Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_KK211191 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00002.2, whole genome shotgun sequence 0 crisprs DinG 0 0 1 1
NZ_JHZR01000002 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00001.1_C, whole genome shotgun sequence 1 crisprs WYL,casR,RT,cas3,DEDDh 3 8 2 2
NZ_JHZR01000010 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00007.7_C, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_JHZR01000005 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00003.3_C, whole genome shotgun sequence 0 crisprs DinG,csa3 0 0 0 0
NZ_JHZR01000009 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00006.6_C, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JHZR01000008 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00005.5_C, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_JHZR01000012 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00009.9_C, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_JHZR01000001 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00010.10_C, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KK211192 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00004.4, whole genome shotgun sequence 1 crisprs csa3,WYL 0 0 1 0
NZ_JHZR01000011 Listeria monocytogenes Lm25180 P892DRAFT_scaffold00008.8_C, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_KK211191
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 509327 : 549328 64 Listeria_phage(94.83%) tail,terminase,holin NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_KK211191.1|WP_003731276.1|510125_510377_+|hypothetical-protein 510125_510377_+ 83 aa aa AcrIIA12 NA NA 509327-549328 NA
2. NZ_JHZR01000002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JHZR01000002_1 286780-287128 Orphan I-A
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_JHZR01000002_1 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT 286936-286970 35 NZ_JHZR01000002.1 1028670-1028704 1 0.971
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 NZ_JHZR01000002.1 1011237-1011272 0 1.0
NZ_JHZR01000002_1 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder 286936-286971 36 NZ_JHZR01000002.1 1028670-1028705 1 0.972

1. spacer 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT matches to position: 1028670-1028704, mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

2. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to position: 1011237-1011272, mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

3. spacer 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder matches to position: 1028670-1028705, mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_JHZR01000002_1 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT 287065-287099 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_JHZR01000002_1 1.1|286809|35|NZ_JHZR01000002|PILER-CR,CRT 286809-286843 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_JHZR01000002_1 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT 286936-286970 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_JHZR01000002_1 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT 286936-286970 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_JHZR01000002_1 1.6|286809|36|NZ_JHZR01000002|CRISPRCasFinder 286809-286844 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
NZ_JHZR01000002_1 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder 286936-286971 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_JHZR01000002_1 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder 286936-286971 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
NZ_JHZR01000002_1 1.10|287065|36|NZ_JHZR01000002|CRISPRCasFinder 287065-287100 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
NZ_JHZR01000002_1 1.1|286809|35|NZ_JHZR01000002|PILER-CR,CRT 286809-286843 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_JHZR01000002_1 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT 286936-286970 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_JHZR01000002_1 1.6|286809|36|NZ_JHZR01000002|CRISPRCasFinder 286809-286844 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
NZ_JHZR01000002_1 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder 286936-286971 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
NZ_JHZR01000002_1 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT 287000-287035 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_JHZR01000002_1 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder 287000-287036 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
NZ_JHZR01000002_1 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT 287065-287099 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_JHZR01000002_1 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT 287065-287099 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_JHZR01000002_1 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT 287065-287099 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_JHZR01000002_1 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT 287065-287099 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

2. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

3. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

4. spacer 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

5. spacer 1.1|286809|35|NZ_JHZR01000002|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

6. spacer 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

7. spacer 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

8. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

9. spacer 1.6|286809|36|NZ_JHZR01000002|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

10. spacer 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

11. spacer 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

12. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

13. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

14. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

15. spacer 1.10|287065|36|NZ_JHZR01000002|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

16. spacer 1.1|286809|35|NZ_JHZR01000002|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

17. spacer 1.3|286936|35|NZ_JHZR01000002|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

18. spacer 1.6|286809|36|NZ_JHZR01000002|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

19. spacer 1.8|286936|36|NZ_JHZR01000002|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

20. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

21. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

22. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

23. spacer 1.4|287000|36|NZ_JHZR01000002|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

24. spacer 1.9|287000|37|NZ_JHZR01000002|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

25. spacer 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

26. spacer 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

27. spacer 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

28. spacer 1.5|287065|35|NZ_JHZR01000002|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 867377 : 874800 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_2 962026 : 1067024 116 Listeria_phage(67.16%) capsid,integrase,tail,portal,protease,holin,terminase,tRNA attL 969302:969318|attR 1007920:1007936
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_JHZR01000002.1|WP_003723550.1|1038171_1038366_-|hypothetical-protein 1038171_1038366_- 64 aa aa NA WHTH_GntR NA 962026-1067024 yes
NZ_JHZR01000002.1|WP_003723553.1|1039612_1039750_-|hypothetical-protein 1039612_1039750_- 45 aa aa NA WHTH_GntR NA 962026-1067024 yes
3. NZ_JHZR01000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_JHZR01000010_1 27106-27257 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_JHZR01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2820 : 11106 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_KK211192
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK211192_1 52704-52860 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43324 : 51168 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage