8027|36|NZ_LNST01000011|PILER-CR 8027-8062 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNST01000011_1 1.113|8027|36|NZ_LNST01000011|PILER-CR 8027-8062 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNST01000011_1 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7586-7619 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNST01000011_1 1.107|7627|34|NZ_LNST01000011|PILER-CR 7627-7660 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNST01000011_1 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7586-7619 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNST01000011_1 1.107|7627|34|NZ_LNST01000011|PILER-CR 7627-7660 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNST01000011_1 1.9|5347|35|NZ_LNST01000011|CRT,CRISPRCasFinder 5347-5381 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNST01000011_1 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7586-7619 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNST01000011_1 1.73|5354|35|NZ_LNST01000011|PILER-CR 5354-5388 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNST01000011_1 1.107|7627|34|NZ_LNST01000011|PILER-CR 7627-7660 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNST01000011_1 1.20|6066|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6066-6100 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNST01000011_1 1.84|6084|35|NZ_LNST01000011|PILER-CR 6084-6118 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNST01000011_1 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder 5479-5512 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNST01000011_1 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder 5479-5512 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNST01000011_1 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder 5479-5512 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNST01000011_1 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder 5479-5512 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNST01000011_1 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6399-6433 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNST01000011_1 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6399-6433 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNST01000011_1 1.75|5488|34|NZ_LNST01000011|PILER-CR 5488-5521 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNST01000011_1 1.75|5488|34|NZ_LNST01000011|PILER-CR 5488-5521 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNST01000011_1 1.75|5488|34|NZ_LNST01000011|PILER-CR 5488-5521 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNST01000011_1 1.75|5488|34|NZ_LNST01000011|PILER-CR 5488-5521 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNST01000011_1 1.89|6422|35|NZ_LNST01000011|PILER-CR 6422-6456 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNST01000011_1 1.89|6422|35|NZ_LNST01000011|PILER-CR 6422-6456 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNST01000011_1 1.18|5934|36|NZ_LNST01000011|CRT,CRISPRCasFinder 5934-5969 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNST01000011_1 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder 6001-6034 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNST01000011_1 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder 6001-6034 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNST01000011_1 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder 6001-6034 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNST01000011_1 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6198-6232 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNST01000011_1 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6532-6566 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNST01000011_1 1.39|7323|35|NZ_LNST01000011|CRT,CRISPRCasFinder 7323-7357 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNST01000011_1 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7718-7751 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNST01000011_1 1.82|5950|36|NZ_LNST01000011|PILER-CR 5950-5985 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNST01000011_1 1.83|6018|34|NZ_LNST01000011|PILER-CR 6018-6051 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNST01000011_1 1.83|6018|34|NZ_LNST01000011|PILER-CR 6018-6051 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNST01000011_1 1.83|6018|34|NZ_LNST01000011|PILER-CR 6018-6051 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNST01000011_1 1.86|6218|35|NZ_LNST01000011|PILER-CR 6218-6252 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNST01000011_1 1.91|6557|35|NZ_LNST01000011|PILER-CR 6557-6591 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNST01000011_1 1.103|7360|35|NZ_LNST01000011|PILER-CR 7360-7394 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNST01000011_1 1.109|7761|34|NZ_LNST01000011|PILER-CR 7761-7794 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNST01000011_1 1.16|5806|33|NZ_LNST01000011|CRT,CRISPRCasFinder 5806-5838 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNST01000011_1 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder 6001-6034 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNST01000011_1 1.21|6132|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6132-6166 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNST01000011_1 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6198-6232 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNST01000011_1 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7718-7751 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNST01000011_1 1.47|7848|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7848-7881 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNST01000011_1 1.47|7848|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7848-7881 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNST01000011_1 1.57|8513|34|NZ_LNST01000011|CRT,CRISPRCasFinder 8513-8546 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNST01000011_1 1.80|5820|33|NZ_LNST01000011|PILER-CR 5820-5852 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNST01000011_1 1.83|6018|34|NZ_LNST01000011|PILER-CR 6018-6051 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNST01000011_1 1.85|6151|35|NZ_LNST01000011|PILER-CR 6151-6185 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNST01000011_1 1.86|6218|35|NZ_LNST01000011|PILER-CR 6218-6252 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNST01000011_1 1.109|7761|34|NZ_LNST01000011|PILER-CR 7761-7794 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNST01000011_1 1.111|7893|34|NZ_LNST01000011|PILER-CR 7893-7926 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNST01000011_1 1.111|7893|34|NZ_LNST01000011|PILER-CR 7893-7926 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNST01000011_1 1.121|8568|34|NZ_LNST01000011|PILER-CR 8568-8601 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNST01000011_1 1.18|5934|36|NZ_LNST01000011|CRT,CRISPRCasFinder 5934-5969 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNST01000011_1 1.24|6331|37|NZ_LNST01000011|CRT,CRISPRCasFinder 6331-6367 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNST01000011_1 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6399-6433 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNST01000011_1 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7191-7224 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNST01000011_1 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7191-7224 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNST01000011_1 1.52|8181|35|NZ_LNST01000011|CRT,CRISPRCasFinder 8181-8215 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNST01000011_1 1.52|8181|35|NZ_LNST01000011|CRT,CRISPRCasFinder 8181-8215 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNST01000011_1 1.57|8513|34|NZ_LNST01000011|CRT,CRISPRCasFinder 8513-8546 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNST01000011_1 1.82|5950|36|NZ_LNST01000011|PILER-CR 5950-5985 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNST01000011_1 1.88|6353|37|NZ_LNST01000011|PILER-CR 6353-6389 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNST01000011_1 1.89|6422|35|NZ_LNST01000011|PILER-CR 6422-6456 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNST01000011_1 1.101|7226|34|NZ_LNST01000011|PILER-CR 7226-7259 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNST01000011_1 1.101|7226|34|NZ_LNST01000011|PILER-CR 7226-7259 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNST01000011_1 1.116|8231|35|NZ_LNST01000011|PILER-CR 8231-8265 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNST01000011_1 1.116|8231|35|NZ_LNST01000011|PILER-CR 8231-8265 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNST01000011_1 1.121|8568|34|NZ_LNST01000011|PILER-CR 8568-8601 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNST01000011_1 1.6|5148|34|NZ_LNST01000011|CRT 5148-5181 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNST01000011_1 1.14|5675|34|NZ_LNST01000011|CRT,CRISPRCasFinder 5675-5708 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNST01000011_1 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder 6198-6232 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNST01000011_1 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7191-7224 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNST01000011_1 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7191-7224 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNST01000011_1 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7718-7751 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNST01000011_1 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder 7718-7751 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNST01000011_1 1.59|8643|34|NZ_LNST01000011|CRT,CRISPRCasFinder 8643-8676 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNST01000011_1 1.70|5153|34|NZ_LNST01000011|PILER-CR 5153-5186 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNST01000011_1 1.78|5687|34|NZ_LNST01000011|PILER-CR 5687-5720 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNST01000011_1 1.86|6218|35|NZ_LNST01000011|PILER-CR 6218-6252 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNST01000011_1 1.101|7226|34|NZ_LNST01000011|PILER-CR 7226-7259 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNST01000011_1 1.101|7226|34|NZ_LNST01000011|PILER-CR 7226-7259 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNST01000011_1 1.109|7761|34|NZ_LNST01000011|PILER-CR 7761-7794 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNST01000011_1 1.109|7761|34|NZ_LNST01000011|PILER-CR 7761-7794 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNST01000011_1 1.123|8700|34|NZ_LNST01000011|PILER-CR 8700-8733 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676

1. spacer 1.36|7126|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

2. spacer 1.36|7126|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

3. spacer 1.100|7160|34|NZ_LNST01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

4. spacer 1.100|7160|34|NZ_LNST01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

5. spacer 1.49|7980|36|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

6. spacer 1.49|7980|36|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

7. spacer 1.113|8027|36|NZ_LNST01000011|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

8. spacer 1.113|8027|36|NZ_LNST01000011|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

9. spacer 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

10. spacer 1.107|7627|34|NZ_LNST01000011|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

11. spacer 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

12. spacer 1.107|7627|34|NZ_LNST01000011|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

13. spacer 1.9|5347|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

14. spacer 1.43|7586|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

15. spacer 1.73|5354|35|NZ_LNST01000011|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

16. spacer 1.107|7627|34|NZ_LNST01000011|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

17. spacer 1.20|6066|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

18. spacer 1.84|6084|35|NZ_LNST01000011|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

19. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

20. spacer 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

21. spacer 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

22. spacer 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

23. spacer 1.11|5479|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

24. spacer 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

25. spacer 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

26. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

27. spacer 1.75|5488|34|NZ_LNST01000011|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

28. spacer 1.75|5488|34|NZ_LNST01000011|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

29. spacer 1.75|5488|34|NZ_LNST01000011|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

30. spacer 1.75|5488|34|NZ_LNST01000011|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

31. spacer 1.89|6422|35|NZ_LNST01000011|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

32. spacer 1.89|6422|35|NZ_LNST01000011|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

33. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

34. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

35. spacer 1.18|5934|36|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

36. spacer 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

37. spacer 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

38. spacer 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

39. spacer 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

40. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

41. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

42. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

43. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

44. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

45. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

46. spacer 1.27|6532|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

47. spacer 1.39|7323|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

48. spacer 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

49. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

50. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

51. spacer 1.82|5950|36|NZ_LNST01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

52. spacer 1.83|6018|34|NZ_LNST01000011|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

53. spacer 1.83|6018|34|NZ_LNST01000011|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

54. spacer 1.83|6018|34|NZ_LNST01000011|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

55. spacer 1.86|6218|35|NZ_LNST01000011|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

56. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

57. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

58. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

59. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

60. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

61. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

62. spacer 1.91|6557|35|NZ_LNST01000011|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

63. spacer 1.103|7360|35|NZ_LNST01000011|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

64. spacer 1.109|7761|34|NZ_LNST01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

65. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

66. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

67. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

68. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

69. spacer 1.16|5806|33|NZ_LNST01000011|CRT,CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

70. spacer 1.19|6001|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

71. spacer 1.21|6132|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

72. spacer 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

73. spacer 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

74. spacer 1.47|7848|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

75. spacer 1.47|7848|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

76. spacer 1.57|8513|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

77. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

78. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

79. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

80. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

81. spacer 1.80|5820|33|NZ_LNST01000011|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

82. spacer 1.83|6018|34|NZ_LNST01000011|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

83. spacer 1.85|6151|35|NZ_LNST01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

84. spacer 1.86|6218|35|NZ_LNST01000011|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

85. spacer 1.109|7761|34|NZ_LNST01000011|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

86. spacer 1.111|7893|34|NZ_LNST01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

87. spacer 1.111|7893|34|NZ_LNST01000011|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

88. spacer 1.121|8568|34|NZ_LNST01000011|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

89. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

90. spacer 1.18|5934|36|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

91. spacer 1.24|6331|37|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

92. spacer 1.25|6399|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

93. spacer 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

94. spacer 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

95. spacer 1.52|8181|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

96. spacer 1.52|8181|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

97. spacer 1.57|8513|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

98. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

99. spacer 1.82|5950|36|NZ_LNST01000011|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

100. spacer 1.88|6353|37|NZ_LNST01000011|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

101. spacer 1.89|6422|35|NZ_LNST01000011|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

102. spacer 1.101|7226|34|NZ_LNST01000011|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

103. spacer 1.101|7226|34|NZ_LNST01000011|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

104. spacer 1.116|8231|35|NZ_LNST01000011|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

105. spacer 1.116|8231|35|NZ_LNST01000011|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

106. spacer 1.121|8568|34|NZ_LNST01000011|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

107. spacer 1.6|5148|34|NZ_LNST01000011|CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

108. spacer 1.14|5675|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

109. spacer 1.22|6198|35|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

110. spacer 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

111. spacer 1.37|7191|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

112. spacer 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

113. spacer 1.45|7718|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

114. spacer 1.59|8643|34|NZ_LNST01000011|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

115. spacer 1.70|5153|34|NZ_LNST01000011|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

116. spacer 1.78|5687|34|NZ_LNST01000011|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

117. spacer 1.86|6218|35|NZ_LNST01000011|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

118. spacer 1.101|7226|34|NZ_LNST01000011|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

119. spacer 1.101|7226|34|NZ_LNST01000011|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

120. spacer 1.109|7761|34|NZ_LNST01000011|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

121. spacer 1.109|7761|34|NZ_LNST01000011|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

122. spacer 1.123|8700|34|NZ_LNST01000011|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
28. NZ_LNST01000222
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
29. NZ_LNST01000187
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
30. NZ_LNST01000248
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
31. NZ_LNST01000095
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
32. NZ_LNST01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
33. NZ_LNST01000163
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
34. NZ_LNST01000386
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
35. NZ_LNST01000441
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
36. NZ_LNST01000090
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
37. NZ_LNST01000305
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
38. NZ_LNST01000097
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
39. NZ_LNST01000325
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
40. NZ_LNST01000094
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
41. NZ_LNST01000108
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000108_1 2261-2507 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
42. NZ_LNST01000506
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNST01000506_1 423-534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
43. NZ_LNST01000429
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
44. NZ_LNST01000335
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
45. NZ_LNST01000083
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage