Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CUEW01000098 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000021 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000102 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000071 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000091 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000067 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000029 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000087 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000056 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000085 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000022 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_CUEW01000009 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000006 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CUEW01000096 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000036 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000093 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000092 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000033 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000051 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000028 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000109 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000010 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000018 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CUEW01000023 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000110 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000020 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CUEW01000082 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000017 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000058 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000105 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000066 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000008 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000100 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000050 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000088 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000069 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CUEW01000086 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000014 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CUEW01000104 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000107 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000055 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000046 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000059 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000013 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_CUEW01000064 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000040 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CUEW01000076 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CUEW01000106 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000108 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000112 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000060 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000099 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000048 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000005 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000090 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000072 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000052 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000053 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000016 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000027 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000039 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000078 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000035 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000079 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000026 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000042 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_CUEW01000089 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000024 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000044 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000047 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000111 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000074 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000007 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000015 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000012 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000019 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_CUEW01000049 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000101 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000011 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000077 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000002 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 1 1
NZ_CUEW01000032 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000054 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000065 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000030 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000004 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CUEW01000080 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000063 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000037 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000061 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000034 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000025 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000094 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000103 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000045 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000062 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000075 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000073 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000057 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000084 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000043 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000083 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_CUEW01000003 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000038 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000041 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_CUEW01000097 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000081 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000001 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_CUEW01000095 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000070 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000031 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_CUEW01000068 Staphylococcus haemolyticus strain CN1134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CUEW01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73180 : 94127 14 Staphylococcus_phage(100.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CUEW01000065
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 160 : 9980 20 Staphylococcus_phage(73.68%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CUEW01000013
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CUEW01000013_1 18835-18921 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CUEW01000013_1 1.1|18865|27|NZ_CUEW01000013|CRISPRCasFinder 18865-18891 27 MN693238 Marine virus AFVG_25M402, complete genome 24675-24701 6 0.778

1. spacer 1.1|18865|27|NZ_CUEW01000013|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 6, identity: 0.778

cacaagcaaagcaggctggggttgggg	CRISPR spacer
cacaagcaacgcaggctgggattctta	Protospacer
********* **********.**   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CUEW01000047
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 156 : 14736 18 Staphylococcus_phage(93.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CUEW01000051
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15222 18 Staphylococcus_phage(100.0%) terminase,tail,capsid,portal,head,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CUEW01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15716 20 uncultured_Caudovirales_phage(75.0%) portal,capsid,head,tail,terminase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CUEW01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2696 : 12824 7 Tupanvirus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_CUEW01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1452 : 9922 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_CUEW01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 778 : 10753 10 Staphylococcus_phage(77.78%) tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CUEW01000002.1|WP_154393739.1|10420_10753_+|hypothetical-protein 10420_10753_+ 110 aa aa AcrIIA13b NA NA 778-10753 NA
10. NZ_CUEW01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9233 : 23107 12 uncultured_Caudovirales_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_CUEW01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 344 : 19880 30 Staphylococcus_phage(62.96%) integrase attL 1435:1449|attR 23387:23401
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_CUEW01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 89594 : 130510 53 Staphylococcus_phage(70.83%) integrase,tail,terminase,capsid,plate,protease,holin,portal,head attL 84603:84618|attR 130924:130939
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage