Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_JVDI01000045 Serratia marcescens strain 532_SMAR 143_2120_49985, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000027 Serratia marcescens strain 532_SMAR 86_13614_273313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000075 Serratia marcescens strain 532_SMAR 223_1445_28374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000052 Serratia marcescens strain 532_SMAR 158_2984_62376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000062 Serratia marcescens strain 532_SMAR 181_30519_716022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000029 Serratia marcescens strain 532_SMAR 96_293_4193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000057 Serratia marcescens strain 532_SMAR 171_24011_504739, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000043 Serratia marcescens strain 532_SMAR 141_104830_1899821, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000082 Serratia marcescens strain 532_SMAR 236_205_4984_85+,211+,162_, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000040 Serratia marcescens strain 532_SMAR 130_220552_4473282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000064 Serratia marcescens strain 532_SMAR 184_36974_744583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000018 Serratia marcescens strain 532_SMAR 55_354_6667, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000024 Serratia marcescens strain 532_SMAR 64_6137_130927, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000049 Serratia marcescens strain 532_SMAR 152_2013_43394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000066 Serratia marcescens strain 532_SMAR 188_46898_920281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000071 Serratia marcescens strain 532_SMAR 213_32586_606933, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000019 Serratia marcescens strain 532_SMAR 56_399_7591, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000085 Serratia marcescens strain 532_SMAR 239_65551_1398706_91_,75+, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000036 Serratia marcescens strain 532_SMAR 122_350835_7664473, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000007 Serratia marcescens strain 532_SMAR 14_22491_429794, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000032 Serratia marcescens strain 532_SMAR 106_40395_877386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000035 Serratia marcescens strain 532_SMAR 117_5669_127848, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000058 Serratia marcescens strain 532_SMAR 172_200_2795, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000068 Serratia marcescens strain 532_SMAR 197_116976_2589334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000021 Serratia marcescens strain 532_SMAR 59_13744_233665, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000041 Serratia marcescens strain 532_SMAR 133_482_8352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000012 Serratia marcescens strain 532_SMAR 24_223229_4278687, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_JVDI01000001 Serratia marcescens strain 532_SMAR 5_74472_1389400, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000004 Serratia marcescens strain 532_SMAR 9_671_14409, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000065 Serratia marcescens strain 532_SMAR 185_2956_539042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000069 Serratia marcescens strain 532_SMAR 198_51826_1025984, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000031 Serratia marcescens strain 532_SMAR 104_202_3649, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000022 Serratia marcescens strain 532_SMAR 61_299781_6165447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000037 Serratia marcescens strain 532_SMAR 124_248261_5000165, whole genome shotgun sequence 1 crisprs cas3 0 1 2 2
NZ_JVDI01000079 Serratia marcescens strain 532_SMAR 233_116388_2261040, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_JVDI01000023 Serratia marcescens strain 532_SMAR 62_41018_912924, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000078 Serratia marcescens strain 532_SMAR 229_773_16379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000034 Serratia marcescens strain 532_SMAR 116_1633_33726, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000002 Serratia marcescens strain 532_SMAR 6_22170_447593, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000026 Serratia marcescens strain 532_SMAR 74_31814_607282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000088 Serratia marcescens strain 532_SMAR 242_33584_763535_221_,27+,199+, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000053 Serratia marcescens strain 532_SMAR 161_13351_236442, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000089 Serratia marcescens strain 532_SMAR 243_2074_304782_231+,98+, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000067 Serratia marcescens strain 532_SMAR 189_236_6242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000080 Serratia marcescens strain 532_SMAR 234_416_9268_37+,179+,111+, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000059 Serratia marcescens strain 532_SMAR 175_453_9982, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000060 Serratia marcescens strain 532_SMAR 176_12243_220666, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000047 Serratia marcescens strain 532_SMAR 146_9517_187203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000017 Serratia marcescens strain 532_SMAR 52_49109_983424, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000072 Serratia marcescens strain 532_SMAR 216_8125_140948, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000030 Serratia marcescens strain 532_SMAR 101_16010_315416, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000061 Serratia marcescens strain 532_SMAR 177_8817_194694, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000076 Serratia marcescens strain 532_SMAR 227_33944_693626, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000038 Serratia marcescens strain 532_SMAR 127_4599_111202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000010 Serratia marcescens strain 532_SMAR 19_280545_5287259, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_JVDI01000009 Serratia marcescens strain 532_SMAR 16_25628_603667, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000008 Serratia marcescens strain 532_SMAR 15_64159_1224615, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000050 Serratia marcescens strain 532_SMAR 153_67198_1277272, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_JVDI01000028 Serratia marcescens strain 532_SMAR 95_247_3266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000081 Serratia marcescens strain 532_SMAR 235_1555_43100_49_,28_,108_, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000006 Serratia marcescens strain 532_SMAR 12_109667_1960017, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_JVDI01000063 Serratia marcescens strain 532_SMAR 183_168377_3549078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000011 Serratia marcescens strain 532_SMAR 20_377770_6725418, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_JVDI01000055 Serratia marcescens strain 532_SMAR 164_66261_1337834, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000083 Serratia marcescens strain 532_SMAR 237_2043_55927_109+,105_,232+, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000005 Serratia marcescens strain 532_SMAR 10_37081_665027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000087 Serratia marcescens strain 532_SMAR 241_273680_6013115_119+,94+,196_, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_JVDI01000074 Serratia marcescens strain 532_SMAR 222_259_4088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000054 Serratia marcescens strain 532_SMAR 163_52021_1179654, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000044 Serratia marcescens strain 532_SMAR 142_3949_82665, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000046 Serratia marcescens strain 532_SMAR 145_238_4406, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000070 Serratia marcescens strain 532_SMAR 206_158050_3005125, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000016 Serratia marcescens strain 532_SMAR 51_35501_769815, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000077 Serratia marcescens strain 532_SMAR 228_346_4225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000013 Serratia marcescens strain 532_SMAR 25_62401_1196902, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000033 Serratia marcescens strain 532_SMAR 110_150548_3115570, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JVDI01000048 Serratia marcescens strain 532_SMAR 149_45749_803426, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000014 Serratia marcescens strain 532_SMAR 32_215_3656, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000051 Serratia marcescens strain 532_SMAR 155_1848_38861, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000020 Serratia marcescens strain 532_SMAR 57_135600_3070521, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000015 Serratia marcescens strain 532_SMAR 42_120018_2741528, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_JVDI01000039 Serratia marcescens strain 532_SMAR 128_170071_3188743, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000003 Serratia marcescens strain 532_SMAR 7_295_5612, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000042 Serratia marcescens strain 532_SMAR 136_79647_2121671, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000086 Serratia marcescens strain 532_SMAR 240_2005_303321_98_,56N,76+, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000056 Serratia marcescens strain 532_SMAR 167_377_7084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000073 Serratia marcescens strain 532_SMAR 218_280_2545, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000025 Serratia marcescens strain 532_SMAR 72_12394_319034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JVDI01000084 Serratia marcescens strain 532_SMAR 238_143258_2631397_63_,22+, whole genome shotgun sequence 0 crisprs cas3,csa3 0 0 0 0

Results visualization

1. NZ_JVDI01000069
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 335 : 15069 16 Klebsiella_phage(35.71%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_JVDI01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 142682 : 150527 10 Acanthocystis_turfacea_Chlorella_virus(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_JVDI01000085
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26105 : 35032 7 environmental_Halophage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JVDI01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 86323 : 124880 50 Erwinia_phage(43.24%) integrase,tRNA,tail,lysis,portal,head,terminase,capsid,plate attL 92953:93002|attR 124952:125001
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_JVDI01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2565 : 68919 64 Tupanvirus(18.75%) tRNA,coat,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_JVDI01000037
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JVDI01000037_1 200879-200971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JVDI01000037_1 1.1|200909|33|NZ_JVDI01000037|CRISPRCasFinder 200909-200941 33 NC_048106 Synechococcus phage S-CBWM1, complete genome 63486-63518 8 0.758

1. spacer 1.1|200909|33|NZ_JVDI01000037|CRISPRCasFinder matches to NC_048106 (Synechococcus phage S-CBWM1, complete genome) position: , mismatch: 8, identity: 0.758

gcatgctccttatccttagcctctgcagctact	CRISPR spacer
tcgtcctccttacccttagcctctgcggcgata	Protospacer
 *.* *******.*************.** *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 132225 : 139334 9 Mycoplasma_phage(16.67%) NA NA
DBSCAN-SWA_2 186196 : 226999 60 Cronobacter_phage(36.36%) head,integrase,holin,terminase,coat attL 177480:177495|attR 231578:231593
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JVDI01000037.1|WP_049300010.1|209379_209589_+|hypothetical-protein 209379_209589_+ 69 aa aa AcrIF18.1 NA NZ_JVDI01000037.1_209588_209780_+ 186196-226999 NA
NZ_JVDI01000037.1|WP_049300009.1|208513_209164_-|hypothetical-protein 208513_209164_- 216 aa aa NA NA NZ_JVDI01000037.1_209588_209780_+ 186196-226999 NA
7. NZ_JVDI01000070
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146863 : 156241 8 Bacillus_phage(16.67%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_JVDI01000079
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58158 : 97493 47 Enterobacteria_phage(30.77%) portal,integrase,head,tail,plate,terminase,capsid attL 62402:62421|attR 98527:98546
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage