Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_APIC01000015 Listeria monocytogenes SHL002 contig15, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_APIC01000008 Listeria monocytogenes SHL002 contig8, whole genome shotgun sequence 0 crisprs WYL,csa3 0 0 1 0
NZ_APIC01000007 Listeria monocytogenes SHL002 contig7, whole genome shotgun sequence 1 crisprs RT,cas6,cas8b2,cas7,cas5,cas3,cas2 2 14 1 1
NZ_APIC01000019 Listeria monocytogenes SHL002 contig19, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000006 Listeria monocytogenes SHL002 contig6, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_APIC01000020 Listeria monocytogenes SHL002 contig20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000009 Listeria monocytogenes SHL002 contig9, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_APIC01000017 Listeria monocytogenes SHL002 contig17, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_APIC01000002 Listeria monocytogenes SHL002 contig2, whole genome shotgun sequence 0 crisprs DEDDh,cas3 0 0 2 0
NZ_APIC01000005 Listeria monocytogenes SHL002 contig5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000016 Listeria monocytogenes SHL002 contig16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000013 Listeria monocytogenes SHL002 contig13, whole genome shotgun sequence 0 crisprs csa3,cas5 0 0 1 0
NZ_APIC01000001 Listeria monocytogenes SHL002 contig1, whole genome shotgun sequence 2 crisprs DinG,csa3,cas9,cas1,cas2,csn2 2 9 1 0
NZ_APIC01000004 Listeria monocytogenes SHL002 contig4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000018 Listeria monocytogenes SHL002 contig18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000003 Listeria monocytogenes SHL002 contig3, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_APIC01000021 Listeria monocytogenes SHL002 contig21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000012 Listeria monocytogenes SHL002 contig12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000014 Listeria monocytogenes SHL002 contig14, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_APIC01000010 Listeria monocytogenes SHL002 contig10, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_APIC01000022 Listeria monocytogenes SHL002 contig22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_APIC01000011 Listeria monocytogenes SHL002 contig11, whole genome shotgun sequence 0 crisprs casR,WYL 0 0 0 0

Results visualization

1. NZ_APIC01000014
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 35716 55 Listeria_phage(96.15%) portal,holin,tail,capsid,terminase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_APIC01000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIC01000010_1 3107-3691 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_APIC01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31112 : 34374 6 Listeria_phage(100.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_APIC01000015.1|WP_003731276.1|31377_31629_+|hypothetical-protein 31377_31629_+ 83 aa aa AcrIIA12 NA NA 31112-34374 NA
4. NZ_APIC01000013
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25454 : 34299 10 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_APIC01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIC01000001_1 26843-26997 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIC01000001_2 510230-511123 TypeII II-A,II-B
13 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_APIC01000001_2 2.11|510859|31|NZ_APIC01000001|CRISPRCasFinder,CRT 510859-510889 31 NZ_APIC01000007.1 204380-204410 0 1.0
NZ_APIC01000001_2 2.15|510861|29|NZ_APIC01000001|PILER-CR 510861-510889 29 NZ_APIC01000007.1 204381-204409 0 1.0

1. spacer 2.11|510859|31|NZ_APIC01000001|CRISPRCasFinder,CRT matches to position: 204380-204410, mismatch: 0, identity: 1.0

tatagtctgttttttcgtaagtgagcagcgc	CRISPR spacer
tatagtctgttttttcgtaagtgagcagcgc	Protospacer
*******************************

2. spacer 2.15|510861|29|NZ_APIC01000001|PILER-CR matches to position: 204381-204409, mismatch: 0, identity: 1.0

atagtctgttttttcgtaagtgagcagcg	CRISPR spacer
atagtctgttttttcgtaagtgagcagcg	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 MH299806 Listeria phage LP-KV022, complete genome 52817-52846 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 MN114083 Listeria phage LP-013, complete genome 48513-48542 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 NC_021785 Listeria phage LP-110, complete genome 10535-10564 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 KJ094026 Listeria phage LP-032 contig 3, partial genome 10007-10036 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 MN128593 Listeria phage LP-031, complete genome 47633-47662 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 NC_021787 Listeria phage LP-037, complete genome 5014-5043 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 JX442241 Listeria phage P70, complete genome 54951-54980 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 KJ094020 Listeria phage LP-026, complete genome 31166-31195 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 KJ094021 Listeria phage LP-114, complete genome 38339-38368 0 1.0
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 MN114082 Listeria phage LP-010, complete genome 47798-47827 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MT438761 Listeria virus P61, complete genome 7010-7039 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131100-131129 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1258-1287 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MT178766 Listeria virus P100plus, complete genome 96120-96149 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 NC_047872 Listeria phage LMTA-94, complete genome 2498-2527 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MT178767 Listeria virus P200, complete genome 96121-96150 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ591605 Listeria phage LMTA-57, complete genome 12879-12908 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MN128594 Listeria phage LP-066, complete genome 131590-131619 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 NC_042048 Listeria phage LMTA-34, complete genome 8562-8591 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6613-6642 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 NC_041862 Listeria phage LP-064, complete genome 3914-3943 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ094030 Listeria phage LP-083-2, complete genome 981-1010 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 JX126918 Listeria phage LP-125, complete genome 3914-3943 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 NC_024360 Listeria phage LMSP-25, complete genome 8562-8591 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 JQ797329 Listeria phage vB_LmoM_AG20, complete genome 129717-129746 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ094031 Listeria phage LP-124, complete genome 98866-98895 0 1.0
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 DQ003638 Listeria phage A511, complete genome 129539-129568 0 1.0
NZ_APIC01000001_2 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT 510926-510955 30 KJ094023 Listeria phage LP-101, complete genome 13151-13180 0 1.0
NZ_APIC01000001_2 2.16|510928|28|NZ_APIC01000001|PILER-CR 510928-510955 28 KJ094023 Listeria phage LP-101, complete genome 13152-13179 0 1.0
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 MN172529 Listeria phage LP-039, complete genome 129892-129921 1 0.967
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 NC_025440 Listeria phage WIL-1, complete genome 38247-38276 1 0.967
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 DQ003638 Listeria phage A511, complete genome 129021-129050 1 0.967
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ591604 Listeria phage LMTA-148, complete genome 6287-6316 1 0.967
NZ_APIC01000001_2 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510595-510624 30 KJ094033 Listeria phage LP-048, complete genome 132349-132378 1 0.967
NZ_APIC01000001_2 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT 510926-510955 30 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 222678-222707 1 0.967
NZ_APIC01000001_2 2.16|510928|28|NZ_APIC01000001|PILER-CR 510928-510955 28 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 222679-222706 1 0.964
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 MN904502 Listeria phage LP-018, complete genome 47792-47821 2 0.933
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 KJ668718 Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds 1776-1805 2 0.933
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 MT178766 Listeria virus P100plus, complete genome 96638-96667 2 0.933
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 NC_025440 Listeria phage WIL-1, complete genome 37729-37758 2 0.933
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 MT178767 Listeria virus P200, complete genome 96639-96668 2 0.933
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 KJ591605 Listeria phage LMTA-57, complete genome 12361-12390 2 0.933
NZ_APIC01000001_2 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510332-510361 30 JB137888 Sequence 7 from Patent WO2012159774 340-369 3 0.9
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 MK792752 UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome 6095-6124 3 0.9
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 NC_047872 Listeria phage LMTA-94, complete genome 1980-2009 3 0.9
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 NC_042048 Listeria phage LMTA-34, complete genome 9080-9109 3 0.9
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 NC_024360 Listeria phage LMSP-25, complete genome 9080-9109 3 0.9
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 MT668624 Listeria phage LP-Mix_6.2, complete genome 131618-131647 4 0.867
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 MN128594 Listeria phage LP-066, complete genome 132108-132137 4 0.867
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 NC_041862 Listeria phage LP-064, complete genome 4432-4461 4 0.867
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 KJ094030 Listeria phage LP-083-2, complete genome 1499-1528 4 0.867
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 JX126918 Listeria phage LP-125, complete genome 4432-4461 4 0.867
NZ_APIC01000001_2 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510661-510690 30 KJ094031 Listeria phage LP-124, complete genome 99384-99413 4 0.867
NZ_APIC01000001_2 2.16|510928|28|NZ_APIC01000001|PILER-CR 510928-510955 28 NZ_LR136959 Alteromonas sp. 76-1 plasmid pAlt76, complete sequence 31735-31762 7 0.75
NZ_APIC01000001_2 2.1|510266|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510266-510295 30 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 223230-223259 8 0.733
NZ_APIC01000001_2 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510529-510558 30 NC_012970 Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence 63330-63359 8 0.733
NZ_APIC01000001_2 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510529-510558 30 MN552143 Lactococcus phage P1046, complete genome 19997-20026 8 0.733
NZ_APIC01000001_2 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510529-510558 30 NC_010576 Lactococcus phage 1706, complete genome 21200-21229 8 0.733
NZ_APIC01000001_2 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510529-510558 30 MK779875 Lactococcus phage CHPC971, complete genome 20962-20991 8 0.733
NZ_APIC01000001_2 2.8|510727|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT 510727-510756 30 MN035989 Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds 382-411 8 0.733
NZ_APIC01000001_2 2.14|511058|30|NZ_APIC01000001|CRISPRCasFinder,CRT 511058-511087 30 MN855765 Myoviridae sp. isolate 14, complete genome 24949-24978 8 0.733
NZ_APIC01000001_2 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT 510926-510955 30 NZ_LR136959 Alteromonas sp. 76-1 plasmid pAlt76, complete sequence 31734-31763 9 0.7

1. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

2. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

3. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

4. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

5. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

6. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

7. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

8. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

9. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

10. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaatatgg	Protospacer
******************************

11. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT438761 (Listeria virus P61, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

12. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

13. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

14. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

15. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

16. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

17. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

18. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

19. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

20. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

21. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

22. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

23. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

24. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

25. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to JQ797329 (Listeria phage vB_LmoM_AG20, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

26. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 0, identity: 1.0

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttattgtctgctaagaatactacta	Protospacer
******************************

27. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 0, identity: 1.0

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcatta	Protospacer
******************************

28. spacer 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
ttgggcaaaatgaccgtaataaatccattc	Protospacer
******************************

29. spacer 2.16|510928|28|NZ_APIC01000001|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

tgggcaaaatgaccgtaataaatccatt	CRISPR spacer
tgggcaaaatgaccgtaataaatccatt	Protospacer
****************************

30. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN172529 (Listeria phage LP-039, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

31. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

32. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to DQ003638 (Listeria phage A511, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

33. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ591604 (Listeria phage LMTA-148, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

34. spacer 2.6|510595|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094033 (Listeria phage LP-048, complete genome) position: , mismatch: 1, identity: 0.967

tacttttattgtctgctaagaatactacta	CRISPR spacer
tacttttgttgtctgctaagaatactacta	Protospacer
*******.**********************

35. spacer 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
ttgagcaaaatgaccgtaataaatccattc	Protospacer
***.**************************

36. spacer 2.16|510928|28|NZ_APIC01000001|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.964

tgggcaaaatgaccgtaataaatccatt	CRISPR spacer
tgagcaaaatgaccgtaataaatccatt	Protospacer
**.*************************

37. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 2, identity: 0.933

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataactgtgctaaaatag	Protospacer
************************* **.*

38. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ668718 (Listeria phage LMTA-34 hypothetical proteins and DNA modification protein genes, complete cds) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaattccaagtaactcatcctca	Protospacer
************************** *.*

39. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

40. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_025440 (Listeria phage WIL-1, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

41. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

42. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 2, identity: 0.933

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcatca	Protospacer
***********.****************.*

43. spacer 2.2|510332|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 3, identity: 0.9

gatagtagtataataactgtgctaatatgg	CRISPR spacer
gatagtagtataataacagtactaatatag	Protospacer
***************** **.*******.*

44. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK792752 (UNVERIFIED: Listera phage vB-LmoM-SH3-3, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcatcacca	Protospacer
***********.***************..*

45. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

46. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

47. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 3, identity: 0.9

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcgtcatca	Protospacer
***********.***********.****.*

48. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

49. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

50. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

51. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

52. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

53. spacer 2.7|510661|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 4, identity: 0.867

attgtacaaattccaagtaactcatcatta	CRISPR spacer
attgtacaaatcccaagtaactcattgtca	Protospacer
***********.*************..*.*

54. spacer 2.16|510928|28|NZ_APIC01000001|PILER-CR matches to NZ_LR136959 (Alteromonas sp. 76-1 plasmid pAlt76, complete sequence) position: , mismatch: 7, identity: 0.75

tgggcaaaatgaccgtaataaatccatt	CRISPR spacer
ctttcaaaatgatcgtaataaatcaata	Protospacer
.   ********.*********** ** 

55. spacer 2.1|510266|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gcaatagaccagttaggtgtcacaggtgcg	CRISPR spacer
gccatagaccagttcggtgtcactcagccc	Protospacer
** *********** ********  .  * 

56. spacer 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_012970 (Methylovorus glucosetrophus SIP3-4 plasmid pMsip01, complete sequence) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
taatatttttcaatgctgcaactgctgtcg	Protospacer
 ****** **********.*****. .  *

57. spacer 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN552143 (Lactococcus phage P1046, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

58. spacer 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to NC_010576 (Lactococcus phage 1706, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

59. spacer 2.5|510529|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MK779875 (Lactococcus phage CHPC971, complete genome) position: , mismatch: 8, identity: 0.733

aaatattattcaatgctgtaactgtaaaag	CRISPR spacer
ctaatctattcaatgcagtaactgtaactg	Protospacer
  *  .********** **********  *

60. spacer 2.8|510727|30|NZ_APIC01000001|PILER-CR,CRISPRCasFinder,CRT matches to MN035989 (Leviviridae sp. isolate H3_Bulk_41_scaffold_462 RNA-dependent RNA polymerase (H3Bulk41462_000001), hypothetical protein (H3Bulk41462_000002), hypothetical protein (H3Bulk41462_000003), and hypothetical protein (H3Bulk41462_000004) genes, complete cds) position: , mismatch: 8, identity: 0.733

------tttttcacgtttgtactgtctctcctcgta	CRISPR spacer
gggaaat------cgtttctactgtctctcttcgta	Protospacer
      *      ***** ***********.*****

61. spacer 2.14|511058|30|NZ_APIC01000001|CRISPRCasFinder,CRT matches to MN855765 (Myoviridae sp. isolate 14, complete genome) position: , mismatch: 8, identity: 0.733

agtgatggggaagagattgaacttatgttt	CRISPR spacer
gctgatgggaaagaggttgaacttaaaggt	Protospacer
. *******.*****.********* .  *

62. spacer 2.12|510926|30|NZ_APIC01000001|CRISPRCasFinder,CRT matches to NZ_LR136959 (Alteromonas sp. 76-1 plasmid pAlt76, complete sequence) position: , mismatch: 9, identity: 0.7

ttgggcaaaatgaccgtaataaatccattc	CRISPR spacer
gctttcaaaatgatcgtaataaatcaatag	Protospacer
 .   ********.*********** **  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 97145 : 107874 17 Listeria_phage(40.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_APIC01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74689 : 82531 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_APIC01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_APIC01000007_1 49519-50846 Unclear I-A
20 spacers
cas2,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_APIC01000007_1 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50267-50302 36 NZ_APIC01000014.1 1401-1436 0 1.0
NZ_APIC01000007_1 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50524-50557 34 NZ_APIC01000014.1 794-827 0 1.0

1. spacer 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to position: 1401-1436, mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

2. spacer 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to position: 794-827, mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_APIC01000007_1 1.2|49624|32|NZ_APIC01000007|PILER-CR 49624-49655 32 DQ003642 Listeria phage A006, complete genome 16676-16707 0 1.0
NZ_APIC01000007_1 1.4|49614|36|NZ_APIC01000007|CRISPRCasFinder,CRT 49614-49649 36 DQ003642 Listeria phage A006, complete genome 16672-16707 0 1.0
NZ_APIC01000007_1 1.5|49679|35|NZ_APIC01000007|CRISPRCasFinder,CRT 49679-49713 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 31167-31201 0 1.0
NZ_APIC01000007_1 1.9|49942|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 49942-49977 36 KJ094023 Listeria phage LP-101, complete genome 18341-18376 0 1.0
NZ_APIC01000007_1 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50267-50302 36 NC_003216 Listeria phage A118, complete genome 18563-18598 0 1.0
NZ_APIC01000007_1 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50267-50302 36 AJ242593 Bacteriophage A118 complete genome 18563-18598 0 1.0
NZ_APIC01000007_1 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50524-50557 34 NC_003216 Listeria phage A118, complete genome 19172-19205 0 1.0
NZ_APIC01000007_1 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50524-50557 34 AJ242593 Bacteriophage A118 complete genome 19172-19205 0 1.0
NZ_APIC01000007_1 1.1|49553|37|NZ_APIC01000007|PILER-CR 49553-49589 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_APIC01000007_1 1.3|49548|37|NZ_APIC01000007|CRISPRCasFinder,CRT 49548-49584 37 KJ094023 Listeria phage LP-101, complete genome 9186-9222 1 0.973
NZ_APIC01000007_1 1.8|49877|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 49877-49912 36 KJ094023 Listeria phage LP-101, complete genome 17910-17945 1 0.972
NZ_APIC01000007_1 1.1|49553|37|NZ_APIC01000007|PILER-CR 49553-49589 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_APIC01000007_1 1.3|49548|37|NZ_APIC01000007|CRISPRCasFinder,CRT 49548-49584 37 MT500540 Listeria phage LP-HM00113468, complete genome 35729-35765 2 0.946
NZ_APIC01000007_1 1.13|50202|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50202-50237 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 26132-26167 2 0.944
NZ_APIC01000007_1 1.19|50587|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50587-50622 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 41996-42031 3 0.917
NZ_APIC01000007_1 1.8|49877|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 49877-49912 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 227438-227473 4 0.889
NZ_APIC01000007_1 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50718-50753 36 FW590615 JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME 3844-3879 4 0.889
NZ_APIC01000007_1 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50718-50753 36 HI504184 Sequence 26 from Patent EP2147092 3844-3879 4 0.889
NZ_APIC01000007_1 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50718-50753 36 AJ417489 bacteriophage U153 int gene for U153 integrase 3844-3879 4 0.889
NZ_APIC01000007_1 1.19|50587|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50587-50622 36 KJ094023 Listeria phage LP-101, complete genome 32760-32795 5 0.861
NZ_APIC01000007_1 1.16|50395|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50395-50428 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1764851-1764884 6 0.824
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 MN694189 Marine virus AFVG_250M578, complete genome 47879-47913 6 0.829
NZ_APIC01000007_1 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50718-50753 36 NC_019743 Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence 4997-5032 8 0.778
NZ_APIC01000007_1 1.5|49679|35|NZ_APIC01000007|CRISPRCasFinder,CRT 49679-49713 35 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 176358-176392 9 0.743
NZ_APIC01000007_1 1.16|50395|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR 50395-50428 34 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 39302-39335 9 0.735
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 MK448625 Streptococcus satellite phage Javan738, complete genome 5960-5994 9 0.743
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 MK448449 Streptococcus satellite phage Javan356, complete genome 4490-4524 9 0.743
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 MK448636 Streptococcus satellite phage Javan749, complete genome 6112-6146 9 0.743
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 NZ_CP045037 Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence 34734-34768 9 0.743
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 NZ_CP018177 Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence 11325-11359 9 0.743
NZ_APIC01000007_1 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT 50783-50817 35 NZ_CP018181 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence 63608-63642 9 0.743

1. spacer 1.2|49624|32|NZ_APIC01000007|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

cagtacaagcaagggttattgagttaaatatt	CRISPR spacer
cagtacaagcaagggttattgagttaaatatt	Protospacer
********************************

2. spacer 1.4|49614|36|NZ_APIC01000007|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

attacagtacaagcaagggttattgagttaaatatt	CRISPR spacer
attacagtacaagcaagggttattgagttaaatatt	Protospacer
************************************

3. spacer 1.5|49679|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 0, identity: 1.0

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
attaatgataagagcggaaagaaaactttcaaggg	Protospacer
***********************************

4. spacer 1.9|49942|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aagttcaaaacctcccacacccgctatgaataaatt	CRISPR spacer
aagttcaaaacctcccacacccgctatgaataaatt	Protospacer
************************************

5. spacer 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

6. spacer 1.14|50267|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

ctggttactcaactggcgacagtaatacacctcaat	CRISPR spacer
ctggttactcaactggcgacagtaatacacctcaat	Protospacer
************************************

7. spacer 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

8. spacer 1.18|50524|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 0, identity: 1.0

agaagcgttagcggcattgttcgaaagtaattta	CRISPR spacer
agaagcgttagcggcattgttcgaaagtaattta	Protospacer
**********************************

9. spacer 1.1|49553|37|NZ_APIC01000007|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

10. spacer 1.3|49548|37|NZ_APIC01000007|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaaacctagagcatcaaattgttcccatgc	Protospacer
************* ***********************

11. spacer 1.8|49877|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccgaattg	Protospacer
********************************.***

12. spacer 1.1|49553|37|NZ_APIC01000007|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

13. spacer 1.3|49548|37|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 2, identity: 0.946

caatgcttaaaccgagagcatcaaattgttcccatgc	CRISPR spacer
caatgcttaacccaagagcatcaaattgttcccatgc	Protospacer
********** **.***********************

14. spacer 1.13|50202|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 2, identity: 0.944

gtccacatcgacaataaaaaacacattgtatcactt	CRISPR spacer
gtccacattgacaacaaaaaacacattgtatcactt	Protospacer
********.*****.*********************

15. spacer 1.19|50587|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 3, identity: 0.917

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
tataaaatattgtccaatgtgtggaaggagtttggg	Protospacer
************.********.*************.

16. spacer 1.8|49877|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 4, identity: 0.889

cttcctactttttgacataaaaaataagccgagttg	CRISPR spacer
cttcctactttttgacataaaaaataagccttgctc	Protospacer
******************************  *.* 

17. spacer 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to FW590615 (JP 2010534058-A/25: ANTIBIOTIC RESISTANCE FREE LISTERIA STRAINS AND METHODS FOR CONSTRUCTING AND USING SAME) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

18. spacer 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to HI504184 (Sequence 26 from Patent EP2147092) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

19. spacer 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to AJ417489 (bacteriophage U153 int gene for U153 integrase) position: , mismatch: 4, identity: 0.889

gtgtaattcttaattccgtattgattcgctagtttt	CRISPR spacer
ttataatccttaattccgtattgatttgctagtttt	Protospacer
 *.****.******************.*********

20. spacer 1.19|50587|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 5, identity: 0.861

tataaaatattgcccaatgtgcggaaggagtttgga	CRISPR spacer
cattgaattttgcccaatgtgcggaaggagcttgga	Protospacer
.** .*** *********************.*****

21. spacer 1.16|50395|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

agaaaaaaaacatctttccaatttgttgttttgc	CRISPR spacer
agcaaaaaaacatctttcctatttgttttatcac	Protospacer
** **************** ******* * *..*

22. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MN694189 (Marine virus AFVG_250M578, complete genome) position: , mismatch: 6, identity: 0.829

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
taataaaaaatgagggcttagaaaatgaaaaaatt	Protospacer
*  *.*** ******.***************** *

23. spacer 1.21|50718|36|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NC_019743 (Microcoleus sp. PCC 7113 plasmid pMIC7113.08, complete sequence) position: , mismatch: 8, identity: 0.778

gtgtaattcttaattccgtattgattcgctagtttt---	CRISPR spacer
gtgtaattcttactgccgtattgatt---taactctgaa	Protospacer
************ * ***********   **..*.*   

24. spacer 1.5|49679|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.743

attaatgataagagcggaaagaaaactttcaaggg	CRISPR spacer
gaaattaaaaagagagcaaagaaaactttcaagga	Protospacer
.  * *.* ***** * *****************.

25. spacer 1.16|50395|34|NZ_APIC01000007|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

agaaaaaaaacatctttccaatttgttgttttgc-----	CRISPR spacer
aagaaaaaaacatatttccaatt-----ttttccaaaaa	Protospacer
*..********** *********     **** *     

26. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MK448625 (Streptococcus satellite phage Javan738, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

27. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MK448449 (Streptococcus satellite phage Javan356, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtatgaactatgaggacttagaaagtgaagacctg	Protospacer
 * **** ****************.****.*    

28. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
gtctgaactatgaggacttagaaagtgaagacctg	Protospacer
 *.**** ****************.****.*    

29. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to NZ_CP045037 (Lactobacillus mali strain LM596 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

30. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

31. spacer 1.22|50783|35|NZ_APIC01000007|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.743

ttttgaaatatgaggacttagaaaatgaaaaaaat	CRISPR spacer
ttaagaaatataaggacttagtaaatgaagttatg	Protospacer
**  *******.********* *******.  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 174774 : 206599 44 Listeria_phage(48.48%) head,integrase,protease,capsid,tail,terminase,portal,holin attL 167343:167357|attR 188575:188589
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_APIC01000007.1|WP_039378866.1|182709_183111_+|hypothetical-protein 182709_183111_+ 133 aa aa NA NA NA 174774-206599 yes
8. NZ_APIC01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 123417 : 130839 8 Hokovirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_APIC01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5808 : 14103 8 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 95222 : 126142 34 Erysipelothrix_phage(70.37%) capsid,protease,terminase,tail,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_APIC01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1645 : 60254 56 Streptococcus_phage(15.79%) protease,tRNA NA
DBSCAN-SWA_2 419812 : 466908 71 Listeria_phage(98.55%) holin,plate,terminase,integrase,head attL 419259:419278|attR 466942:466961
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage