Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CZAS01000067 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000040 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000092 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000096 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000084 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000110 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000100 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000111 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000093 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000055 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000048 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CZAS01000108 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000098 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000002 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CZAS01000071 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000104 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000018 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000035 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000094 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000125 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000053 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000011 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CZAS01000001 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 1 crisprs csa3,WYL,DEDDh,cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 1 3 0
NZ_CZAS01000107 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000085 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000114 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000128 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000025 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000069 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000043 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000083 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000052 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000026 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs RT 0 0 1 1
NZ_CZAS01000095 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000013 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000089 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000078 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000029 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000090 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000117 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000102 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000032 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000116 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000051 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000127 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000046 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000058 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000009 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000030 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000031 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 2 crisprs cas14j 0 1 0 0
NZ_CZAS01000068 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_CZAS01000091 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000054 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000074 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000118 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000113 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000080 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000070 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000023 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CZAS01000079 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CZAS01000082 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000033 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000020 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000061 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000097 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000004 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CZAS01000042 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000012 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000123 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000101 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000059 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000036 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000103 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000076 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000039 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000034 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000119 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000060 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000044 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000120 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000099 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000007 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000081 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs PD-DExK 0 0 0 0
NZ_CZAS01000024 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000126 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000041 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000056 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000057 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs PD-DExK 0 0 0 0
NZ_CZAS01000010 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs DinG,RT 0 0 2 1
NZ_CZAS01000064 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000005 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 0 0
NZ_CZAS01000017 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CZAS01000121 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000087 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000003 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_CZAS01000077 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000072 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000073 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000088 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000047 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000006 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs RT 0 0 2 0
NZ_CZAS01000019 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000063 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000037 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000122 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000016 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_CZAS01000028 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000112 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000106 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000027 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_CZAS01000021 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_CZAS01000045 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000115 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000109 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000066 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000124 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000050 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000062 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000105 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000075 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000022 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000014 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_CZAS01000065 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000008 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 3 0
NZ_CZAS01000038 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000015 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_CZAS01000049 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CZAS01000086 Flavonifractor plautii strain 2789STDY5834892, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CZAS01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120044 : 184864 92 Faecalibacterium_phage(65.91%) plate,protease,head,tail,integrase,holin,capsid,tRNA,portal,terminase attL 149294:149309|attR 189216:189231
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CZAS01000031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CZAS01000031_1 20294-20365 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CZAS01000031_2 42457-42606 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MT446400 UNVERIFIED: Escherichia virus TH26, complete genome 12386-12409 2 0.917
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MT446409 UNVERIFIED: Escherichia virus TH37, complete genome 15033-15056 2 0.917
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 CP000385 Mycobacterium sp. MCS Plasmid1, complete sequence 121374-121397 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 146907-146930 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_008704 Mycobacterium sp. KMS plasmid pMKMS02, complete sequence 147433-147456 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 67378-67401 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KC691254 Mycobacterium phage Breezona, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694337 Marine virus AFVG_250M497, complete genome 2834-2857 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694465 Marine virus AFVG_250M1200, complete genome 29035-29058 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MK937600 Mycobacterium phage Wigglewiggle, complete genome 22740-22763 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MK238400 CrAssphage ZA, complete genome 77352-77375 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN586030 Mycobacterium phage BobsGarage, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694500 Marine virus AFVG_250M1198, complete genome 29075-29098 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MH155872 Streptomyces phage Moozy, complete genome 15435-15458 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 JX181829 Salmonella phage SKML-39, complete genome 155141-155164 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_023732 Mycobacterium phage Rumpelstiltskin, complete genome 22714-22737 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN693905 Marine virus AFVG_250M498, complete genome 35882-35905 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN703406 Mycobacterium phage Gabriela, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MF324910 Mycobacterium phage GuuelaD, complete genome 22742-22765 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MH834600 Mycobacterium phage BigCheese, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN693342 Marine virus AFVG_25M9, complete genome 21706-21729 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KC661276 Mycobacterium phage Winky, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694038 Marine virus AFVG_250M496, complete genome 2838-2861 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_022071 Mycobacterium phage Crossroads, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN096380 Mycobacterium phage Lewan, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MF185730 Mycobacterium phage Miley16, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN693851 Marine virus AFVG_250M123, complete genome 28749-28772 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_048182 Edwardsiella virus pEt-SU, complete genome 205955-205978 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MF185728 Mycobacterium phage Finemlucis, complete genome 22716-22739 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694726 Marine virus AFVG_250M757, complete genome 13642-13665 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KU997639 Mycobacterium phage Loadrie, complete genome 22740-22763 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KX580961 Mycobacterium phage Zakai, complete genome 22702-22725 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN693857 Marine virus AFVG_250M1199, complete genome 29080-29103 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694008 Marine virus AFVG_250M442, complete genome 34481-34504 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN703410 Mycobacterium phage Itos, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_015584 Mycobacterium virus Faith1, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KU234099 Mycobacterium phage MkaliMitinis3, complete genome 22708-22731 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MT006214 CrAssphage LMMB, complete genome 78254-78277 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MN694648 Marine virus AFVG_250M756, complete genome 13582-13605 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 JX901189 Mycobacterium phage vB_MapS_FF47, complete genome 22395-22418 3 0.875
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MT778837 Rhizobium phage AF3, complete genome 38105-38128 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MH051254 Mycobacterium phage Jabiru, complete genome 23175-23198 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MG099938 Mycobacterium phage Archetta, complete genome 23706-23729 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KT246486 Mycobacterium phage Chadwick, complete genome 23095-23118 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_025429 Rhizobium phage vB_RleM_P10VF, complete genome 25436-25459 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 KJ019089 Synechococcus phage ACG-2014j isolate Syn7803US23, complete genome 144917-144940 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 JN083853 Mycobacterium phage Airmid, complete genome 23124-23147 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 JN083852 Mycobacterium virus Benedict, complete genome 23127-23150 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NZ_CP034431 Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence 159240-159263 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NZ_CP034431 Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence 165811-165834 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 NC_017773 Rahnella aquatilis HX2 plasmid PRA2, complete sequence 52042-52065 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MG099952 Mycobacterium phage WunderPhul, complete genome 23806-23829 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MF351863 Synechococcus phage Bellamy, complete genome 37403-37426 4 0.833
NZ_CZAS01000031_1 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder 20318-20341 24 MH020240 Mycobacterium phage SuperAwesome, complete genome 23804-23827 4 0.833

1. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MT446400 (UNVERIFIED: Escherichia virus TH26, complete genome) position: , mismatch: 2, identity: 0.917

accgccgccagatccaccaccgct	CRISPR spacer
accgccaccagaaccaccaccgct	Protospacer
******.***** ***********

2. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MT446409 (UNVERIFIED: Escherichia virus TH37, complete genome) position: , mismatch: 2, identity: 0.917

accgccgccagatccaccaccgct	CRISPR spacer
accgccaccagaaccaccaccgct	Protospacer
******.***** ***********

3. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to CP000385 (Mycobacterium sp. MCS Plasmid1, complete sequence) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagcaccaccaccgcc	Protospacer
***********  **********.

4. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccggcagctccaccaccgcc	Protospacer
******* *** ***********.

5. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_008704 (Mycobacterium sp. KMS plasmid pMKMS02, complete sequence) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagcaccaccaccgcc	Protospacer
***********  **********.

6. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
gccgcggccagatcctccaccgct	Protospacer
.**** ********* ********

7. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KC691254 (Mycobacterium phage Breezona, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

8. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694337 (Marine virus AFVG_250M497, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagctccaccgccgcc	Protospacer
*********** ******.****.

9. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694465 (Marine virus AFVG_250M1200, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

10. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MK937600 (Mycobacterium phage Wigglewiggle, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

11. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MK238400 (CrAssphage ZA, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagaaccaccacctgt	Protospacer
************ ********  *

12. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN586030 (Mycobacterium phage BobsGarage, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

13. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694500 (Marine virus AFVG_250M1198, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

14. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MH155872 (Streptomyces phage Moozy, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
gcccccgccagctccaccaccgct	Protospacer
.** ******* ************

15. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to JX181829 (Salmonella phage SKML-39, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccaccagaaccaccaccgcc	Protospacer
******.***** **********.

16. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_023732 (Mycobacterium phage Rumpelstiltskin, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

17. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN693905 (Marine virus AFVG_250M498, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagctccaccgccgcc	Protospacer
*********** ******.****.

18. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN703406 (Mycobacterium phage Gabriela, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

19. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MF324910 (Mycobacterium phage GuuelaD, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

20. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MH834600 (Mycobacterium phage BigCheese, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

21. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN693342 (Marine virus AFVG_25M9, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagatccaccagctcc	Protospacer
******************* * *.

22. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KC661276 (Mycobacterium phage Winky, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

23. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694038 (Marine virus AFVG_250M496, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagctccaccgccgcc	Protospacer
*********** ******.****.

24. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_022071 (Mycobacterium phage Crossroads, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

25. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN096380 (Mycobacterium phage Lewan, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

26. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MF185730 (Mycobacterium phage Miley16, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

27. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN693851 (Marine virus AFVG_250M123, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

28. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_048182 (Edwardsiella virus pEt-SU, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accaccgccagatccagcaccgcc	Protospacer
***.************ ******.

29. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MF185728 (Mycobacterium phage Finemlucis, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

30. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694726 (Marine virus AFVG_250M757, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

31. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KU997639 (Mycobacterium phage Loadrie, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

32. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KX580961 (Mycobacterium phage Zakai, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

33. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN693857 (Marine virus AFVG_250M1199, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

34. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694008 (Marine virus AFVG_250M442, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagctccaccgccgcc	Protospacer
*********** ******.****.

35. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN703410 (Mycobacterium phage Itos, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

36. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_015584 (Mycobacterium virus Faith1, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

37. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KU234099 (Mycobacterium phage MkaliMitinis3, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
agcgccgccagctccaccaccgcc	Protospacer
* ********* ***********.

38. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MT006214 (CrAssphage LMMB, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagaaccaccacctgt	Protospacer
************ ********  *

39. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MN694648 (Marine virus AFVG_250M756, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccgcctgatccaccgccgcc	Protospacer
********* ********.****.

40. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to JX901189 (Mycobacterium phage vB_MapS_FF47, complete genome) position: , mismatch: 3, identity: 0.875

accgccgccagatccaccaccgct	CRISPR spacer
accgccggcagatccaccgccgcc	Protospacer
******* **********.****.

41. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MT778837 (Rhizobium phage AF3, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
tttgccgccagatccaccaccgcc	Protospacer
 ..********************.

42. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MH051254 (Mycobacterium phage Jabiru, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgg	Protospacer
.********************   

43. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MG099938 (Mycobacterium phage Archetta, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgg	Protospacer
.********************   

44. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KT246486 (Mycobacterium phage Chadwick, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgg	Protospacer
.********************   

45. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_025429 (Rhizobium phage vB_RleM_P10VF, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
tttgccgccagatccaccaccgcc	Protospacer
 ..********************.

46. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to KJ019089 (Synechococcus phage ACG-2014j isolate Syn7803US23, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgc	Protospacer
.********************  .

47. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to JN083853 (Mycobacterium phage Airmid, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgg	Protospacer
.********************   

48. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to JN083852 (Mycobacterium virus Benedict, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatccaccacctgg	Protospacer
.********************   

49. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NZ_CP034431 (Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatcgaccaccgtc	Protospacer
.************* *******..

50. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NZ_CP034431 (Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagatcgaccaccgtc	Protospacer
.************* *******..

51. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to NC_017773 (Rahnella aquatilis HX2 plasmid PRA2, complete sequence) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
accgccgccagatccatcacctgc	Protospacer
****************.****  .

52. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MG099952 (Mycobacterium phage WunderPhul, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagaaccaccaccggg	Protospacer
.*********** *********  

53. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
accgcctccagatccaccaccagc	Protospacer
****** **************. .

54. spacer 1.1|20318|24|NZ_CZAS01000031|CRISPRCasFinder matches to MH020240 (Mycobacterium phage SuperAwesome, complete genome) position: , mismatch: 4, identity: 0.833

accgccgccagatccaccaccgct	CRISPR spacer
gccgccgccagaaccaccaccggg	Protospacer
.*********** *********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CZAS01000068
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CZAS01000068_1 5739-5853 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CZAS01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34298 : 41837 12 Erysipelothrix_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CZAS01000026.1|WP_055271317.1|30628_31126_+|hypothetical-protein 30628_31126_+ 165 aa aa AcrIIA11 NA NA No NA
5. NZ_CZAS01000006
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 91782 : 160448 62 Faecalibacterium_phage(65.0%) transposase,plate,tail,tRNA NA
DBSCAN-SWA_2 163960 : 176010 16 Faecalibacterium_phage(63.64%) head,portal,terminase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CZAS01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CZAS01000001_1 537735-538310 TypeI I-C
8 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CZAS01000001_1 1.8|538244|34|NZ_CZAS01000001|CRT 538244-538277 34 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 847162-847195 6 0.824
NZ_CZAS01000001_1 1.8|538244|34|NZ_CZAS01000001|CRT 538244-538277 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 791470-791503 6 0.824

1. spacer 1.8|538244|34|NZ_CZAS01000001|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

cagcggctg--gaccgcggccacatggagtatgtct	CRISPR spacer
--gccgccgccgaccgcggcgacatcgagtatgtct	Protospacer
  ** **.*  ********* **** **********

2. spacer 1.8|538244|34|NZ_CZAS01000001|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.824

cagcggctg--gaccgcggccacatggagtatgtct	CRISPR spacer
--gccgccgccgaccgcggcgacatcgagtatgtct	Protospacer
  ** **.*  ********* **** **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 214678 : 221424 11 Paenibacillus_phage(16.67%) NA NA
DBSCAN-SWA_2 226920 : 235872 13 uncultured_Caudovirales_phage(28.57%) capsid,terminase NA
DBSCAN-SWA_3 517782 : 525340 9 Synechococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CZAS01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11413 : 19986 13 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_2 68661 : 112008 52 Faecalibacterium_phage(23.08%) head,plate,transposase,terminase,integrase,capsid,portal,tail attL 54391:54403|attR 112082:112094
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CZAS01000010.1|WP_009258904.1|22963_23701_-|hypothetical-protein 22963_23701_- 245 aa aa AcrIIA11 NA NA No NA
8. NZ_CZAS01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55323 : 78488 36 unidentified_phage(28.57%) integrase,protease,terminase,capsid,portal attL 51854:51870|attR 78580:78596
DBSCAN-SWA_2 83086 : 93230 14 Clostridium_phage(22.22%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_CZAS01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 86 : 10194 15 Faecalibacterium_phage(44.44%) NA NA
DBSCAN-SWA_2 24023 : 39566 20 Faecalibacterium_phage(28.57%) NA NA
DBSCAN-SWA_3 121850 : 130258 9 Bacillus_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_CZAS01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1154 : 9217 10 Streptococcus_phage(42.86%) portal,plate,tail NA
DBSCAN-SWA_2 13834 : 33784 30 Paenibacillus_phage(38.46%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_CZAS01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23511 : 35470 10 Orpheovirus(14.29%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_CZAS01000021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CZAS01000021_1 11109-11203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage