Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNSS01000197 Xanthomonas translucens strain LB5 flattened_line_393, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000270 Xanthomonas translucens strain LB5 flattened_line_538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000252 Xanthomonas translucens strain LB5 flattened_line_502, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000173 Xanthomonas translucens strain LB5 flattened_line_345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000114 Xanthomonas translucens strain LB5 flattened_line_228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000274 Xanthomonas translucens strain LB5 flattened_line_546, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000070 Xanthomonas translucens strain LB5 flattened_line_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000063 Xanthomonas translucens strain LB5 flattened_line_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000065 Xanthomonas translucens strain LB5 flattened_line_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000061 Xanthomonas translucens strain LB5 flattened_line_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000260 Xanthomonas translucens strain LB5 flattened_line_518, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000265 Xanthomonas translucens strain LB5 flattened_line_528, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000142 Xanthomonas translucens strain LB5 flattened_line_284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000104 Xanthomonas translucens strain LB5 flattened_line_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000053 Xanthomonas translucens strain LB5 flattened_line_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000294 Xanthomonas translucens strain LB5 flattened_line_586, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000258 Xanthomonas translucens strain LB5 flattened_line_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000184 Xanthomonas translucens strain LB5 flattened_line_367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000246 Xanthomonas translucens strain LB5 flattened_line_490, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000269 Xanthomonas translucens strain LB5 flattened_line_536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000042 Xanthomonas translucens strain LB5 flattened_line_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000062 Xanthomonas translucens strain LB5 flattened_line_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000033 Xanthomonas translucens strain LB5 flattened_line_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000071 Xanthomonas translucens strain LB5 flattened_line_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000050 Xanthomonas translucens strain LB5 flattened_line_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000035 Xanthomonas translucens strain LB5 flattened_line_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000120 Xanthomonas translucens strain LB5 flattened_line_240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000111 Xanthomonas translucens strain LB5 flattened_line_222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000172 Xanthomonas translucens strain LB5 flattened_line_343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000245 Xanthomonas translucens strain LB5 flattened_line_488, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000279 Xanthomonas translucens strain LB5 flattened_line_556, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000264 Xanthomonas translucens strain LB5 flattened_line_526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000060 Xanthomonas translucens strain LB5 flattened_line_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000171 Xanthomonas translucens strain LB5 flattened_line_341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000106 Xanthomonas translucens strain LB5 flattened_line_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000286 Xanthomonas translucens strain LB5 flattened_line_570, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000129 Xanthomonas translucens strain LB5 flattened_line_258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000099 Xanthomonas translucens strain LB5 flattened_line_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000113 Xanthomonas translucens strain LB5 flattened_line_226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000223 Xanthomonas translucens strain LB5 flattened_line_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000195 Xanthomonas translucens strain LB5 flattened_line_389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000280 Xanthomonas translucens strain LB5 flattened_line_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000059 Xanthomonas translucens strain LB5 flattened_line_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000079 Xanthomonas translucens strain LB5 flattened_line_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000198 Xanthomonas translucens strain LB5 flattened_line_395, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000175 Xanthomonas translucens strain LB5 flattened_line_349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000224 Xanthomonas translucens strain LB5 flattened_line_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000019 Xanthomonas translucens strain LB5 flattened_line_36, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNSS01000160 Xanthomonas translucens strain LB5 flattened_line_320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000112 Xanthomonas translucens strain LB5 flattened_line_224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000152 Xanthomonas translucens strain LB5 flattened_line_304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000236 Xanthomonas translucens strain LB5 flattened_line_470, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000268 Xanthomonas translucens strain LB5 flattened_line_534, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000109 Xanthomonas translucens strain LB5 flattened_line_218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000167 Xanthomonas translucens strain LB5 flattened_line_334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000123 Xanthomonas translucens strain LB5 flattened_line_246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000117 Xanthomonas translucens strain LB5 flattened_line_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000094 Xanthomonas translucens strain LB5 flattened_line_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000166 Xanthomonas translucens strain LB5 flattened_line_332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000137 Xanthomonas translucens strain LB5 flattened_line_274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000266 Xanthomonas translucens strain LB5 flattened_line_530, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000153 Xanthomonas translucens strain LB5 flattened_line_306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000006 Xanthomonas translucens strain LB5 flattened_line_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000110 Xanthomonas translucens strain LB5 flattened_line_220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000034 Xanthomonas translucens strain LB5 flattened_line_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000155 Xanthomonas translucens strain LB5 flattened_line_310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000018 Xanthomonas translucens strain LB5 flattened_line_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000095 Xanthomonas translucens strain LB5 flattened_line_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000185 Xanthomonas translucens strain LB5 flattened_line_369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000138 Xanthomonas translucens strain LB5 flattened_line_276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000072 Xanthomonas translucens strain LB5 flattened_line_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000084 Xanthomonas translucens strain LB5 flattened_line_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000028 Xanthomonas translucens strain LB5 flattened_line_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000282 Xanthomonas translucens strain LB5 flattened_line_562, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000011 Xanthomonas translucens strain LB5 flattened_line_20, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNSS01000031 Xanthomonas translucens strain LB5 flattened_line_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000012 Xanthomonas translucens strain LB5 flattened_line_22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000023 Xanthomonas translucens strain LB5 flattened_line_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000226 Xanthomonas translucens strain LB5 flattened_line_450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000066 Xanthomonas translucens strain LB5 flattened_line_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000022 Xanthomonas translucens strain LB5 flattened_line_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000210 Xanthomonas translucens strain LB5 flattened_line_419, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000233 Xanthomonas translucens strain LB5 flattened_line_464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000030 Xanthomonas translucens strain LB5 flattened_line_58, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNSS01000192 Xanthomonas translucens strain LB5 flattened_line_383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000105 Xanthomonas translucens strain LB5 flattened_line_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000010 Xanthomonas translucens strain LB5 flattened_line_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000015 Xanthomonas translucens strain LB5 flattened_line_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000177 Xanthomonas translucens strain LB5 flattened_line_353, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000292 Xanthomonas translucens strain LB5 flattened_line_582, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000096 Xanthomonas translucens strain LB5 flattened_line_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000080 Xanthomonas translucens strain LB5 flattened_line_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000057 Xanthomonas translucens strain LB5 flattened_line_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000259 Xanthomonas translucens strain LB5 flattened_line_516, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000243 Xanthomonas translucens strain LB5 flattened_line_484, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000003 Xanthomonas translucens strain LB5 flattened_line_4, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNSS01000290 Xanthomonas translucens strain LB5 flattened_line_578, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000130 Xanthomonas translucens strain LB5 flattened_line_260, whole genome shotgun sequence 0 crisprs PrimPol 0 0 0 0
NZ_LNSS01000174 Xanthomonas translucens strain LB5 flattened_line_347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000194 Xanthomonas translucens strain LB5 flattened_line_387, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000038 Xanthomonas translucens strain LB5 flattened_line_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000009 Xanthomonas translucens strain LB5 flattened_line_16, whole genome shotgun sequence 0 crisprs Cas9_archaeal,cas3 0 0 0 0
NZ_LNSS01000211 Xanthomonas translucens strain LB5 flattened_line_421, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000054 Xanthomonas translucens strain LB5 flattened_line_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000101 Xanthomonas translucens strain LB5 flattened_line_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000089 Xanthomonas translucens strain LB5 flattened_line_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000281 Xanthomonas translucens strain LB5 flattened_line_560, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000219 Xanthomonas translucens strain LB5 flattened_line_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000098 Xanthomonas translucens strain LB5 flattened_line_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000069 Xanthomonas translucens strain LB5 flattened_line_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000225 Xanthomonas translucens strain LB5 flattened_line_448, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000278 Xanthomonas translucens strain LB5 flattened_line_554, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000196 Xanthomonas translucens strain LB5 flattened_line_391, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000273 Xanthomonas translucens strain LB5 flattened_line_544, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000205 Xanthomonas translucens strain LB5 flattened_line_409, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000044 Xanthomonas translucens strain LB5 flattened_line_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000182 Xanthomonas translucens strain LB5 flattened_line_363, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000261 Xanthomonas translucens strain LB5 flattened_line_520, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000100 Xanthomonas translucens strain LB5 flattened_line_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000262 Xanthomonas translucens strain LB5 flattened_line_522, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000008 Xanthomonas translucens strain LB5 flattened_line_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000162 Xanthomonas translucens strain LB5 flattened_line_324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000139 Xanthomonas translucens strain LB5 flattened_line_278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000074 Xanthomonas translucens strain LB5 flattened_line_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000027 Xanthomonas translucens strain LB5 flattened_line_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000119 Xanthomonas translucens strain LB5 flattened_line_238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000056 Xanthomonas translucens strain LB5 flattened_line_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000025 Xanthomonas translucens strain LB5 flattened_line_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000295 Xanthomonas translucens strain LB5 flattened_line_588, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000284 Xanthomonas translucens strain LB5 flattened_line_566, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000216 Xanthomonas translucens strain LB5 flattened_line_431, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000248 Xanthomonas translucens strain LB5 flattened_line_494, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000289 Xanthomonas translucens strain LB5 flattened_line_576, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000227 Xanthomonas translucens strain LB5 flattened_line_452, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000092 Xanthomonas translucens strain LB5 flattened_line_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000237 Xanthomonas translucens strain LB5 flattened_line_472, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000143 Xanthomonas translucens strain LB5 flattened_line_286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000121 Xanthomonas translucens strain LB5 flattened_line_242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000206 Xanthomonas translucens strain LB5 flattened_line_411, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000075 Xanthomonas translucens strain LB5 flattened_line_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000048 Xanthomonas translucens strain LB5 flattened_line_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000200 Xanthomonas translucens strain LB5 flattened_line_399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000156 Xanthomonas translucens strain LB5 flattened_line_312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000201 Xanthomonas translucens strain LB5 flattened_line_401, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000140 Xanthomonas translucens strain LB5 flattened_line_280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000239 Xanthomonas translucens strain LB5 flattened_line_476, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000051 Xanthomonas translucens strain LB5 flattened_line_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000039 Xanthomonas translucens strain LB5 flattened_line_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000190 Xanthomonas translucens strain LB5 flattened_line_379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000082 Xanthomonas translucens strain LB5 flattened_line_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000144 Xanthomonas translucens strain LB5 flattened_line_288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000254 Xanthomonas translucens strain LB5 flattened_line_506, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000214 Xanthomonas translucens strain LB5 flattened_line_427, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000043 Xanthomonas translucens strain LB5 flattened_line_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000271 Xanthomonas translucens strain LB5 flattened_line_540, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000203 Xanthomonas translucens strain LB5 flattened_line_405, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000215 Xanthomonas translucens strain LB5 flattened_line_429, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000208 Xanthomonas translucens strain LB5 flattened_line_415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000285 Xanthomonas translucens strain LB5 flattened_line_568, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000221 Xanthomonas translucens strain LB5 flattened_line_441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000232 Xanthomonas translucens strain LB5 flattened_line_462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000291 Xanthomonas translucens strain LB5 flattened_line_580, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000032 Xanthomonas translucens strain LB5 flattened_line_62, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNSS01000234 Xanthomonas translucens strain LB5 flattened_line_466, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000283 Xanthomonas translucens strain LB5 flattened_line_564, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000083 Xanthomonas translucens strain LB5 flattened_line_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000213 Xanthomonas translucens strain LB5 flattened_line_425, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000128 Xanthomonas translucens strain LB5 flattened_line_256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000209 Xanthomonas translucens strain LB5 flattened_line_417, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000204 Xanthomonas translucens strain LB5 flattened_line_407, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000122 Xanthomonas translucens strain LB5 flattened_line_244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000242 Xanthomonas translucens strain LB5 flattened_line_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000064 Xanthomonas translucens strain LB5 flattened_line_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000222 Xanthomonas translucens strain LB5 flattened_line_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000108 Xanthomonas translucens strain LB5 flattened_line_214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000183 Xanthomonas translucens strain LB5 flattened_line_365, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000073 Xanthomonas translucens strain LB5 flattened_line_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000134 Xanthomonas translucens strain LB5 flattened_line_268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000176 Xanthomonas translucens strain LB5 flattened_line_351, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000131 Xanthomonas translucens strain LB5 flattened_line_262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000047 Xanthomonas translucens strain LB5 flattened_line_92, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNSS01000116 Xanthomonas translucens strain LB5 flattened_line_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000277 Xanthomonas translucens strain LB5 flattened_line_552, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000040 Xanthomonas translucens strain LB5 flattened_line_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000217 Xanthomonas translucens strain LB5 flattened_line_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000036 Xanthomonas translucens strain LB5 flattened_line_70, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_LNSS01000102 Xanthomonas translucens strain LB5 flattened_line_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000228 Xanthomonas translucens strain LB5 flattened_line_454, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000150 Xanthomonas translucens strain LB5 flattened_line_300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000193 Xanthomonas translucens strain LB5 flattened_line_385, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000251 Xanthomonas translucens strain LB5 flattened_line_500, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000297 Xanthomonas translucens strain LB5 flattened_line_592, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000107 Xanthomonas translucens strain LB5 flattened_line_212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000253 Xanthomonas translucens strain LB5 flattened_line_504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000133 Xanthomonas translucens strain LB5 flattened_line_266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000097 Xanthomonas translucens strain LB5 flattened_line_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000093 Xanthomonas translucens strain LB5 flattened_line_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000017 Xanthomonas translucens strain LB5 flattened_line_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000293 Xanthomonas translucens strain LB5 flattened_line_584, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000029 Xanthomonas translucens strain LB5 flattened_line_56, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNSS01000275 Xanthomonas translucens strain LB5 flattened_line_548, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000159 Xanthomonas translucens strain LB5 flattened_line_318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000164 Xanthomonas translucens strain LB5 flattened_line_328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000170 Xanthomonas translucens strain LB5 flattened_line_340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000148 Xanthomonas translucens strain LB5 flattened_line_296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000086 Xanthomonas translucens strain LB5 flattened_line_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000052 Xanthomonas translucens strain LB5 flattened_line_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000180 Xanthomonas translucens strain LB5 flattened_line_359, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000151 Xanthomonas translucens strain LB5 flattened_line_302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000187 Xanthomonas translucens strain LB5 flattened_line_373, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000230 Xanthomonas translucens strain LB5 flattened_line_458, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000212 Xanthomonas translucens strain LB5 flattened_line_423, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000001 Xanthomonas translucens strain LB5 flattened_line_0, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_LNSS01000263 Xanthomonas translucens strain LB5 flattened_line_524, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000016 Xanthomonas translucens strain LB5 flattened_line_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000045 Xanthomonas translucens strain LB5 flattened_line_88, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNSS01000189 Xanthomonas translucens strain LB5 flattened_line_377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000077 Xanthomonas translucens strain LB5 flattened_line_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000081 Xanthomonas translucens strain LB5 flattened_line_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000014 Xanthomonas translucens strain LB5 flattened_line_26, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNSS01000188 Xanthomonas translucens strain LB5 flattened_line_375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000238 Xanthomonas translucens strain LB5 flattened_line_474, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000296 Xanthomonas translucens strain LB5 flattened_line_590, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000004 Xanthomonas translucens strain LB5 flattened_line_6, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 2
NZ_LNSS01000127 Xanthomonas translucens strain LB5 flattened_line_254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000202 Xanthomonas translucens strain LB5 flattened_line_403, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000118 Xanthomonas translucens strain LB5 flattened_line_236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000020 Xanthomonas translucens strain LB5 flattened_line_38, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 9 46 0 0
NZ_LNSS01000257 Xanthomonas translucens strain LB5 flattened_line_512, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000247 Xanthomonas translucens strain LB5 flattened_line_492, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000154 Xanthomonas translucens strain LB5 flattened_line_308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000037 Xanthomonas translucens strain LB5 flattened_line_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000068 Xanthomonas translucens strain LB5 flattened_line_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000125 Xanthomonas translucens strain LB5 flattened_line_250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000218 Xanthomonas translucens strain LB5 flattened_line_435, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000067 Xanthomonas translucens strain LB5 flattened_line_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000078 Xanthomonas translucens strain LB5 flattened_line_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000141 Xanthomonas translucens strain LB5 flattened_line_282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000145 Xanthomonas translucens strain LB5 flattened_line_290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000103 Xanthomonas translucens strain LB5 flattened_line_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000041 Xanthomonas translucens strain LB5 flattened_line_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000231 Xanthomonas translucens strain LB5 flattened_line_460, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000181 Xanthomonas translucens strain LB5 flattened_line_361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000147 Xanthomonas translucens strain LB5 flattened_line_294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000241 Xanthomonas translucens strain LB5 flattened_line_480, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000136 Xanthomonas translucens strain LB5 flattened_line_272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000169 Xanthomonas translucens strain LB5 flattened_line_338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000132 Xanthomonas translucens strain LB5 flattened_line_264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000024 Xanthomonas translucens strain LB5 flattened_line_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000058 Xanthomonas translucens strain LB5 flattened_line_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000163 Xanthomonas translucens strain LB5 flattened_line_326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000244 Xanthomonas translucens strain LB5 flattened_line_486, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000026 Xanthomonas translucens strain LB5 flattened_line_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000287 Xanthomonas translucens strain LB5 flattened_line_572, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000087 Xanthomonas translucens strain LB5 flattened_line_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000288 Xanthomonas translucens strain LB5 flattened_line_574, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000256 Xanthomonas translucens strain LB5 flattened_line_510, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000007 Xanthomonas translucens strain LB5 flattened_line_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000149 Xanthomonas translucens strain LB5 flattened_line_298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000168 Xanthomonas translucens strain LB5 flattened_line_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000179 Xanthomonas translucens strain LB5 flattened_line_357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000088 Xanthomonas translucens strain LB5 flattened_line_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000049 Xanthomonas translucens strain LB5 flattened_line_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000146 Xanthomonas translucens strain LB5 flattened_line_292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000158 Xanthomonas translucens strain LB5 flattened_line_316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000249 Xanthomonas translucens strain LB5 flattened_line_496, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000276 Xanthomonas translucens strain LB5 flattened_line_550, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000255 Xanthomonas translucens strain LB5 flattened_line_508, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000005 Xanthomonas translucens strain LB5 flattened_line_8, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNSS01000013 Xanthomonas translucens strain LB5 flattened_line_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000240 Xanthomonas translucens strain LB5 flattened_line_478, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000250 Xanthomonas translucens strain LB5 flattened_line_498, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000220 Xanthomonas translucens strain LB5 flattened_line_439, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000199 Xanthomonas translucens strain LB5 flattened_line_397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000021 Xanthomonas translucens strain LB5 flattened_line_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000272 Xanthomonas translucens strain LB5 flattened_line_542, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000161 Xanthomonas translucens strain LB5 flattened_line_322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000191 Xanthomonas translucens strain LB5 flattened_line_381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000126 Xanthomonas translucens strain LB5 flattened_line_252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000157 Xanthomonas translucens strain LB5 flattened_line_314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000115 Xanthomonas translucens strain LB5 flattened_line_230, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNSS01000002 Xanthomonas translucens strain LB5 flattened_line_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000135 Xanthomonas translucens strain LB5 flattened_line_270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000165 Xanthomonas translucens strain LB5 flattened_line_330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000076 Xanthomonas translucens strain LB5 flattened_line_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000091 Xanthomonas translucens strain LB5 flattened_line_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000186 Xanthomonas translucens strain LB5 flattened_line_371, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000235 Xanthomonas translucens strain LB5 flattened_line_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000207 Xanthomonas translucens strain LB5 flattened_line_413, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000229 Xanthomonas translucens strain LB5 flattened_line_456, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000055 Xanthomonas translucens strain LB5 flattened_line_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000090 Xanthomonas translucens strain LB5 flattened_line_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000124 Xanthomonas translucens strain LB5 flattened_line_248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000085 Xanthomonas translucens strain LB5 flattened_line_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000178 Xanthomonas translucens strain LB5 flattened_line_355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000267 Xanthomonas translucens strain LB5 flattened_line_532, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNSS01000046 Xanthomonas translucens strain LB5 flattened_line_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LNSS01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNSS01000001_1 198673-198784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 121638 : 127983 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNSS01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNSS01000020_1 53102-57413 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNSS01000020_1 1.1|53133|35|NZ_LNSS01000020|CRISPRCasFinder,CRT 53133-53167 35 NZ_LNSS01000004.1 83221-83255 1 0.971
NZ_LNSS01000020_1 1.2|53199|33|NZ_LNSS01000020|CRISPRCasFinder,CRT 53199-53231 33 NZ_LNSS01000004.1 78396-78428 0 1.0
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_LNSS01000004.1 58637-58670 0 1.0
NZ_LNSS01000020_1 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 54315-54348 34 NZ_LNSS01000004.1 62094-62127 0 1.0
NZ_LNSS01000020_1 1.21|54446|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54446-54480 35 NZ_LNSS01000004.1 64411-64445 0 1.0
NZ_LNSS01000020_1 1.66|53200|33|NZ_LNSS01000020|PILER-CR 53200-53232 33 NZ_LNSS01000004.1 78396-78428 0 1.0
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_LNSS01000004.1 58637-58670 0 1.0
NZ_LNSS01000020_1 1.83|54332|34|NZ_LNSS01000020|PILER-CR 54332-54365 34 NZ_LNSS01000004.1 62094-62127 0 1.0
NZ_LNSS01000020_1 1.85|54465|35|NZ_LNSS01000020|PILER-CR 54465-54499 35 NZ_LNSS01000004.1 64411-64445 0 1.0

1. spacer 1.1|53133|35|NZ_LNSS01000020|CRISPRCasFinder,CRT matches to position: 83221-83255, mismatch: 1, identity: 0.971

gatgtcgagtggcgccgggacgacatggcatgggt	CRISPR spacer
gatgtcgagtggcgccgggacgacatggcttgggt	Protospacer
***************************** *****

2. spacer 1.2|53199|33|NZ_LNSS01000020|CRISPRCasFinder,CRT matches to position: 78396-78428, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

3. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to position: 58637-58670, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

4. spacer 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to position: 62094-62127, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

5. spacer 1.21|54446|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to position: 64411-64445, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

6. spacer 1.66|53200|33|NZ_LNSS01000020|PILER-CR matches to position: 78396-78428, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

7. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to position: 58637-58670, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

8. spacer 1.83|54332|34|NZ_LNSS01000020|PILER-CR matches to position: 62094-62127, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

9. spacer 1.85|54465|35|NZ_LNSS01000020|PILER-CR matches to position: 64411-64445, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNSS01000020_1 1.36|55440|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55440-55473 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNSS01000020_1 1.36|55440|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55440-55473 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNSS01000020_1 1.100|55474|34|NZ_LNSS01000020|PILER-CR 55474-55507 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNSS01000020_1 1.100|55474|34|NZ_LNSS01000020|PILER-CR 55474-55507 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNSS01000020_1 1.49|56294|36|NZ_LNSS01000020|CRT,CRISPRCasFinder 56294-56329 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNSS01000020_1 1.49|56294|36|NZ_LNSS01000020|CRT,CRISPRCasFinder 56294-56329 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNSS01000020_1 1.113|56341|36|NZ_LNSS01000020|PILER-CR 56341-56376 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNSS01000020_1 1.113|56341|36|NZ_LNSS01000020|PILER-CR 56341-56376 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNSS01000020_1 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55900-55933 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNSS01000020_1 1.107|55941|34|NZ_LNSS01000020|PILER-CR 55941-55974 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNSS01000020_1 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55900-55933 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNSS01000020_1 1.107|55941|34|NZ_LNSS01000020|PILER-CR 55941-55974 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNSS01000020_1 1.9|53661|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 53661-53695 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNSS01000020_1 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55900-55933 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNSS01000020_1 1.73|53668|35|NZ_LNSS01000020|PILER-CR 53668-53702 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNSS01000020_1 1.107|55941|34|NZ_LNSS01000020|PILER-CR 55941-55974 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNSS01000020_1 1.20|54380|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54380-54414 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNSS01000020_1 1.84|54398|35|NZ_LNSS01000020|PILER-CR 54398-54432 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNSS01000020_1 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 53793-53826 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNSS01000020_1 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 53793-53826 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNSS01000020_1 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 53793-53826 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNSS01000020_1 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 53793-53826 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNSS01000020_1 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54713-54747 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNSS01000020_1 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54713-54747 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNSS01000020_1 1.75|53802|34|NZ_LNSS01000020|PILER-CR 53802-53835 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNSS01000020_1 1.75|53802|34|NZ_LNSS01000020|PILER-CR 53802-53835 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNSS01000020_1 1.75|53802|34|NZ_LNSS01000020|PILER-CR 53802-53835 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNSS01000020_1 1.75|53802|34|NZ_LNSS01000020|PILER-CR 53802-53835 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNSS01000020_1 1.89|54736|35|NZ_LNSS01000020|PILER-CR 54736-54770 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNSS01000020_1 1.89|54736|35|NZ_LNSS01000020|PILER-CR 54736-54770 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNSS01000020_1 1.18|54248|36|NZ_LNSS01000020|CRT,CRISPRCasFinder 54248-54283 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNSS01000020_1 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 54315-54348 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNSS01000020_1 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 54315-54348 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNSS01000020_1 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 54315-54348 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNSS01000020_1 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54512-54546 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNSS01000020_1 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54846-54880 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNSS01000020_1 1.39|55637|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 55637-55671 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNSS01000020_1 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56032-56065 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNSS01000020_1 1.82|54264|36|NZ_LNSS01000020|PILER-CR 54264-54299 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNSS01000020_1 1.83|54332|34|NZ_LNSS01000020|PILER-CR 54332-54365 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNSS01000020_1 1.83|54332|34|NZ_LNSS01000020|PILER-CR 54332-54365 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNSS01000020_1 1.83|54332|34|NZ_LNSS01000020|PILER-CR 54332-54365 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNSS01000020_1 1.86|54532|35|NZ_LNSS01000020|PILER-CR 54532-54566 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNSS01000020_1 1.91|54871|35|NZ_LNSS01000020|PILER-CR 54871-54905 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNSS01000020_1 1.103|55674|35|NZ_LNSS01000020|PILER-CR 55674-55708 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNSS01000020_1 1.109|56075|34|NZ_LNSS01000020|PILER-CR 56075-56108 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNSS01000020_1 1.16|54120|33|NZ_LNSS01000020|CRT,CRISPRCasFinder 54120-54152 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNSS01000020_1 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 54315-54348 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNSS01000020_1 1.21|54446|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54446-54480 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNSS01000020_1 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54512-54546 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNSS01000020_1 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56032-56065 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNSS01000020_1 1.47|56162|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56162-56195 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNSS01000020_1 1.47|56162|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56162-56195 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNSS01000020_1 1.57|56827|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56827-56860 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNSS01000020_1 1.80|54134|33|NZ_LNSS01000020|PILER-CR 54134-54166 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNSS01000020_1 1.83|54332|34|NZ_LNSS01000020|PILER-CR 54332-54365 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNSS01000020_1 1.85|54465|35|NZ_LNSS01000020|PILER-CR 54465-54499 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNSS01000020_1 1.86|54532|35|NZ_LNSS01000020|PILER-CR 54532-54566 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNSS01000020_1 1.109|56075|34|NZ_LNSS01000020|PILER-CR 56075-56108 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNSS01000020_1 1.111|56207|34|NZ_LNSS01000020|PILER-CR 56207-56240 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNSS01000020_1 1.111|56207|34|NZ_LNSS01000020|PILER-CR 56207-56240 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNSS01000020_1 1.121|56882|34|NZ_LNSS01000020|PILER-CR 56882-56915 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNSS01000020_1 1.18|54248|36|NZ_LNSS01000020|CRT,CRISPRCasFinder 54248-54283 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNSS01000020_1 1.24|54645|37|NZ_LNSS01000020|CRT,CRISPRCasFinder 54645-54681 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNSS01000020_1 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54713-54747 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNSS01000020_1 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55505-55538 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNSS01000020_1 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55505-55538 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNSS01000020_1 1.52|56495|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 56495-56529 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNSS01000020_1 1.52|56495|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 56495-56529 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNSS01000020_1 1.57|56827|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56827-56860 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNSS01000020_1 1.82|54264|36|NZ_LNSS01000020|PILER-CR 54264-54299 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNSS01000020_1 1.88|54667|37|NZ_LNSS01000020|PILER-CR 54667-54703 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNSS01000020_1 1.89|54736|35|NZ_LNSS01000020|PILER-CR 54736-54770 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNSS01000020_1 1.101|55540|34|NZ_LNSS01000020|PILER-CR 55540-55573 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNSS01000020_1 1.101|55540|34|NZ_LNSS01000020|PILER-CR 55540-55573 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNSS01000020_1 1.116|56545|35|NZ_LNSS01000020|PILER-CR 56545-56579 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNSS01000020_1 1.116|56545|35|NZ_LNSS01000020|PILER-CR 56545-56579 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNSS01000020_1 1.121|56882|34|NZ_LNSS01000020|PILER-CR 56882-56915 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNSS01000020_1 1.6|53462|34|NZ_LNSS01000020|CRT 53462-53495 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNSS01000020_1 1.14|53989|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 53989-54022 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNSS01000020_1 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder 54512-54546 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNSS01000020_1 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55505-55538 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNSS01000020_1 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 55505-55538 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNSS01000020_1 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56032-56065 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNSS01000020_1 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56032-56065 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNSS01000020_1 1.59|56957|34|NZ_LNSS01000020|CRT,CRISPRCasFinder 56957-56990 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNSS01000020_1 1.70|53467|34|NZ_LNSS01000020|PILER-CR 53467-53500 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNSS01000020_1 1.78|54001|34|NZ_LNSS01000020|PILER-CR 54001-54034 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNSS01000020_1 1.86|54532|35|NZ_LNSS01000020|PILER-CR 54532-54566 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNSS01000020_1 1.101|55540|34|NZ_LNSS01000020|PILER-CR 55540-55573 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNSS01000020_1 1.101|55540|34|NZ_LNSS01000020|PILER-CR 55540-55573 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNSS01000020_1 1.109|56075|34|NZ_LNSS01000020|PILER-CR 56075-56108 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNSS01000020_1 1.109|56075|34|NZ_LNSS01000020|PILER-CR 56075-56108 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNSS01000020_1 1.123|57014|34|NZ_LNSS01000020|PILER-CR 57014-57047 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676

1. spacer 1.36|55440|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

2. spacer 1.36|55440|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

3. spacer 1.100|55474|34|NZ_LNSS01000020|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

4. spacer 1.100|55474|34|NZ_LNSS01000020|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

5. spacer 1.49|56294|36|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

6. spacer 1.49|56294|36|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

7. spacer 1.113|56341|36|NZ_LNSS01000020|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

8. spacer 1.113|56341|36|NZ_LNSS01000020|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

9. spacer 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

10. spacer 1.107|55941|34|NZ_LNSS01000020|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

11. spacer 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

12. spacer 1.107|55941|34|NZ_LNSS01000020|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

13. spacer 1.9|53661|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

14. spacer 1.43|55900|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

15. spacer 1.73|53668|35|NZ_LNSS01000020|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

16. spacer 1.107|55941|34|NZ_LNSS01000020|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

17. spacer 1.20|54380|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

18. spacer 1.84|54398|35|NZ_LNSS01000020|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

19. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

20. spacer 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

21. spacer 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

22. spacer 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

23. spacer 1.11|53793|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

24. spacer 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

25. spacer 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

26. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

27. spacer 1.75|53802|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

28. spacer 1.75|53802|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

29. spacer 1.75|53802|34|NZ_LNSS01000020|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

30. spacer 1.75|53802|34|NZ_LNSS01000020|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

31. spacer 1.89|54736|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

32. spacer 1.89|54736|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

33. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

34. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

35. spacer 1.18|54248|36|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

36. spacer 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

37. spacer 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

38. spacer 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

39. spacer 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

40. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

41. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

42. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

43. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

44. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

45. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

46. spacer 1.27|54846|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

47. spacer 1.39|55637|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

48. spacer 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

49. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

50. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

51. spacer 1.82|54264|36|NZ_LNSS01000020|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

52. spacer 1.83|54332|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

53. spacer 1.83|54332|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

54. spacer 1.83|54332|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

55. spacer 1.86|54532|35|NZ_LNSS01000020|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

56. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

57. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

58. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

59. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

60. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

61. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

62. spacer 1.91|54871|35|NZ_LNSS01000020|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

63. spacer 1.103|55674|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

64. spacer 1.109|56075|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

65. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

66. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

67. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

68. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

69. spacer 1.16|54120|33|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

70. spacer 1.19|54315|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

71. spacer 1.21|54446|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

72. spacer 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

73. spacer 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

74. spacer 1.47|56162|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

75. spacer 1.47|56162|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

76. spacer 1.57|56827|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

77. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

78. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

79. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

80. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

81. spacer 1.80|54134|33|NZ_LNSS01000020|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

82. spacer 1.83|54332|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

83. spacer 1.85|54465|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

84. spacer 1.86|54532|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

85. spacer 1.109|56075|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

86. spacer 1.111|56207|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

87. spacer 1.111|56207|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

88. spacer 1.121|56882|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

89. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

90. spacer 1.18|54248|36|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

91. spacer 1.24|54645|37|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

92. spacer 1.25|54713|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

93. spacer 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

94. spacer 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

95. spacer 1.52|56495|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

96. spacer 1.52|56495|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

97. spacer 1.57|56827|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

98. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

99. spacer 1.82|54264|36|NZ_LNSS01000020|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

100. spacer 1.88|54667|37|NZ_LNSS01000020|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

101. spacer 1.89|54736|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

102. spacer 1.101|55540|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

103. spacer 1.101|55540|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

104. spacer 1.116|56545|35|NZ_LNSS01000020|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

105. spacer 1.116|56545|35|NZ_LNSS01000020|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

106. spacer 1.121|56882|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

107. spacer 1.6|53462|34|NZ_LNSS01000020|CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

108. spacer 1.14|53989|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

109. spacer 1.22|54512|35|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

110. spacer 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

111. spacer 1.37|55505|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

112. spacer 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

113. spacer 1.45|56032|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

114. spacer 1.59|56957|34|NZ_LNSS01000020|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

115. spacer 1.70|53467|34|NZ_LNSS01000020|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

116. spacer 1.78|54001|34|NZ_LNSS01000020|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

117. spacer 1.86|54532|35|NZ_LNSS01000020|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

118. spacer 1.101|55540|34|NZ_LNSS01000020|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

119. spacer 1.101|55540|34|NZ_LNSS01000020|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

120. spacer 1.109|56075|34|NZ_LNSS01000020|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

121. spacer 1.109|56075|34|NZ_LNSS01000020|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

122. spacer 1.123|57014|34|NZ_LNSS01000020|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LNSS01000036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNSS01000036_1 45288-45390 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LNSS01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61132 : 91494 40 Siphoviridae_environmental_samples(34.78%) integrase,tail,terminase attL 67205:67224|attR 93040:93059
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNSS01000004.1|WP_058195519.1|89642_89927_-|hypothetical-protein 89642_89927_- 94 aa aa AcrIC10 NA NA 61132-91494 yes
NZ_LNSS01000004.1|WP_058195493.1|62845_63358_+|hypothetical-protein 62845_63358_+ 170 aa aa NA NA NA 61132-91494 yes
5. NZ_LNSS01000003
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNSS01000003_1 75569-75712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage