Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_APIH01000011 Listeria monocytogenes SHL008 contig11, whole genome shotgun sequence 0 crisprs NA 0 0 1 3
NZ_APIH01000014 Listeria monocytogenes SHL008 contig14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000020 Listeria monocytogenes SHL008 contig22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000010 Listeria monocytogenes SHL008 contig10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000002 Listeria monocytogenes SHL008 contig2, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 1 0
NZ_APIH01000012 Listeria monocytogenes SHL008 contig12, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_APIH01000005 Listeria monocytogenes SHL008 contig5, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_APIH01000024 Listeria monocytogenes SHL008 contig26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000006 Listeria monocytogenes SHL008 contig6, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 8 0 0
NZ_APIH01000021 Listeria monocytogenes SHL008 contig23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000013 Listeria monocytogenes SHL008 contig13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000018 Listeria monocytogenes SHL008 contig19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000019 Listeria monocytogenes SHL008 contig20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000017 Listeria monocytogenes SHL008 contig18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000001 Listeria monocytogenes SHL008 contig1, whole genome shotgun sequence 1 crisprs cas6,cas8b2,cas7,cas5,cas3,cas2 1 14 1 0
NZ_APIH01000016 Listeria monocytogenes SHL008 contig16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000023 Listeria monocytogenes SHL008 contig25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000022 Listeria monocytogenes SHL008 contig24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIH01000008 Listeria monocytogenes SHL008 contig8, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_APIH01000004 Listeria monocytogenes SHL008 contig4, whole genome shotgun sequence 1 crisprs csa3,DinG,cas3 0 0 1 0
NZ_APIH01000015 Listeria monocytogenes SHL008 contig15, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_APIH01000007 Listeria monocytogenes SHL008 contig7, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 1 0
NZ_APIH01000009 Listeria monocytogenes SHL008 contig9, whole genome shotgun sequence 0 crisprs casR,WYL 0 0 0 0
NZ_APIH01000003 Listeria monocytogenes SHL008 contig3, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_APIH01000004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIH01000004_1 245463-245617 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 164615 : 175344 17 Listeria_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_APIH01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3398 : 71508 93 Listeria_phage(83.87%) integrase,portal,protease,tRNA,plate,terminase,holin,tail,capsid NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_APIH01000011.1|WP_003731276.1|31849_32101_+|hypothetical-protein 31849_32101_+ 83 aa aa AcrIIA12 NA NA 3398-71508 yes
NZ_APIH01000011.1|WP_039381688.1|67624_67906_-|hypothetical-protein 67624_67906_- 93 aa aa NA HTH_XRE NA 3398-71508 yes
NZ_APIH01000011.1|WP_039381690.1|67902_68139_-|hypothetical-protein 67902_68139_- 78 aa aa NA HTH_XRE NA 3398-71508 yes
3. NZ_APIH01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIH01000001_1 50265-51602 Unclear I-A
20 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_APIH01000001_1 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51023-51058 36 NZ_APIH01000011.1 36294-36329 1 0.972

1. spacer 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to position: 36294-36329, mismatch: 1, identity: 0.972

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggtgacagtaatacacctcaat	Protospacer
****************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_APIH01000001_1 1.2|50370|32|NZ_APIH01000001|PILER-CR 50370-50401 32 DQ003642 Listeria phage A006, complete genome 16676-16707 0 1.0
NZ_APIH01000001_1 1.4|50360|36|NZ_APIH01000001|CRISPRCasFinder,CRT 50360-50395 36 DQ003642 Listeria phage A006, complete genome 16672-16707 0 1.0
NZ_APIH01000001_1 1.5|50425|35|NZ_APIH01000001|CRISPRCasFinder,CRT 50425-50459 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 31167-31201 0 1.0
NZ_APIH01000001_1 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51023-51058 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_APIH01000001_1 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51023-51058 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_APIH01000001_1 1.18|51280|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51280-51313 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_APIH01000001_1 1.18|51280|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51280-51313 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_APIH01000001_1 1.1|50299|37|NZ_APIH01000001|PILER-CR 50299-50335 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_APIH01000001_1 1.3|50294|37|NZ_APIH01000001|CRISPRCasFinder,CRT 50294-50330 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_APIH01000001_1 1.8|50623|36|NZ_APIH01000001|CRISPRCasFinder,CRT 50623-50658 36 KJ094023 Listeria phage LP-101, complete genome 17910-17945 1 0.972
NZ_APIH01000001_1 1.1|50299|37|NZ_APIH01000001|PILER-CR 50299-50335 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_APIH01000001_1 1.3|50294|37|NZ_APIH01000001|CRISPRCasFinder,CRT 50294-50330 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_APIH01000001_1 1.13|50958|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 50958-50993 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 26132-26167 2 0.944
NZ_APIH01000001_1 1.19|51343|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51343-51378 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_APIH01000001_1 1.8|50623|36|NZ_APIH01000001|CRISPRCasFinder,CRT 50623-50658 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 227438-227473 4 0.889
NZ_APIH01000001_1 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51474-51509 36 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 3844-3879 4 0.889
NZ_APIH01000001_1 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51474-51509 36 HI504184 Sequence 26 from Patent EP2147092 3844-3879 4 0.889
NZ_APIH01000001_1 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51474-51509 36 AJ417489 bacteriophage U153 int gene for U153 integrase 3844-3879 4 0.889
NZ_APIH01000001_1 1.19|51343|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51343-51378 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_APIH01000001_1 1.16|51151|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51151-51184 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_APIH01000001_1 1.9|50688|46|NZ_APIH01000001|CRISPRCasFinder,CRT 50688-50733 46 KJ094023 Listeria phage LP-101, complete genome 18341-18386 8 0.826
NZ_APIH01000001_1 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51474-51509 36 NC_019743 Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence 4997-5032 8 0.778
NZ_APIH01000001_1 1.5|50425|35|NZ_APIH01000001|CRISPRCasFinder,CRT 50425-50459 35 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 176358-176392 9 0.743
NZ_APIH01000001_1 1.16|51151|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR 51151-51184 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_APIH01000001_1 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT 51539-51573 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743

1. spacer 1.2|50370|32|NZ_APIH01000001|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

cagtacaagcaagggttattgagttaaatatt	CRISPR spacer
cagtacaagcaagggttattgagttaaatatt	Protospacer
********************************

2. spacer 1.4|50360|36|NZ_APIH01000001|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

3. spacer 1.5|50425|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 0, identity: 1.0

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
attaatgataagagcggaaagaaaactttcaaggg	Protospacer
***********************************

4. spacer 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

5. spacer 1.14|51023|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

6. spacer 1.18|51280|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

7. spacer 1.18|51280|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

8. spacer 1.1|50299|37|NZ_APIH01000001|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

9. spacer 1.3|50294|37|NZ_APIH01000001|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

10. spacer 1.8|50623|36|NZ_APIH01000001|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccgaattg	Protospacer
********************************.***

11. spacer 1.1|50299|37|NZ_APIH01000001|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

12. spacer 1.3|50294|37|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

13. spacer 1.13|50958|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 2, identity: 0.944

gtccacatcgacaataaaaaacacattgtatcactt	CRISPR spacer
gtccacattgacaacaaaaaacacattgtatcactt	Protospacer
********.*****.*********************

14. spacer 1.19|51343|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

15. spacer 1.8|50623|36|NZ_APIH01000001|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 4, identity: 0.889

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccttgctc	Protospacer
******************************  *.* 

16. spacer 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

17. spacer 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

18. spacer 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

19. spacer 1.19|51343|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

20. spacer 1.16|51151|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

21. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

22. spacer 1.9|50688|46|NZ_APIH01000001|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 8, identity: 0.826

aaaaataaataagttcaaaacctcccacacccgctatgaataaatt	CRISPR spacer
tcagcttccaaagttcaaaacctcccacacccgctatgaataaatt	Protospacer
  *. *    ************************************

23. spacer 1.21|51474|36|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to NC_019743 (Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence) position: , mismatch: 8, identity: 0.778

gtgtaattcttaattccgtattgattcgctagtttt---	CRISPR spacer
gtgtaattcttactgccgtattgatt---taactctgaa	Protospacer
************ * ***********   **..*.*   

24. spacer 1.5|50425|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.743

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
gaaattaaaaagagagcaaagaaaactttcaagga	Protospacer
.  * *.* ***** * *****************.

25. spacer 1.16|51151|34|NZ_APIH01000001|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

26. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

27. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

28. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

29. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

30. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

31. spacer 1.22|51539|35|NZ_APIH01000001|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 614910 : 622332 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_APIH01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIH01000006_1 237389-238283 TypeII II-A,II-B
13 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 MH299806 Listeria phage LP-KV022, complete genome 52817-52846 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 MN114083 Listeria phage LP-013, complete genome 48513-48542 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 NC_021785 Listeria phage LP-110, complete genome 10535-10564 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 10007-10036 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 MN128593 Listeria phage LP-031, complete genome 47633-47662 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 NC_021787 Listeria phage LP-037, complete genome 5014-5043 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 JX442241 Listeria phage P70, complete genome 54951-54980 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 KJ094020 Listeria phage LP-026, complete genome 31166-31195 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 KJ094021 Listeria phage LP-114, complete genome 38339-38368 0 1.0
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 MN114082 Listeria phage LP-010, complete genome 47798-47827 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MT438761 Listeria virus P61, complete genome 7010-7039 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131100-131129 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1258-1287 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MT178766 Listeria virus P100plus, complete genome 96120-96149 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 NC_047872 Listeria phage LMTA-94, complete genome 2498-2527 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MT178767 Listeria virus P200, complete genome 96121-96150 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ591605 Listeria phage LMTA-57, complete genome 12879-12908 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MN128594 Listeria phage LP-066, complete genome 131590-131619 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 NC_042048 Listeria phage LMTA-34, complete genome 8562-8591 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6613-6642 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 NC_041862 Listeria phage LP-064, complete genome 3914-3943 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ094030 Listeria phage LP-083-2, complete genome 981-1010 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 JX126918 Listeria phage LP-125, complete genome 3914-3943 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 NC_024360 Listeria phage LMSP-25, complete genome 8562-8591 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 129717-129746 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ094031 Listeria phage LP-124, complete genome 98866-98895 0 1.0
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 DQ003638 Listeria phage A511, complete genome 129539-129568 0 1.0
NZ_APIH01000006_1 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT 238086-238115 30 KJ094023 Listeria phage LP-101, complete genome 13151-13180 0 1.0
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 MN172529 Listeria phage LP-039, complete genome 129892-129921 1 0.967
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 NC_025440 Listeria phage WIL-1, complete genome 38247-38276 1 0.967
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 DQ003638 Listeria phage A511, complete genome 129021-129050 1 0.967
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ591604 Listeria phage LMTA-148, complete genome 6287-6316 1 0.967
NZ_APIH01000006_1 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237755-237784 30 KJ094033 Listeria phage LP-048, complete genome 132349-132378 1 0.967
NZ_APIH01000006_1 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT 238086-238115 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 222678-222707 1 0.967
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 MN904502 Listeria phage LP-018, complete genome 47792-47821 2 0.933
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1776-1805 2 0.933
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 MT178766 Listeria virus P100plus, complete genome 96638-96667 2 0.933
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 NC_025440 Listeria phage WIL-1, complete genome 37729-37758 2 0.933
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 MT178767 Listeria virus P200, complete genome 96639-96668 2 0.933
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 KJ591605 Listeria phage LMTA-57, complete genome 12361-12390 2 0.933
NZ_APIH01000006_1 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237491-237520 30 JB137888 Sequence 7 from Patent WO2012159774 340-369 3 0.9
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6095-6124 3 0.9
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 NC_047872 Listeria phage LMTA-94, complete genome 1980-2009 3 0.9
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 NC_042048 Listeria phage LMTA-34, complete genome 9080-9109 3 0.9
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 NC_024360 Listeria phage LMSP-25, complete genome 9080-9109 3 0.9
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131618-131647 4 0.867
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 MN128594 Listeria phage LP-066, complete genome 132108-132137 4 0.867
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 NC_041862 Listeria phage LP-064, complete genome 4432-4461 4 0.867
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 KJ094030 Listeria phage LP-083-2, complete genome 1499-1528 4 0.867
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 JX126918 Listeria phage LP-125, complete genome 4432-4461 4 0.867
NZ_APIH01000006_1 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237821-237850 30 KJ094031 Listeria phage LP-124, complete genome 99384-99413 4 0.867
NZ_APIH01000006_1 1.1|237425|30|NZ_APIH01000006|CRISPRCasFinder,CRT 237425-237454 30 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 223230-223259 8 0.733
NZ_APIH01000006_1 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237689-237718 30 NC_012970 Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence 63330-63359 8 0.733
NZ_APIH01000006_1 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237689-237718 30 MN552143 Lactococcus phage P1046, complete genome 19997-20026 8 0.733
NZ_APIH01000006_1 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237689-237718 30 NC_010576 Lactococcus phage 1706, complete genome 21200-21229 8 0.733
NZ_APIH01000006_1 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237689-237718 30 MK779875 Lactococcus phage CHPC971, complete genome 20962-20991 8 0.733
NZ_APIH01000006_1 1.8|237887|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR 237887-237916 30 MN035989 Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds 382-411 8 0.733
NZ_APIH01000006_1 1.13|238218|30|NZ_APIH01000006|CRISPRCasFinder,CRT 238218-238247 30 MN855765 Myoviridae sp. isolate 14, complete genome 24949-24978 8 0.733
NZ_APIH01000006_1 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT 238086-238115 30 NZ_LR136959 Alteromonas sp. 76-1 plasmid pAlt76, complete sequence 31734-31763 9 0.7

1. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

2. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

3. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

4. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

5. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

6. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

7. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

8. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

9. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

10. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

11. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

12. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

13. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

14. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

15. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

16. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

17. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

18. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

19. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

20. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

21. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

22. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

23. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

24. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

25. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

26. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

27. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 0, identity: 1.0

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcatta	Protospacer
******************************

28. spacer 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
ttgggcaaaatgaccgtaataaatccattc	Protospacer
******************************

29. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

30. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

31. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

32. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

33. spacer 1.6|237755|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

34. spacer 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
ttgagcaaaatgaccgtaataaatccattc	Protospacer
***.**************************

35. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 2, identity: 0.933

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaaaatag	Protospacer
************************* **.*

36. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcctca	Protospacer
************************** *.*

37. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

38. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

39. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

40. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

41. spacer 1.2|237491|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 3, identity: 0.9

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataacagtactaatatag	Protospacer
***************** **.*******.*

42. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcacca	Protospacer
***********.***************..*

43. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

44. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

45. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

46. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

47. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

48. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

49. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

50. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

51. spacer 1.7|237821|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

52. spacer 1.1|237425|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gcaatagaccagttaggtgtcacaggtgcg	CRISPR spacer
gccatagaccagttcggtgtcactcagccc	Protospacer
** *********** ********  .  * 

53. spacer 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_012970 (Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
taatatttttcaatgctgcaactgctgtcg	Protospacer
 ****** **********.*****. .  *

54. spacer 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MN552143 (Lactococcus phage P1046, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

55. spacer 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to NC_010576 (Lactococcus phage 1706, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

56. spacer 1.5|237689|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MK779875 (Lactococcus phage CHPC971, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

57. spacer 1.8|237887|30|NZ_APIH01000006|CRISPRCasFinder,CRT,PILER-CR matches to MN035989 (Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds) position: , mismatch: 8, identity: 0.733

------tttttcacgtttgtactgtctctcctcgta	CRISPR spacer
gggaaat------cgtttctactgtctctcttcgta	Protospacer
      *      ***** ***********.*****

58. spacer 1.13|238218|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to MN855765 (Myoviridae sp. isolate 14, complete genome) position: , mismatch: 8, identity: 0.733

agtgatggggaagagattgaacttatgttt	CRISPR spacer
gctgatgggaaagaggttgaacttaaaggt	Protospacer
. *******.*****.********* .  *

59. spacer 1.11|238086|30|NZ_APIH01000006|CRISPRCasFinder,CRT matches to NZ_LR136959 (Alteromonas sp. 76-1 plasmid pAlt76, complete sequence) position: , mismatch: 9, identity: 0.7

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
gctttcaaaatgatcgtaataaatcaatag	Protospacer
 .   ********.*********** **  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_APIH01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2445 : 10731 8 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 91830 : 122750 34 Erysipelothrix_phage(70.37%) terminase,protease,tail,head,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_APIH01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74888 : 82730 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_APIH01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20747 : 77598 56 Bacillus_virus(15.0%) tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_APIH01000015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIH01000015_1 4471-5055 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage