Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ASRD01000073 Pseudomonas aeruginosa str. C 1426 contig073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000371 Pseudomonas aeruginosa str. C 1426 contig371, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000160 Pseudomonas aeruginosa str. C 1426 contig160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000257 Pseudomonas aeruginosa str. C 1426 contig257, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000104 Pseudomonas aeruginosa str. C 1426 contig104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000256 Pseudomonas aeruginosa str. C 1426 contig256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000307 Pseudomonas aeruginosa str. C 1426 contig307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000097 Pseudomonas aeruginosa str. C 1426 contig097, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 0 0
NZ_ASRD01000318 Pseudomonas aeruginosa str. C 1426 contig318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000355 Pseudomonas aeruginosa str. C 1426 contig355, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000107 Pseudomonas aeruginosa str. C 1426 contig107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000136 Pseudomonas aeruginosa str. C 1426 contig136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000078 Pseudomonas aeruginosa str. C 1426 contig078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000178 Pseudomonas aeruginosa str. C 1426 contig178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000153 Pseudomonas aeruginosa str. C 1426 contig153, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000003 Pseudomonas aeruginosa str. C 1426 contig003, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000290 Pseudomonas aeruginosa str. C 1426 contig290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000146 Pseudomonas aeruginosa str. C 1426 contig146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000276 Pseudomonas aeruginosa str. C 1426 contig276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000239 Pseudomonas aeruginosa str. C 1426 contig239, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000419 Pseudomonas aeruginosa str. C 1426 contig419, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000061 Pseudomonas aeruginosa str. C 1426 contig061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000250 Pseudomonas aeruginosa str. C 1426 contig250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000134 Pseudomonas aeruginosa str. C 1426 contig134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000213 Pseudomonas aeruginosa str. C 1426 contig213, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000304 Pseudomonas aeruginosa str. C 1426 contig304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000045 Pseudomonas aeruginosa str. C 1426 contig045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000132 Pseudomonas aeruginosa str. C 1426 contig132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000127 Pseudomonas aeruginosa str. C 1426 contig127, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000347 Pseudomonas aeruginosa str. C 1426 contig347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000118 Pseudomonas aeruginosa str. C 1426 contig118, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ASRD01000390 Pseudomonas aeruginosa str. C 1426 contig390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000354 Pseudomonas aeruginosa str. C 1426 contig354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000161 Pseudomonas aeruginosa str. C 1426 contig161, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000388 Pseudomonas aeruginosa str. C 1426 contig388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000064 Pseudomonas aeruginosa str. C 1426 contig064, whole genome shotgun sequence 0 crisprs NA 0 0 0 2
NZ_ASRD01000420 Pseudomonas aeruginosa str. C 1426 contig420, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000123 Pseudomonas aeruginosa str. C 1426 contig123, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000059 Pseudomonas aeruginosa str. C 1426 contig059, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ASRD01000191 Pseudomonas aeruginosa str. C 1426 contig191, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000237 Pseudomonas aeruginosa str. C 1426 contig237, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000351 Pseudomonas aeruginosa str. C 1426 contig351, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000144 Pseudomonas aeruginosa str. C 1426 contig144, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ASRD01000404 Pseudomonas aeruginosa str. C 1426 contig404, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000328 Pseudomonas aeruginosa str. C 1426 contig328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000234 Pseudomonas aeruginosa str. C 1426 contig234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000121 Pseudomonas aeruginosa str. C 1426 contig121, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000062 Pseudomonas aeruginosa str. C 1426 contig062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000395 Pseudomonas aeruginosa str. C 1426 contig395, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000089 Pseudomonas aeruginosa str. C 1426 contig089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000412 Pseudomonas aeruginosa str. C 1426 contig412, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000339 Pseudomonas aeruginosa str. C 1426 contig339, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000070 Pseudomonas aeruginosa str. C 1426 contig070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000369 Pseudomonas aeruginosa str. C 1426 contig369, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000416 Pseudomonas aeruginosa str. C 1426 contig416, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000092 Pseudomonas aeruginosa str. C 1426 contig092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000236 Pseudomonas aeruginosa str. C 1426 contig236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000021 Pseudomonas aeruginosa str. C 1426 contig021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000196 Pseudomonas aeruginosa str. C 1426 contig196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000421 Pseudomonas aeruginosa str. C 1426 contig421, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000053 Pseudomonas aeruginosa str. C 1426 contig053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000024 Pseudomonas aeruginosa str. C 1426 contig024, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ASRD01000181 Pseudomonas aeruginosa str. C 1426 contig181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000259 Pseudomonas aeruginosa str. C 1426 contig259, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000194 Pseudomonas aeruginosa str. C 1426 contig194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000130 Pseudomonas aeruginosa str. C 1426 contig130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000319 Pseudomonas aeruginosa str. C 1426 contig319, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000302 Pseudomonas aeruginosa str. C 1426 contig302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000415 Pseudomonas aeruginosa str. C 1426 contig415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000169 Pseudomonas aeruginosa str. C 1426 contig169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000093 Pseudomonas aeruginosa str. C 1426 contig093, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000058 Pseudomonas aeruginosa str. C 1426 contig058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000014 Pseudomonas aeruginosa str. C 1426 contig014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000171 Pseudomonas aeruginosa str. C 1426 contig171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000015 Pseudomonas aeruginosa str. C 1426 contig015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000040 Pseudomonas aeruginosa str. C 1426 contig040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000005 Pseudomonas aeruginosa str. C 1426 contig005, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000346 Pseudomonas aeruginosa str. C 1426 contig346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000017 Pseudomonas aeruginosa str. C 1426 contig017, whole genome shotgun sequence 1 crisprs DEDDh 0 1 0 0
NZ_ASRD01000399 Pseudomonas aeruginosa str. C 1426 contig399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000085 Pseudomonas aeruginosa str. C 1426 contig085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000264 Pseudomonas aeruginosa str. C 1426 contig264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000002 Pseudomonas aeruginosa str. C 1426 contig002, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000241 Pseudomonas aeruginosa str. C 1426 contig241, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000220 Pseudomonas aeruginosa str. C 1426 contig220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000401 Pseudomonas aeruginosa str. C 1426 contig401, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000175 Pseudomonas aeruginosa str. C 1426 contig175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000133 Pseudomonas aeruginosa str. C 1426 contig133, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000393 Pseudomonas aeruginosa str. C 1426 contig393, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000084 Pseudomonas aeruginosa str. C 1426 contig084, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ASRD01000163 Pseudomonas aeruginosa str. C 1426 contig163, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000288 Pseudomonas aeruginosa str. C 1426 contig288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000385 Pseudomonas aeruginosa str. C 1426 contig385, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000378 Pseudomonas aeruginosa str. C 1426 contig378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000389 Pseudomonas aeruginosa str. C 1426 contig389, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000154 Pseudomonas aeruginosa str. C 1426 contig154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000364 Pseudomonas aeruginosa str. C 1426 contig364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000260 Pseudomonas aeruginosa str. C 1426 contig260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000035 Pseudomonas aeruginosa str. C 1426 contig035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000410 Pseudomonas aeruginosa str. C 1426 contig410, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000165 Pseudomonas aeruginosa str. C 1426 contig165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000091 Pseudomonas aeruginosa str. C 1426 contig091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000408 Pseudomonas aeruginosa str. C 1426 contig408, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000120 Pseudomonas aeruginosa str. C 1426 contig120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000168 Pseudomonas aeruginosa str. C 1426 contig168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000278 Pseudomonas aeruginosa str. C 1426 contig278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000282 Pseudomonas aeruginosa str. C 1426 contig282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000095 Pseudomonas aeruginosa str. C 1426 contig095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000067 Pseudomonas aeruginosa str. C 1426 contig067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000049 Pseudomonas aeruginosa str. C 1426 contig049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000317 Pseudomonas aeruginosa str. C 1426 contig317, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000266 Pseudomonas aeruginosa str. C 1426 contig266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000308 Pseudomonas aeruginosa str. C 1426 contig308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000016 Pseudomonas aeruginosa str. C 1426 contig016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000177 Pseudomonas aeruginosa str. C 1426 contig177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000143 Pseudomonas aeruginosa str. C 1426 contig143, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ASRD01000406 Pseudomonas aeruginosa str. C 1426 contig406, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000164 Pseudomonas aeruginosa str. C 1426 contig164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000205 Pseudomonas aeruginosa str. C 1426 contig205, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000047 Pseudomonas aeruginosa str. C 1426 contig047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000083 Pseudomonas aeruginosa str. C 1426 contig083, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ASRD01000405 Pseudomonas aeruginosa str. C 1426 contig405, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000294 Pseudomonas aeruginosa str. C 1426 contig294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000269 Pseudomonas aeruginosa str. C 1426 contig269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000370 Pseudomonas aeruginosa str. C 1426 contig370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000332 Pseudomonas aeruginosa str. C 1426 contig332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000247 Pseudomonas aeruginosa str. C 1426 contig247, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000186 Pseudomonas aeruginosa str. C 1426 contig186, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ASRD01000310 Pseudomonas aeruginosa str. C 1426 contig310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000306 Pseudomonas aeruginosa str. C 1426 contig306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000207 Pseudomonas aeruginosa str. C 1426 contig207, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000022 Pseudomonas aeruginosa str. C 1426 contig022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000056 Pseudomonas aeruginosa str. C 1426 contig056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000340 Pseudomonas aeruginosa str. C 1426 contig340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000223 Pseudomonas aeruginosa str. C 1426 contig223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000321 Pseudomonas aeruginosa str. C 1426 contig321, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000189 Pseudomonas aeruginosa str. C 1426 contig189, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000274 Pseudomonas aeruginosa str. C 1426 contig274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000184 Pseudomonas aeruginosa str. C 1426 contig184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000368 Pseudomonas aeruginosa str. C 1426 contig368, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000179 Pseudomonas aeruginosa str. C 1426 contig179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000240 Pseudomonas aeruginosa str. C 1426 contig240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000079 Pseudomonas aeruginosa str. C 1426 contig079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000101 Pseudomonas aeruginosa str. C 1426 contig101, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000209 Pseudomonas aeruginosa str. C 1426 contig209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000283 Pseudomonas aeruginosa str. C 1426 contig283, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000373 Pseudomonas aeruginosa str. C 1426 contig373, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000032 Pseudomonas aeruginosa str. C 1426 contig032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000353 Pseudomonas aeruginosa str. C 1426 contig353, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000323 Pseudomonas aeruginosa str. C 1426 contig323, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000112 Pseudomonas aeruginosa str. C 1426 contig112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000066 Pseudomonas aeruginosa str. C 1426 contig066, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ASRD01000377 Pseudomonas aeruginosa str. C 1426 contig377, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000108 Pseudomonas aeruginosa str. C 1426 contig108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000217 Pseudomonas aeruginosa str. C 1426 contig217, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000137 Pseudomonas aeruginosa str. C 1426 contig137, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000201 Pseudomonas aeruginosa str. C 1426 contig201, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000285 Pseudomonas aeruginosa str. C 1426 contig285, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000050 Pseudomonas aeruginosa str. C 1426 contig050, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000244 Pseudomonas aeruginosa str. C 1426 contig244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000077 Pseudomonas aeruginosa str. C 1426 contig077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000312 Pseudomonas aeruginosa str. C 1426 contig312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000345 Pseudomonas aeruginosa str. C 1426 contig345, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000365 Pseudomonas aeruginosa str. C 1426 contig365, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000263 Pseudomonas aeruginosa str. C 1426 contig263, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000341 Pseudomonas aeruginosa str. C 1426 contig341, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000038 Pseudomonas aeruginosa str. C 1426 contig038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000135 Pseudomonas aeruginosa str. C 1426 contig135, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000334 Pseudomonas aeruginosa str. C 1426 contig334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000349 Pseudomonas aeruginosa str. C 1426 contig349, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000157 Pseudomonas aeruginosa str. C 1426 contig157, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000314 Pseudomonas aeruginosa str. C 1426 contig314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000088 Pseudomonas aeruginosa str. C 1426 contig088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000360 Pseudomonas aeruginosa str. C 1426 contig360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000267 Pseudomonas aeruginosa str. C 1426 contig267, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000268 Pseudomonas aeruginosa str. C 1426 contig268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000096 Pseudomonas aeruginosa str. C 1426 contig096, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000006 Pseudomonas aeruginosa str. C 1426 contig006, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ASRD01000148 Pseudomonas aeruginosa str. C 1426 contig148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000381 Pseudomonas aeruginosa str. C 1426 contig381, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000397 Pseudomonas aeruginosa str. C 1426 contig397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000233 Pseudomonas aeruginosa str. C 1426 contig233, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000037 Pseudomonas aeruginosa str. C 1426 contig037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000254 Pseudomonas aeruginosa str. C 1426 contig254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000275 Pseudomonas aeruginosa str. C 1426 contig275, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000151 Pseudomonas aeruginosa str. C 1426 contig151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000374 Pseudomonas aeruginosa str. C 1426 contig374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000141 Pseudomonas aeruginosa str. C 1426 contig141, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_ASRD01000098 Pseudomonas aeruginosa str. C 1426 contig098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000363 Pseudomonas aeruginosa str. C 1426 contig363, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000046 Pseudomonas aeruginosa str. C 1426 contig046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000348 Pseudomonas aeruginosa str. C 1426 contig348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000215 Pseudomonas aeruginosa str. C 1426 contig215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000034 Pseudomonas aeruginosa str. C 1426 contig034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000329 Pseudomonas aeruginosa str. C 1426 contig329, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000072 Pseudomonas aeruginosa str. C 1426 contig072, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ASRD01000124 Pseudomonas aeruginosa str. C 1426 contig124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000292 Pseudomonas aeruginosa str. C 1426 contig292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000296 Pseudomonas aeruginosa str. C 1426 contig296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000413 Pseudomonas aeruginosa str. C 1426 contig413, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000114 Pseudomonas aeruginosa str. C 1426 contig114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000115 Pseudomonas aeruginosa str. C 1426 contig115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000147 Pseudomonas aeruginosa str. C 1426 contig147, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000229 Pseudomonas aeruginosa str. C 1426 contig229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000224 Pseudomonas aeruginosa str. C 1426 contig224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000309 Pseudomonas aeruginosa str. C 1426 contig309, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000190 Pseudomonas aeruginosa str. C 1426 contig190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000246 Pseudomonas aeruginosa str. C 1426 contig246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000170 Pseudomonas aeruginosa str. C 1426 contig170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000203 Pseudomonas aeruginosa str. C 1426 contig203, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000232 Pseudomonas aeruginosa str. C 1426 contig232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000110 Pseudomonas aeruginosa str. C 1426 contig110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000080 Pseudomonas aeruginosa str. C 1426 contig080, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ASRD01000270 Pseudomonas aeruginosa str. C 1426 contig270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000094 Pseudomonas aeruginosa str. C 1426 contig094, whole genome shotgun sequence 1 crisprs NA 0 6 0 0
NZ_ASRD01000243 Pseudomonas aeruginosa str. C 1426 contig243, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000105 Pseudomonas aeruginosa str. C 1426 contig105, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000119 Pseudomonas aeruginosa str. C 1426 contig119, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000248 Pseudomonas aeruginosa str. C 1426 contig248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000055 Pseudomonas aeruginosa str. C 1426 contig055, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000116 Pseudomonas aeruginosa str. C 1426 contig116, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ASRD01000327 Pseudomonas aeruginosa str. C 1426 contig327, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000379 Pseudomonas aeruginosa str. C 1426 contig379, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000149 Pseudomonas aeruginosa str. C 1426 contig149, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000028 Pseudomonas aeruginosa str. C 1426 contig028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000042 Pseudomonas aeruginosa str. C 1426 contig042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000156 Pseudomonas aeruginosa str. C 1426 contig156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000313 Pseudomonas aeruginosa str. C 1426 contig313, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000126 Pseudomonas aeruginosa str. C 1426 contig126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000054 Pseudomonas aeruginosa str. C 1426 contig054, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000173 Pseudomonas aeruginosa str. C 1426 contig173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000031 Pseudomonas aeruginosa str. C 1426 contig031, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ASRD01000216 Pseudomonas aeruginosa str. C 1426 contig216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000113 Pseudomonas aeruginosa str. C 1426 contig113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000106 Pseudomonas aeruginosa str. C 1426 contig106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000027 Pseudomonas aeruginosa str. C 1426 contig027, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ASRD01000159 Pseudomonas aeruginosa str. C 1426 contig159, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000009 Pseudomonas aeruginosa str. C 1426 contig009, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000138 Pseudomonas aeruginosa str. C 1426 contig138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000158 Pseudomonas aeruginosa str. C 1426 contig158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000297 Pseudomonas aeruginosa str. C 1426 contig297, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000324 Pseudomonas aeruginosa str. C 1426 contig324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000375 Pseudomonas aeruginosa str. C 1426 contig375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000155 Pseudomonas aeruginosa str. C 1426 contig155, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000051 Pseudomonas aeruginosa str. C 1426 contig051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000301 Pseudomonas aeruginosa str. C 1426 contig301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000131 Pseudomonas aeruginosa str. C 1426 contig131, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000039 Pseudomonas aeruginosa str. C 1426 contig039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000387 Pseudomonas aeruginosa str. C 1426 contig387, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000206 Pseudomonas aeruginosa str. C 1426 contig206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000358 Pseudomonas aeruginosa str. C 1426 contig358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000253 Pseudomonas aeruginosa str. C 1426 contig253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000041 Pseudomonas aeruginosa str. C 1426 contig041, whole genome shotgun sequence 0 crisprs NA 0 0 2 3
NZ_ASRD01000048 Pseudomonas aeruginosa str. C 1426 contig048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000111 Pseudomonas aeruginosa str. C 1426 contig111, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ASRD01000102 Pseudomonas aeruginosa str. C 1426 contig102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000010 Pseudomonas aeruginosa str. C 1426 contig010, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000082 Pseudomonas aeruginosa str. C 1426 contig082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000052 Pseudomonas aeruginosa str. C 1426 contig052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000166 Pseudomonas aeruginosa str. C 1426 contig166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000150 Pseudomonas aeruginosa str. C 1426 contig150, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ASRD01000086 Pseudomonas aeruginosa str. C 1426 contig086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000252 Pseudomonas aeruginosa str. C 1426 contig252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000265 Pseudomonas aeruginosa str. C 1426 contig265, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000382 Pseudomonas aeruginosa str. C 1426 contig382, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000359 Pseudomonas aeruginosa str. C 1426 contig359, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000289 Pseudomonas aeruginosa str. C 1426 contig289, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000019 Pseudomonas aeruginosa str. C 1426 contig019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000023 Pseudomonas aeruginosa str. C 1426 contig023, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ASRD01000402 Pseudomonas aeruginosa str. C 1426 contig402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000258 Pseudomonas aeruginosa str. C 1426 contig258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000352 Pseudomonas aeruginosa str. C 1426 contig352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000176 Pseudomonas aeruginosa str. C 1426 contig176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000125 Pseudomonas aeruginosa str. C 1426 contig125, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ASRD01000400 Pseudomonas aeruginosa str. C 1426 contig400, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000142 Pseudomonas aeruginosa str. C 1426 contig142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000261 Pseudomonas aeruginosa str. C 1426 contig261, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000333 Pseudomonas aeruginosa str. C 1426 contig333, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000271 Pseudomonas aeruginosa str. C 1426 contig271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000212 Pseudomonas aeruginosa str. C 1426 contig212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000117 Pseudomonas aeruginosa str. C 1426 contig117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000033 Pseudomonas aeruginosa str. C 1426 contig033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000262 Pseudomonas aeruginosa str. C 1426 contig262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000356 Pseudomonas aeruginosa str. C 1426 contig356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000320 Pseudomonas aeruginosa str. C 1426 contig320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000335 Pseudomonas aeruginosa str. C 1426 contig335, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000214 Pseudomonas aeruginosa str. C 1426 contig214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000287 Pseudomonas aeruginosa str. C 1426 contig287, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000081 Pseudomonas aeruginosa str. C 1426 contig081, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_ASRD01000018 Pseudomonas aeruginosa str. C 1426 contig018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000273 Pseudomonas aeruginosa str. C 1426 contig273, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000235 Pseudomonas aeruginosa str. C 1426 contig235, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000122 Pseudomonas aeruginosa str. C 1426 contig122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000172 Pseudomonas aeruginosa str. C 1426 contig172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000208 Pseudomonas aeruginosa str. C 1426 contig208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000065 Pseudomonas aeruginosa str. C 1426 contig065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000145 Pseudomonas aeruginosa str. C 1426 contig145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000417 Pseudomonas aeruginosa str. C 1426 contig417, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000305 Pseudomonas aeruginosa str. C 1426 contig305, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000392 Pseudomonas aeruginosa str. C 1426 contig392, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000336 Pseudomonas aeruginosa str. C 1426 contig336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000396 Pseudomonas aeruginosa str. C 1426 contig396, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000303 Pseudomonas aeruginosa str. C 1426 contig303, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000030 Pseudomonas aeruginosa str. C 1426 contig030, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_ASRD01000071 Pseudomonas aeruginosa str. C 1426 contig071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000068 Pseudomonas aeruginosa str. C 1426 contig068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000251 Pseudomonas aeruginosa str. C 1426 contig251, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000230 Pseudomonas aeruginosa str. C 1426 contig230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000407 Pseudomonas aeruginosa str. C 1426 contig407, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000344 Pseudomonas aeruginosa str. C 1426 contig344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000128 Pseudomonas aeruginosa str. C 1426 contig128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000418 Pseudomonas aeruginosa str. C 1426 contig418, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000362 Pseudomonas aeruginosa str. C 1426 contig362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000403 Pseudomonas aeruginosa str. C 1426 contig403, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000380 Pseudomonas aeruginosa str. C 1426 contig380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000315 Pseudomonas aeruginosa str. C 1426 contig315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000140 Pseudomonas aeruginosa str. C 1426 contig140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000013 Pseudomonas aeruginosa str. C 1426 contig013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000281 Pseudomonas aeruginosa str. C 1426 contig281, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000218 Pseudomonas aeruginosa str. C 1426 contig218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000372 Pseudomonas aeruginosa str. C 1426 contig372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000226 Pseudomonas aeruginosa str. C 1426 contig226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000311 Pseudomonas aeruginosa str. C 1426 contig311, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000211 Pseudomonas aeruginosa str. C 1426 contig211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000384 Pseudomonas aeruginosa str. C 1426 contig384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000286 Pseudomonas aeruginosa str. C 1426 contig286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000182 Pseudomonas aeruginosa str. C 1426 contig182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000193 Pseudomonas aeruginosa str. C 1426 contig193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000188 Pseudomonas aeruginosa str. C 1426 contig188, whole genome shotgun sequence 1 crisprs cas1 3 24 0 0
NZ_ASRD01000060 Pseudomonas aeruginosa str. C 1426 contig060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000103 Pseudomonas aeruginosa str. C 1426 contig103, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000367 Pseudomonas aeruginosa str. C 1426 contig367, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000414 Pseudomonas aeruginosa str. C 1426 contig414, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000185 Pseudomonas aeruginosa str. C 1426 contig185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000386 Pseudomonas aeruginosa str. C 1426 contig386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000152 Pseudomonas aeruginosa str. C 1426 contig152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000195 Pseudomonas aeruginosa str. C 1426 contig195, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000057 Pseudomonas aeruginosa str. C 1426 contig057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000008 Pseudomonas aeruginosa str. C 1426 contig008, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000025 Pseudomonas aeruginosa str. C 1426 contig025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000162 Pseudomonas aeruginosa str. C 1426 contig162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000099 Pseudomonas aeruginosa str. C 1426 contig099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000357 Pseudomonas aeruginosa str. C 1426 contig357, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000322 Pseudomonas aeruginosa str. C 1426 contig322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000337 Pseudomonas aeruginosa str. C 1426 contig337, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000394 Pseudomonas aeruginosa str. C 1426 contig394, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000376 Pseudomonas aeruginosa str. C 1426 contig376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000326 Pseudomonas aeruginosa str. C 1426 contig326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000075 Pseudomonas aeruginosa str. C 1426 contig075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000210 Pseudomonas aeruginosa str. C 1426 contig210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000343 Pseudomonas aeruginosa str. C 1426 contig343, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000330 Pseudomonas aeruginosa str. C 1426 contig330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000044 Pseudomonas aeruginosa str. C 1426 contig044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000197 Pseudomonas aeruginosa str. C 1426 contig197, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000331 Pseudomonas aeruginosa str. C 1426 contig331, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000011 Pseudomonas aeruginosa str. C 1426 contig011, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000219 Pseudomonas aeruginosa str. C 1426 contig219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000299 Pseudomonas aeruginosa str. C 1426 contig299, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000026 Pseudomonas aeruginosa str. C 1426 contig026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000225 Pseudomonas aeruginosa str. C 1426 contig225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000342 Pseudomonas aeruginosa str. C 1426 contig342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000198 Pseudomonas aeruginosa str. C 1426 contig198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000183 Pseudomonas aeruginosa str. C 1426 contig183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000167 Pseudomonas aeruginosa str. C 1426 contig167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000231 Pseudomonas aeruginosa str. C 1426 contig231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000043 Pseudomonas aeruginosa str. C 1426 contig043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000398 Pseudomonas aeruginosa str. C 1426 contig398, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000245 Pseudomonas aeruginosa str. C 1426 contig245, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000001 Pseudomonas aeruginosa str. C 1426 contig001, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000272 Pseudomonas aeruginosa str. C 1426 contig272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000298 Pseudomonas aeruginosa str. C 1426 contig298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000007 Pseudomonas aeruginosa str. C 1426 contig007, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ASRD01000202 Pseudomonas aeruginosa str. C 1426 contig202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000291 Pseudomonas aeruginosa str. C 1426 contig291, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000076 Pseudomonas aeruginosa str. C 1426 contig076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000409 Pseudomonas aeruginosa str. C 1426 contig409, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000109 Pseudomonas aeruginosa str. C 1426 contig109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000204 Pseudomonas aeruginosa str. C 1426 contig204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000180 Pseudomonas aeruginosa str. C 1426 contig180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000238 Pseudomonas aeruginosa str. C 1426 contig238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000228 Pseudomonas aeruginosa str. C 1426 contig228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000284 Pseudomonas aeruginosa str. C 1426 contig284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000199 Pseudomonas aeruginosa str. C 1426 contig199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000036 Pseudomonas aeruginosa str. C 1426 contig036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000221 Pseudomonas aeruginosa str. C 1426 contig221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000361 Pseudomonas aeruginosa str. C 1426 contig361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000004 Pseudomonas aeruginosa str. C 1426 contig004, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000090 Pseudomonas aeruginosa str. C 1426 contig090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000350 Pseudomonas aeruginosa str. C 1426 contig350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000074 Pseudomonas aeruginosa str. C 1426 contig074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000192 Pseudomonas aeruginosa str. C 1426 contig192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000325 Pseudomonas aeruginosa str. C 1426 contig325, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000338 Pseudomonas aeruginosa str. C 1426 contig338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000391 Pseudomonas aeruginosa str. C 1426 contig391, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000280 Pseudomonas aeruginosa str. C 1426 contig280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000069 Pseudomonas aeruginosa str. C 1426 contig069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000222 Pseudomonas aeruginosa str. C 1426 contig222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000227 Pseudomonas aeruginosa str. C 1426 contig227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000187 Pseudomonas aeruginosa str. C 1426 contig187, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000316 Pseudomonas aeruginosa str. C 1426 contig316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000174 Pseudomonas aeruginosa str. C 1426 contig174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000366 Pseudomonas aeruginosa str. C 1426 contig366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000020 Pseudomonas aeruginosa str. C 1426 contig020, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000277 Pseudomonas aeruginosa str. C 1426 contig277, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000295 Pseudomonas aeruginosa str. C 1426 contig295, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000242 Pseudomonas aeruginosa str. C 1426 contig242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000383 Pseudomonas aeruginosa str. C 1426 contig383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000139 Pseudomonas aeruginosa str. C 1426 contig139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000129 Pseudomonas aeruginosa str. C 1426 contig129, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000293 Pseudomonas aeruginosa str. C 1426 contig293, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000087 Pseudomonas aeruginosa str. C 1426 contig087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000300 Pseudomonas aeruginosa str. C 1426 contig300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000255 Pseudomonas aeruginosa str. C 1426 contig255, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000279 Pseudomonas aeruginosa str. C 1426 contig279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000200 Pseudomonas aeruginosa str. C 1426 contig200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000029 Pseudomonas aeruginosa str. C 1426 contig029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000411 Pseudomonas aeruginosa str. C 1426 contig411, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000063 Pseudomonas aeruginosa str. C 1426 contig063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000249 Pseudomonas aeruginosa str. C 1426 contig249, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000100 Pseudomonas aeruginosa str. C 1426 contig100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ASRD01000012 Pseudomonas aeruginosa str. C 1426 contig012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ASRD01000017
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000017_1 41462-41564 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ASRD01000017_1 1.1|41488|51|NZ_ASRD01000017|CRISPRCasFinder 41488-41538 51 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63841 0 1.0

1. spacer 1.1|41488|51|NZ_ASRD01000017|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga	CRISPR spacer
aacggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga	Protospacer
***************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ASRD01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 172325 : 178511 9 Powai_lake_megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ASRD01000188
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000188_1 1282-2570 Unclear I-F
21 spacers
cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ASRD01000188_1 1.5|1550|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1550-1581 32 NZ_ASRD01000041.1 5622-5653 2 0.938
NZ_ASRD01000188_1 1.7|1670|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1670-1701 32 NZ_ASRD01000041.1 6919-6950 2 0.938
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_ASRD01000041.1 26349-26380 2 0.938

1. spacer 1.5|1550|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to position: 5622-5653, mismatch: 2, identity: 0.938

ttcccgcctgatatgtacctaatgttcatatt	CRISPR spacer
ttcctgcctaatatgtacctaatgttcatatt	Protospacer
****.****.**********************

2. spacer 1.7|1670|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to position: 6919-6950, mismatch: 2, identity: 0.938

gcgaacgaccaaggggtgtgctggccggcggt	CRISPR spacer
gcgaacgaccaaggcgtgtgctggccggctgt	Protospacer
************** ************** **

3. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to position: 26349-26380, mismatch: 2, identity: 0.938

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcacaagatcgatc	Protospacer
********************** **.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 JN811560 Pseudomonas phage JBD26, complete genome 29468-29499 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 NC_006548 Pseudomonas phage B3, complete genome 30706-30737 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 KM389245 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00004 genomic sequence 2995-3026 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 AF232233 Bacteriophage B3, complete genome 30706-30737 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511057 Pseudomonas phage CF5, partial genome 27936-27967 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MH719189 Pseudomonas phage Fc02, complete genome 29827-29858 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 KM389336 UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence 10111-10142 0 1.0
NZ_ASRD01000188_1 1.7|1670|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1670-1701 32 NC_030931 Pseudomonas phage phi2, complete genome 15925-15956 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 1414-1445 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 44107-44138 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 989-1020 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 48111-48142 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 47547-47578 0 1.0
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 NC_030929 Pseudomonas phage JBD44, complete genome 33296-33327 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 2583-2614 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 2158-2189 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK511008 Pseudomonas phage CF124, partial genome 24696-24727 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK511013 Pseudomonas phage BR161, partial genome 37401-37432 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK511002 Pseudomonas phage CF57, partial genome 37300-37331 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK511003 Pseudomonas phage CF65, partial genome 37287-37318 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 46942-46973 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 46378-46409 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK511005 Pseudomonas phage CF81, partial genome 37392-37423 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 22870-22901 0 1.0
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 NC_030929 Pseudomonas phage JBD44, complete genome 34465-34496 0 1.0
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 1231-1262 0 1.0
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 KM389212 UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence 806-837 0 1.0
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 KM389210 UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence 48294-48325 0 1.0
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 KM389463 UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence 47730-47761 0 1.0
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 NC_030929 Pseudomonas phage JBD44, complete genome 33113-33144 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389234 UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00002 genomic sequence 4285-4316 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 AY394005 Bacteriophage D3112, complete genome 31301-31332 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MH719194 Pseudomonas phage Ps60, complete genome 33262-33293 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JN811560 Pseudomonas phage JBD26, complete genome 31415-31446 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511031 Pseudomonas phage BR52, partial genome 24477-24508 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511034 Pseudomonas phage BR243, partial genome 31117-31148 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389262 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence 3354-3385 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511033 Pseudomonas phage BR205, partial genome 31182-31213 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_027298 Pseudomonas phage LPB1, complate genome 30394-30425 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JQ762257 Pseudomonas phage MP42, complete genome 30503-30534 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511017 Pseudomonas phage CF23, partial genome 31133-31164 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_027992 Pseudomonas phage JBD25, complete genome 33418-33449 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 7482-7513 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK144667 Pseudomonas phage Spike, complete genome 31179-31210 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 6386-6417 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511026 Pseudomonas phage CF121, partial genome 31085-31116 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_005178 Pseudomonas phage D3112, complete genome 31301-31332 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MH719192 Pseudomonas phage Ps56, complete genome 33402-33433 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 30987-31018 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511022 Pseudomonas phage CF74, partial genome 33746-33777 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM233689 Pseudomonas phage H70, complete genome 30950-30981 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 DQ631426 Pseudomonas phage DMS3, complete genome 30076-30107 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389336 UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence 12058-12089 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511030 Pseudomonas phage CF213, partial genome 31083-31114 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511025 Pseudomonas phage CF118, partial genome 31112-31143 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511023 Pseudomonas phage CF77, partial genome 31083-31114 0 1.0
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511029 Pseudomonas phage CF183, partial genome 31867-31898 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 19362-19393 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 AY394005 Bacteriophage D3112, complete genome 19998-20029 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 19677-19708 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JN811560 Pseudomonas phage JBD26, complete genome 20116-20147 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 19015-19046 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511031 Pseudomonas phage BR52, partial genome 13171-13202 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511034 Pseudomonas phage BR243, partial genome 19811-19842 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511033 Pseudomonas phage BR205, partial genome 19876-19907 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_027298 Pseudomonas phage LPB1, complate genome 19089-19120 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511017 Pseudomonas phage CF23, partial genome 19827-19858 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389264 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000634 genomic sequence 3657-3688 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 18939-18970 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 17860-17891 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 19475-19506 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 17699-17730 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JQ067085 Pseudomonas phage PaMx73, complete genome 18851-18882 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 19574-19605 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511026 Pseudomonas phage CF121, partial genome 19779-19810 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JX434030 Pseudomonas phage JBD5, complete genome 20020-20051 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_005178 Pseudomonas phage D3112, complete genome 19998-20029 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 17707-17738 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 19513-19544 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 16825-16856 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511022 Pseudomonas phage CF74, partial genome 22440-22471 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389336 UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence 759-790 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511030 Pseudomonas phage CF213, partial genome 19777-19808 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511025 Pseudomonas phage CF118, partial genome 19806-19837 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511023 Pseudomonas phage CF77, partial genome 19777-19808 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511029 Pseudomonas phage CF183, partial genome 20561-20592 0 1.0
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 EU272036 Pseudomonas phage MP29, complete genome 18908-18939 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 AY394005 Bacteriophage D3112, complete genome 31471-31502 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 JN811560 Pseudomonas phage JBD26, complete genome 31585-31616 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_027298 Pseudomonas phage LPB1, complate genome 30564-30595 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 JQ762257 Pseudomonas phage MP42, complete genome 30673-30704 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_027992 Pseudomonas phage JBD25, complete genome 33588-33619 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 7312-7343 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 6216-6247 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 JQ067085 Pseudomonas phage PaMx73, complete genome 30326-30357 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_005178 Pseudomonas phage D3112, complete genome 31471-31502 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 31157-31188 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM233689 Pseudomonas phage H70, complete genome 31120-31151 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM389336 UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence 12228-12259 0 1.0
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_024782 Pseudomonas phage MP48, complete genome 30586-30617 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510993 Pseudomonas phage BR201, partial genome 33469-33500 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510962 Pseudomonas phage CF3, partial genome 6406-6437 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510987 Pseudomonas phage BR233, partial genome 14019-14050 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510971 Pseudomonas phage CF79, partial genome 35574-35605 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510965 Pseudomonas phage CF34, partial genome 28046-28077 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510974 Pseudomonas phage CF140, partial genome 13989-14020 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510978 Pseudomonas phage CF208, partial genome 14129-14160 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510988 Pseudomonas phage BR299, partial genome 14075-14106 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510976 Pseudomonas phage CF165, partial genome 34729-34760 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510970 Pseudomonas phage CF67, partial genome 14072-14103 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 KY707339 Pseudomonas phage JBD68, complete genome 14089-14120 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510990 Pseudomonas phage BR133, partial genome 17358-17389 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510975 Pseudomonas phage CF145, partial genome 14305-14336 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510968 Pseudomonas phage CF55, partial genome 15430-15461 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510969 Pseudomonas phage CF60, partial genome 246-277 0 1.0
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MK510986 Pseudomonas phage BR213, partial genome 14020-14051 0 1.0
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 45511-45542 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_009818 Pseudomonas phage MP22, complete genome 27990-28021 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511059 Pseudomonas phage CF78, partial genome 31252-31283 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511036 Pseudomonas phage BR327, partial genome 28810-28841 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511031 Pseudomonas phage BR52, partial genome 22474-22505 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511034 Pseudomonas phage BR243, partial genome 29114-29145 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389262 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence 1357-1388 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 9484-9515 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511033 Pseudomonas phage BR205, partial genome 29179-29210 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_027298 Pseudomonas phage LPB1, complate genome 28394-28425 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JQ762257 Pseudomonas phage MP42, complete genome 28503-28534 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511017 Pseudomonas phage CF23, partial genome 29130-29161 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JX434033 Pseudomonas phage JBD88a, complete genome 28008-28039 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511061 Pseudomonas phage CF125, partial genome 31251-31282 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_027992 Pseudomonas phage JBD25, complete genome 31418-31449 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 9482-9513 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 20196-20227 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK144667 Pseudomonas phage Spike, complete genome 29176-29207 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 8389-8420 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511018 Pseudomonas phage CF28, partial genome 28842-28873 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KU199707 Pseudomonas phage JBD16C, partial genome 28000-28031 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JQ067085 Pseudomonas phage PaMx73, complete genome 28156-28187 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511026 Pseudomonas phage CF121, partial genome 29082-29113 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 28900-28931 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KJ477077 Pseudomonas phage JD024, complete genome 27879-27910 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511063 Pseudomonas phage CF177, partial genome 30566-30597 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 28616-28647 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 28815-28846 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JX434030 Pseudomonas phage JBD5, complete genome 29321-29352 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_030918 Pseudomonas phage JBD93, complete genome 28205-28236 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MH719192 Pseudomonas phage Ps56, complete genome 31402-31433 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 EU272037 Pseudomonas phage MP38, complete genome 28472-28503 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 28984-29015 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JX434032 Pseudomonas phage JBD30, complete genome 28542-28573 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511022 Pseudomonas phage CF74, partial genome 31743-31774 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KU199708 Pseudomonas phage JBD69, complete genome 28525-28556 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 DQ631426 Pseudomonas phage DMS3, complete genome 28076-28107 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511030 Pseudomonas phage CF213, partial genome 29080-29111 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511025 Pseudomonas phage CF118, partial genome 29109-29140 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JX434031 Pseudomonas phage JBD24, complete genome 28660-28691 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 DQ873690 Phage MP22, complete genome 27990-28021 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511023 Pseudomonas phage CF77, partial genome 29080-29111 0 1.0
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511029 Pseudomonas phage CF183, partial genome 29864-29895 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 AY394005 Bacteriophage D3112, complete genome 17013-17044 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 JN811560 Pseudomonas phage JBD26, complete genome 17087-17118 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389337 UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence 14770-14801 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NC_027298 Pseudomonas phage LPB1, complate genome 16354-16385 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 21925-21956 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 JQ067085 Pseudomonas phage PaMx73, complete genome 15822-15853 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NC_005178 Pseudomonas phage D3112, complete genome 17013-17044 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389261 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence 1565-1596 0 1.0
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM233689 Pseudomonas phage H70, complete genome 16908-16939 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_009818 Pseudomonas phage MP22, complete genome 27990-28020 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511059 Pseudomonas phage CF78, partial genome 31252-31282 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511036 Pseudomonas phage BR327, partial genome 28810-28840 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511031 Pseudomonas phage BR52, partial genome 22474-22504 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511034 Pseudomonas phage BR243, partial genome 29114-29144 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389262 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence 1357-1387 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 9485-9515 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511033 Pseudomonas phage BR205, partial genome 29179-29209 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_027298 Pseudomonas phage LPB1, complate genome 28394-28424 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JQ762257 Pseudomonas phage MP42, complete genome 28503-28533 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511017 Pseudomonas phage CF23, partial genome 29130-29160 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JX434033 Pseudomonas phage JBD88a, complete genome 28008-28038 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511061 Pseudomonas phage CF125, partial genome 31251-31281 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_027992 Pseudomonas phage JBD25, complete genome 31418-31448 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 9483-9513 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 20196-20226 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK144667 Pseudomonas phage Spike, complete genome 29176-29206 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 8390-8420 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511018 Pseudomonas phage CF28, partial genome 28842-28872 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KU199707 Pseudomonas phage JBD16C, partial genome 28000-28030 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JQ067085 Pseudomonas phage PaMx73, complete genome 28156-28186 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511026 Pseudomonas phage CF121, partial genome 29082-29112 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 28900-28930 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KJ477077 Pseudomonas phage JD024, complete genome 27879-27909 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511063 Pseudomonas phage CF177, partial genome 30566-30596 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 28616-28646 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 28815-28845 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JX434030 Pseudomonas phage JBD5, complete genome 29321-29351 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_030918 Pseudomonas phage JBD93, complete genome 28205-28235 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MH719192 Pseudomonas phage Ps56, complete genome 31402-31432 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 EU272037 Pseudomonas phage MP38, complete genome 28472-28502 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 28984-29014 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JX434032 Pseudomonas phage JBD30, complete genome 28542-28572 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511022 Pseudomonas phage CF74, partial genome 31743-31773 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KU199708 Pseudomonas phage JBD69, complete genome 28525-28555 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 DQ631426 Pseudomonas phage DMS3, complete genome 28076-28106 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511030 Pseudomonas phage CF213, partial genome 29080-29110 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511025 Pseudomonas phage CF118, partial genome 29109-29139 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JX434031 Pseudomonas phage JBD24, complete genome 28660-28690 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 DQ873690 Phage MP22, complete genome 27990-28020 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511023 Pseudomonas phage CF77, partial genome 29080-29110 0 1.0
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511029 Pseudomonas phage CF183, partial genome 29864-29894 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 AY394005 Bacteriophage D3112, complete genome 17014-17044 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 JN811560 Pseudomonas phage JBD26, complete genome 17088-17118 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389337 UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence 14771-14801 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NC_027298 Pseudomonas phage LPB1, complate genome 16355-16385 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 21925-21955 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 JQ067085 Pseudomonas phage PaMx73, complete genome 15823-15853 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NC_005178 Pseudomonas phage D3112, complete genome 17014-17044 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389261 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence 1566-1596 0 1.0
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM233689 Pseudomonas phage H70, complete genome 16909-16939 0 1.0
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK934841 Pseudomonas phage UMP151, complete genome 30365-30396 1 0.969
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 KM389238 UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence 9126-9157 1 0.969
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 42124-42155 1 0.969
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 KT887557 Pseudomonas phage phi1, complete genome 56921-56952 1 0.969
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 43293-43324 1 0.969
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 NC_011373 Pseudomonas phage PAJU2, complete genome 27755-27786 1 0.969
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 42938-42969 1 0.969
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 AP009624 Pseudomonas phage PAJU2 DNA, complete genome 27755-27786 1 0.969
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 41941-41972 1 0.969
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 44290-44321 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 30664-30695 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 31152-31183 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_009818 Pseudomonas phage MP22, complete genome 29990-30021 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511036 Pseudomonas phage BR327, partial genome 30810-30841 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 30316-30347 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 7484-7515 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JX434033 Pseudomonas phage JBD88a, complete genome 30008-30039 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 22196-22227 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 30777-30808 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 6397-6428 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 MK511018 Pseudomonas phage CF28, partial genome 30842-30873 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KU199707 Pseudomonas phage JBD16C, partial genome 30000-30031 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JQ067085 Pseudomonas phage PaMx73, complete genome 30156-30187 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 30876-30907 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 30900-30931 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KJ477077 Pseudomonas phage JD024, complete genome 29879-29910 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 30616-30647 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 30815-30846 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JX434030 Pseudomonas phage JBD5, complete genome 31321-31352 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_030918 Pseudomonas phage JBD93, complete genome 30205-30236 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 6406-6437 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 28127-28158 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JX434032 Pseudomonas phage JBD30, complete genome 30542-30573 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 KU199708 Pseudomonas phage JBD69, complete genome 30525-30556 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 NC_024782 Pseudomonas phage MP48, complete genome 30416-30447 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 DQ873690 Phage MP22, complete genome 29990-30021 1 0.969
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 EU272036 Pseudomonas phage MP29, complete genome 30209-30240 1 0.969
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 18799-18830 1 0.969
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 10899-10930 1 0.969
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK144667 Pseudomonas phage Spike, complete genome 19876-19907 1 0.969
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KJ477077 Pseudomonas phage JD024, complete genome 18564-18595 1 0.969
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM233689 Pseudomonas phage H70, complete genome 19652-19683 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KM389234 UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00002 genomic sequence 4455-4486 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MH719194 Pseudomonas phage Ps60, complete genome 33432-33463 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511036 Pseudomonas phage BR327, partial genome 30980-31011 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511031 Pseudomonas phage BR52, partial genome 24647-24678 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511034 Pseudomonas phage BR243, partial genome 31287-31318 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511033 Pseudomonas phage BR205, partial genome 31352-31383 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511017 Pseudomonas phage CF23, partial genome 31303-31334 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK144667 Pseudomonas phage Spike, complete genome 31349-31380 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511018 Pseudomonas phage CF28, partial genome 31012-31043 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511026 Pseudomonas phage CF121, partial genome 31255-31286 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 30985-31016 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511022 Pseudomonas phage CF74, partial genome 33916-33947 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511030 Pseudomonas phage CF213, partial genome 31253-31284 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511025 Pseudomonas phage CF118, partial genome 31282-31313 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511023 Pseudomonas phage CF77, partial genome 31253-31284 1 0.969
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 MK511029 Pseudomonas phage CF183, partial genome 32037-32068 1 0.969
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 KJ959591 Pseudomonas phage PAN70, partial genome 14032-14063 1 0.969
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NC_031091 Pseudomonas phage MD8, complete genome 15891-15922 1 0.969
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 KC862296 Pseudomonas phage P3_CHA, complete genome 71817-71848 1 0.969
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 MT118295 Pseudomonas phage Epa18, complete genome 6788-6819 1 0.969
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 KC862299 Pseudomonas phage PAK_P3, complete genome 71817-71848 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511008 Pseudomonas phage CF124, partial genome 24635-24666 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511013 Pseudomonas phage BR161, partial genome 37340-37371 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511002 Pseudomonas phage CF57, partial genome 37239-37270 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511009 Pseudomonas phage CF136, partial genome 37195-37226 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511003 Pseudomonas phage CF65, partial genome 37226-37257 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 23534-23565 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MK511005 Pseudomonas phage CF81, partial genome 37331-37362 1 0.969
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 22809-22840 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 16189-16220 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511031 Pseudomonas phage BR52, partial genome 10163-10194 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511034 Pseudomonas phage BR243, partial genome 16803-16834 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511033 Pseudomonas phage BR205, partial genome 16868-16899 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511017 Pseudomonas phage CF23, partial genome 16819-16850 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK144667 Pseudomonas phage Spike, complete genome 16868-16899 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 21216-21247 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511026 Pseudomonas phage CF121, partial genome 16771-16802 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 JX434030 Pseudomonas phage JBD5, complete genome 16500-16531 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 20533-20564 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 16157-16188 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511022 Pseudomonas phage CF74, partial genome 19432-19463 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511030 Pseudomonas phage CF213, partial genome 16769-16800 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511025 Pseudomonas phage CF118, partial genome 16798-16829 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511023 Pseudomonas phage CF77, partial genome 16769-16800 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MK511029 Pseudomonas phage CF183, partial genome 17553-17584 1 0.969
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 EU272036 Pseudomonas phage MP29, complete genome 16082-16113 1 0.969
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511008 Pseudomonas phage CF124, partial genome 24636-24666 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511013 Pseudomonas phage BR161, partial genome 37341-37371 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511002 Pseudomonas phage CF57, partial genome 37240-37270 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511009 Pseudomonas phage CF136, partial genome 37196-37226 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511003 Pseudomonas phage CF65, partial genome 37227-37257 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 23535-23565 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MK511005 Pseudomonas phage CF81, partial genome 37332-37362 1 0.968
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 22810-22840 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 16190-16220 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511031 Pseudomonas phage BR52, partial genome 10164-10194 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511034 Pseudomonas phage BR243, partial genome 16804-16834 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511033 Pseudomonas phage BR205, partial genome 16869-16899 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511017 Pseudomonas phage CF23, partial genome 16820-16850 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK144667 Pseudomonas phage Spike, complete genome 16869-16899 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 21216-21246 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511026 Pseudomonas phage CF121, partial genome 16772-16802 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 JX434030 Pseudomonas phage JBD5, complete genome 16501-16531 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 20533-20563 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 16158-16188 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511022 Pseudomonas phage CF74, partial genome 19433-19463 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511030 Pseudomonas phage CF213, partial genome 16770-16800 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511025 Pseudomonas phage CF118, partial genome 16799-16829 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511023 Pseudomonas phage CF77, partial genome 16770-16800 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MK511029 Pseudomonas phage CF183, partial genome 17554-17584 1 0.968
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 EU272036 Pseudomonas phage MP29, complete genome 16083-16113 1 0.968
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MH719194 Pseudomonas phage Ps60, complete genome 31315-31346 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 29202-29233 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511031 Pseudomonas phage BR52, partial genome 22527-22558 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511034 Pseudomonas phage BR243, partial genome 29167-29198 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511033 Pseudomonas phage BR205, partial genome 29232-29263 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511017 Pseudomonas phage CF23, partial genome 29183-29214 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK144667 Pseudomonas phage Spike, complete genome 29229-29260 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511026 Pseudomonas phage CF121, partial genome 29135-29166 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511022 Pseudomonas phage CF74, partial genome 31796-31827 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511030 Pseudomonas phage CF213, partial genome 29133-29164 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511025 Pseudomonas phage CF118, partial genome 29162-29193 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511023 Pseudomonas phage CF77, partial genome 29133-29164 2 0.938
NZ_ASRD01000188_1 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1370-1401 32 MK511029 Pseudomonas phage CF183, partial genome 29917-29948 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 123799-123830 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 113804-113835 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 148602-148633 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 119419-119450 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 112951-112982 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 113104-113135 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 165303-165334 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 150729-150760 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 440044-440075 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 116452-116483 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 398781-398812 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 116234-116265 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 118914-118945 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 115504-115535 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 117232-117263 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 360806-360837 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 190944-190975 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 398692-398723 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 116429-116460 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 46122-46153 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 188852-188883 2 0.938
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 119882-119913 2 0.938
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 KT887557 Pseudomonas phage phi1, complete genome 57104-57135 2 0.938
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 EU272037 Pseudomonas phage MP38, complete genome 30472-30503 2 0.938
NZ_ASRD01000188_1 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1970-2001 32 JX434031 Pseudomonas phage JBD24, complete genome 30660-30691 2 0.938
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NC_030918 Pseudomonas phage JBD93, complete genome 30375-30406 2 0.938
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 DQ631426 Pseudomonas phage DMS3, complete genome 30246-30277 2 0.938
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 JX434031 Pseudomonas phage JBD24, complete genome 30830-30861 2 0.938
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 KM389225 UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence 18827-18858 2 0.938
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MG707188 Pseudomonas phage TC7, partial genome 636-667 2 0.938
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 26335-26366 2 0.938
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NC_030931 Pseudomonas phage phi2, complete genome 35361-35392 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 28664-28695 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 29149-29180 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 28316-28347 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 28777-28808 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 8397-8428 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 28876-28907 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 8406-8437 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 26127-26158 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM233689 Pseudomonas phage H70, complete genome 28950-28981 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_024782 Pseudomonas phage MP48, complete genome 28416-28447 2 0.938
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 EU272036 Pseudomonas phage MP29, complete genome 28209-28240 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 16006-16037 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 16157-16188 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 21785-21816 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 8074-8105 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 16119-16150 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 21055-21086 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 16218-16249 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 KJ477077 Pseudomonas phage JD024, complete genome 15578-15609 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 13469-13500 2 0.938
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NC_024782 Pseudomonas phage MP48, complete genome 16082-16113 2 0.938
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 28664-28694 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MH719191 Pseudomonas phage Fc22, complete genome 29837-29867 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 29149-29179 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_006548 Pseudomonas phage B3, complete genome 30653-30683 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 28316-28346 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 AF232233 Bacteriophage B3, complete genome 30653-30683 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 28777-28807 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 8398-8428 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511057 Pseudomonas phage CF5, partial genome 27883-27913 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 28876-28906 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 8407-8437 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 26127-26157 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MH719189 Pseudomonas phage Fc02, complete genome 29774-29804 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM233689 Pseudomonas phage H70, complete genome 28950-28980 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK934841 Pseudomonas phage UMP151, complete genome 30312-30342 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 KM389238 UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence 9180-9210 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_024782 Pseudomonas phage MP48, complete genome 28416-28446 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 JX495041 Pseudomonas phage JBD18, complete genome 30586-30616 2 0.935
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 EU272036 Pseudomonas phage MP29, complete genome 28209-28239 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 16007-16037 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 16158-16188 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 21785-21815 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 8075-8105 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 16120-16150 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 21055-21085 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 16219-16249 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 KJ477077 Pseudomonas phage JD024, complete genome 15579-15609 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 13470-13500 2 0.935
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NC_024782 Pseudomonas phage MP48, complete genome 16083-16113 2 0.935
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_009818 Pseudomonas phage MP22, complete genome 18858-18889 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511036 Pseudomonas phage BR327, partial genome 19977-20008 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JQ762257 Pseudomonas phage MP42, complete genome 19675-19706 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JX434033 Pseudomonas phage JBD88a, complete genome 18847-18878 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389243 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence 5942-5973 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511018 Pseudomonas phage CF28, partial genome 20009-20040 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KU199707 Pseudomonas phage JBD16C, partial genome 18824-18855 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 19768-19799 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 19484-19515 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 19982-20013 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 EU272037 Pseudomonas phage MP38, complete genome 19320-19351 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JX434032 Pseudomonas phage JBD30, complete genome 19714-19745 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KU199708 Pseudomonas phage JBD69, complete genome 19697-19728 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 DQ631426 Pseudomonas phage DMS3, complete genome 19243-19274 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_024782 Pseudomonas phage MP48, complete genome 19432-19463 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JX434031 Pseudomonas phage JBD24, complete genome 19827-19858 3 0.906
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 DQ873690 Phage MP22, complete genome 18858-18889 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MH719191 Pseudomonas phage Fc22, complete genome 29837-29868 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NC_006548 Pseudomonas phage B3, complete genome 30653-30684 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 AF232233 Bacteriophage B3, complete genome 30653-30684 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511057 Pseudomonas phage CF5, partial genome 27883-27914 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MH719189 Pseudomonas phage Fc02, complete genome 29774-29805 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK934841 Pseudomonas phage UMP151, complete genome 30312-30343 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 KM389238 UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence 9179-9210 3 0.906
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 JX495041 Pseudomonas phage JBD18, complete genome 30586-30617 3 0.906
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 242353-242384 5 0.844
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 242353-242383 5 0.839
NZ_ASRD01000188_1 1.3|1430|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1430-1461 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 930539-930570 6 0.812
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 MK819239 Pseudomonas phage vB_PaeP_YA3, complete genome 23593-23624 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389237 UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00001 genomic sequence 10768-10799 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719191 Pseudomonas phage Fc22, complete genome 20431-20462 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719195 Pseudomonas phage Ps59, complete genome 21199-21230 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_027992 Pseudomonas phage JBD25, complete genome 22007-22038 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK511057 Pseudomonas phage CF5, partial genome 18476-18507 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719192 Pseudomonas phage Ps56, complete genome 21996-22027 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719190 Pseudomonas phage H71, complete genome 20402-20433 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719189 Pseudomonas phage Fc02, complete genome 20367-20398 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MK934841 Pseudomonas phage UMP151, complete genome 20896-20927 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 KM389233 UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00001 genomic sequence 6522-6553 6 0.812
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 MH719193 Pseudomonas phage H72, complete genome 20825-20856 6 0.812
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 KT887557 Pseudomonas phage phi1, complete genome 55753-55784 7 0.781
NZ_ASRD01000188_1 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1790-1821 32 NZ_CP013052 Sinorhizobium americanum CCGM7 plasmid A, complete sequence 378775-378806 7 0.781
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 MK524530 Mycobacterium phage Pharaoh, complete genome 12291-12322 7 0.781
NZ_ASRD01000188_1 1.11|1910|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1910-1941 32 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 279343-279374 7 0.781
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 JQ680365 Unidentified phage clone 2200_scaffold2278 genomic sequence 18085-18116 7 0.781
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 445768-445799 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 87828-87859 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 618101-618132 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 76852-76883 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 237642-237673 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 83284-83315 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 2395-2426 7 0.781
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 810968-810999 7 0.781
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 247715-247746 7 0.781
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 445769-445799 7 0.774
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP012699 Microbacterium sp. No. 7 plasmid B, complete sequence 1323-1353 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 87829-87859 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 618101-618131 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 76852-76882 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 237643-237673 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 83284-83314 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 2395-2425 7 0.774
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 810968-810998 7 0.774
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 247716-247746 7 0.774
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NZ_CP021745 Agarilytica rhodophyticola strain 017 plasmid pSU1, complete sequence 36269-36300 8 0.75
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 443806-443837 8 0.75
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 242440-242471 8 0.75
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 490127-490158 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 86157-86188 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 299763-299794 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 372136-372167 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 746196-746227 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 877822-877853 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 877822-877853 8 0.75
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 239013-239044 8 0.75
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP012699 Microbacterium sp. No. 7 plasmid B, complete sequence 1323-1354 8 0.75
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1326053-1326084 8 0.75
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 847177-847208 8 0.75
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 MN536027 Pseudomonas phage vB_Pae-SS2019XII, complete genome 12415-12445 8 0.742
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 99552-99582 8 0.742
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1326053-1326083 8 0.742
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 847178-847208 8 0.742
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 745685-745715 8 0.742
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1290739-1290769 8 0.742
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 472862-472892 8 0.742
NZ_ASRD01000188_1 1.1|1310|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1310-1341 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 683346-683377 9 0.719
NZ_ASRD01000188_1 1.3|1430|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1430-1461 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 391449-391480 9 0.719
NZ_ASRD01000188_1 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2030-2061 32 NC_024123 Pseudomonas phage KPP25 DNA, complete sequence 18719-18750 9 0.719
NZ_ASRD01000188_1 1.15|2150|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2150-2181 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 948697-948728 9 0.719
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 NZ_CP044991 Deinococcus sp. AJ005 plasmid p115k, complete sequence 55938-55969 9 0.719
NZ_ASRD01000188_1 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2210-2241 32 KT001914 Caulobacter phage Seuss, complete genome 19069-19100 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1816193-1816224 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 784036-784067 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 119173-119204 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 166509-166540 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 408348-408379 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 263438-263469 9 0.719
NZ_ASRD01000188_1 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2270-2301 32 MN693917 Marine virus AFVG_250M787, complete genome 39672-39703 9 0.719
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 MN693532 Marine virus AFVG_25M340, complete genome 2896-2927 9 0.719
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 MN536027 Pseudomonas phage vB_Pae-SS2019XII, complete genome 12415-12446 9 0.719
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 99552-99583 9 0.719
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_AP018668 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence 8013-8044 9 0.719
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 745685-745716 9 0.719
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1290739-1290770 9 0.719
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 472862-472893 9 0.719
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 354673-354703 9 0.71
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 946718-946748 9 0.71
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 147022-147052 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 9205-9235 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511042 Pseudomonas phage CF126, partial genome 10702-10732 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511040 Pseudomonas phage CF63, partial genome 57193-57223 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511051 Pseudomonas phage BR181, partial genome 56270-56300 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511041 Pseudomonas phage CF69, partial genome 10730-10760 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511049 Pseudomonas phage BR326, partial genome 56270-56300 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511045 Pseudomonas phage BR208, partial genome 56270-56300 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511044 Pseudomonas phage BR197, partial genome 10730-10760 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511050 Pseudomonas phage BR150, partial genome 10658-10688 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511048 Pseudomonas phage BR320, partial genome 10658-10688 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511046 Pseudomonas phage BR313, partial genome 56270-56300 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511047 Pseudomonas phage BR319, partial genome 10834-10864 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511043 Pseudomonas phage BR228, partial genome 6779-6809 9 0.71
NZ_ASRD01000188_1 1.24|2451|31|NZ_ASRD01000188|PILER-CR 2451-2481 31 MK511039 Pseudomonas phage CF24, partial genome 10730-10760 9 0.71
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 13096-13126 9 0.71
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_AP018668 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence 8014-8044 9 0.71
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 353802-353832 9 0.71
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 403805-403835 9 0.71
NZ_ASRD01000188_1 1.25|2511|31|NZ_ASRD01000188|PILER-CR 2511-2541 31 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 587526-587556 9 0.71
NZ_ASRD01000188_1 1.4|1490|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1490-1521 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 193294-193325 10 0.688
NZ_ASRD01000188_1 1.5|1550|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1550-1581 32 MN783747 Klebsiella oxytoca plasmid pIron_OXY, complete sequence 8391-8422 10 0.688
NZ_ASRD01000188_1 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1610-1641 32 NZ_AP018284 Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome 31677-31708 10 0.688
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 412494-412525 10 0.688
NZ_ASRD01000188_1 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1730-1761 32 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 56719-56750 10 0.688
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 235448-235479 10 0.688
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 58313-58344 10 0.688
NZ_ASRD01000188_1 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 1850-1881 32 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 114009-114040 10 0.688
NZ_ASRD01000188_1 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2090-2121 32 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 92525-92556 10 0.688
NZ_ASRD01000188_1 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2090-2121 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 349542-349573 10 0.688
NZ_ASRD01000188_1 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2090-2121 32 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 138317-138348 10 0.688
NZ_ASRD01000188_1 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2090-2121 32 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 356729-356760 10 0.688
NZ_ASRD01000188_1 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT 2090-2121 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 57580-57611 10 0.688
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 MN694153 Marine virus AFVG_250M457, complete genome 33929-33960 10 0.688
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 NZ_CP032528 Bacillus megaterium NCT-2 plasmid pNCT2_1, complete sequence 78653-78684 10 0.688
NZ_ASRD01000188_1 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2330-2361 32 MN693930 Marine virus AFVG_250M489, complete genome 32736-32767 10 0.688
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 354672-354703 10 0.688
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 53663-53694 10 0.688
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 946717-946748 10 0.688
NZ_ASRD01000188_1 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2390-2421 32 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 147021-147052 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511042 Pseudomonas phage CF126, partial genome 10702-10733 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511040 Pseudomonas phage CF63, partial genome 57193-57224 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511051 Pseudomonas phage BR181, partial genome 56270-56301 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511041 Pseudomonas phage CF69, partial genome 10730-10761 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511049 Pseudomonas phage BR326, partial genome 56270-56301 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511045 Pseudomonas phage BR208, partial genome 56270-56301 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511044 Pseudomonas phage BR197, partial genome 10730-10761 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511050 Pseudomonas phage BR150, partial genome 10658-10689 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511048 Pseudomonas phage BR320, partial genome 10658-10689 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511046 Pseudomonas phage BR313, partial genome 56270-56301 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511047 Pseudomonas phage BR319, partial genome 10834-10865 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511043 Pseudomonas phage BR228, partial genome 6779-6810 10 0.688
NZ_ASRD01000188_1 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2450-2481 32 MK511039 Pseudomonas phage CF24, partial genome 10730-10761 10 0.688
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 13096-13127 10 0.688
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 353802-353833 10 0.688
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 403805-403836 10 0.688
NZ_ASRD01000188_1 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT 2510-2541 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 587525-587556 10 0.688
NZ_ASRD01000188_1 1.23|2391|31|NZ_ASRD01000188|PILER-CR 2391-2421 31 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 53664-53694 10 0.677

1. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

2. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_006548 (Pseudomonas phage B3, complete genome) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

3. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389245 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00004 genomic sequence) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

4. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to AF232233 (Bacteriophage B3, complete genome) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

5. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511057 (Pseudomonas phage CF5, partial genome) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

6. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719189 (Pseudomonas phage Fc02, complete genome) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

7. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389336 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggttgcaacgtcgccacggta	Protospacer
********************************

8. spacer 1.7|1670|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 0, identity: 1.0

gcgaacgaccaaggggtgtgctggccggcggt	CRISPR spacer
gcgaacgaccaaggggtgtgctggccggcggt	Protospacer
********************************

9. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

10. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

11. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

12. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

13. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

14. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 0, identity: 1.0

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatcaagcgcggcgtggaagtgctttat	Protospacer
********************************

15. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

16. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

17. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511008 (Pseudomonas phage CF124, partial genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

18. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511013 (Pseudomonas phage BR161, partial genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

19. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

20. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

21. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

22. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

23. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

24. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

25. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 0, identity: 1.0

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggcggaga	Protospacer
********************************

26. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 0, identity: 1.0

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccaactcgctccaatccga	Protospacer
********************************

27. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389212 (UNVERIFIED: Pseudomonas phage JBD88b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccaactcgctccaatccga	Protospacer
********************************

28. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389210 (UNVERIFIED: Pseudomonas phage DO4 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccaactcgctccaatccga	Protospacer
********************************

29. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389463 (UNVERIFIED: Pseudomonas phage JBD94b clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccaactcgctccaatccga	Protospacer
********************************

30. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030929 (Pseudomonas phage JBD44, complete genome) position: , mismatch: 0, identity: 1.0

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccaactcgctccaatccga	Protospacer
********************************

31. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389234 (UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00002 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

32. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

33. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719194 (Pseudomonas phage Ps60, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

34. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

35. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

36. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

37. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389262 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

38. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

39. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

40. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

41. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

42. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027992 (Pseudomonas phage JBD25, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

43. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

44. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

45. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

46. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

47. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

48. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719192 (Pseudomonas phage Ps56, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

49. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

50. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

51. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

52. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

53. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389336 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

54. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

55. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

56. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

57. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 0, identity: 1.0

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcaggatatttgtcga	Protospacer
********************************

58. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

59. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

60. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

61. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

62. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

63. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

64. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

65. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

66. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

67. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

68. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389264 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000634 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

69. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

70. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

71. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

72. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

73. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

74. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

75. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

76. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

77. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

78. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

79. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

80. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

81. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

82. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389336 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

83. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

84. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

85. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

86. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

87. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 0, identity: 1.0

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tctttagggtctggtgctcgtagtccaggacg	Protospacer
********************************

88. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

89. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

90. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

91. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

92. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027992 (Pseudomonas phage JBD25, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

93. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

94. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

95. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

96. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

97. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

98. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

99. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389336 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

100. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 0, identity: 1.0

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagctggatatca	Protospacer
********************************

101. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510993 (Pseudomonas phage BR201, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

102. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510962 (Pseudomonas phage CF3, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

103. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

104. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

105. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510965 (Pseudomonas phage CF34, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

106. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

107. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

108. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

109. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

110. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

111. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KY707339 (Pseudomonas phage JBD68, complete genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

112. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

113. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

114. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510968 (Pseudomonas phage CF55, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

115. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

116. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 0, identity: 1.0

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccaggtcgatc	Protospacer
********************************

117. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 0, identity: 1.0

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
gcatcaaagatattgaaaagcatcaacgacga	Protospacer
********************************

118. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

119. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511059 (Pseudomonas phage CF78, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

120. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

121. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

122. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

123. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389262 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

124. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

125. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

126. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

127. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

128. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

129. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

130. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511061 (Pseudomonas phage CF125, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

131. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_027992 (Pseudomonas phage JBD25, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

132. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

133. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

134. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

135. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

136. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

137. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

138. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

139. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

140. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

141. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

142. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511063 (Pseudomonas phage CF177, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

143. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

144. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

145. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

146. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

147. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH719192 (Pseudomonas phage Ps56, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

148. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

149. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

150. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

151. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

152. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

153. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

154. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

155. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

156. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

157. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

158. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

159. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 0, identity: 1.0

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacagggtggca	Protospacer
********************************

160. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

161. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

162. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389337 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

163. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

164. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

165. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

166. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

167. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389261 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

168. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 0, identity: 1.0

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcacgctggatcggatcgactgat	Protospacer
********************************

169. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

170. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511059 (Pseudomonas phage CF78, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

171. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

172. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

173. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

174. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389262 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000624 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

175. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

176. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

177. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

178. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

179. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

180. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

181. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511061 (Pseudomonas phage CF125, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

182. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_027992 (Pseudomonas phage JBD25, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

183. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

184. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

185. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

186. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

187. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

188. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

189. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

190. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

191. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

192. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

193. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511063 (Pseudomonas phage CF177, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

194. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

195. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

196. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

197. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

198. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MH719192 (Pseudomonas phage Ps56, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

199. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

200. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

201. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

202. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

203. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

204. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

205. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

206. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

207. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

208. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

209. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

210. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 0, identity: 1.0

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacagggtggca	Protospacer
*******************************

211. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

212. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

213. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389337 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

214. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

215. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

216. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

217. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

218. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389261 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

219. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 0, identity: 1.0

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcacgctggatcggatcgactgat	Protospacer
*******************************

220. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK934841 (Pseudomonas phage UMP151, complete genome) position: , mismatch: 1, identity: 0.969

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccatcgggttgcaacgtcgccacggta	Protospacer
******** ***********************

221. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389238 (UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 1, identity: 0.969

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccatcgggttgcaacgtcgccacggta	Protospacer
******** ***********************

222. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 1, identity: 0.969

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
aaagcatcaagcgcggcgtggaagtgctttat	Protospacer
*.******************************

223. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 1, identity: 0.969

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
agagcatccagcgcggcgtggaagtgctttat	Protospacer
******** ***********************

224. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 1, identity: 0.969

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggtggaga	Protospacer
**************************.*****

225. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_011373 (Pseudomonas phage PAJU2, complete genome) position: , mismatch: 1, identity: 0.969

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggtggaga	Protospacer
**************************.*****

226. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 1, identity: 0.969

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggtggaga	Protospacer
**************************.*****

227. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to AP009624 (Pseudomonas phage PAJU2 DNA, complete genome) position: , mismatch: 1, identity: 0.969

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctccccggcaatagctggggtggaga	Protospacer
**************************.*****

228. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 1, identity: 0.969

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccagctcgctccaatccga	Protospacer
****************.***************

229. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 1, identity: 0.969

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctgtagcttctccagctcgctccaatccga	Protospacer
****************.***************

230. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

231. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

232. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

233. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acgactgattcgctttgcaggatatttgtcga	Protospacer
***.****************************

234. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

235. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

236. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

237. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

238. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

239. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

240. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acgactgattcgctttgcaggatatttgtcga	Protospacer
***.****************************

241. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

242. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggctgattcgctttgcagaatatttgtcga	Protospacer
********************.***********

243. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

244. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

245. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

246. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

247. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acgactgattcgctttgcaggatatttgtcga	Protospacer
***.****************************

248. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

249. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

250. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

251. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

252. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

253. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

254. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

255. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

256. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 1, identity: 0.969

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcaggatatttgtcga	Protospacer
*****.**************************

257. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcgtagtccaggacg	Protospacer
**** ***************************

258. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 1, identity: 0.969

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcgtagtccaggacg	Protospacer
**** ***************************

259. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 1, identity: 0.969

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcgtagtccaggacg	Protospacer
**** ***************************

260. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 1, identity: 0.969

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcgtagtccaggacg	Protospacer
**** ***************************

261. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 1, identity: 0.969

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcgtagtccaggacg	Protospacer
**** ***************************

262. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389234 (UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00002 genomic sequence) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

263. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719194 (Pseudomonas phage Ps60, complete genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

264. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

265. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

266. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

267. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

268. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

269. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

270. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

271. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

272. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

273. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

274. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

275. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

276. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

277. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 1, identity: 0.969

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcctggagcagttggatatca	Protospacer
**********************.*********

278. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KJ959591 (Pseudomonas phage PAN70, partial genome) position: , mismatch: 1, identity: 0.969

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccagatcgatc	Protospacer
*************************.******

279. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 1, identity: 0.969

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcactaggtcgatc	Protospacer
**********************.*********

280. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KC862296 (Pseudomonas phage P3_CHA, complete genome) position: , mismatch: 1, identity: 0.969

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
gcatcaaagatattgaaaagcatcaacgacgg	Protospacer
*******************************.

281. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MT118295 (Pseudomonas phage Epa18, complete genome) position: , mismatch: 1, identity: 0.969

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
gcatcaaagatattgaaaagcatcaacgacgg	Protospacer
*******************************.

282. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KC862299 (Pseudomonas phage PAK_P3, complete genome) position: , mismatch: 1, identity: 0.969

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
gcatcaaagatattgaaaagcatcaacgacgg	Protospacer
*******************************.

283. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511008 (Pseudomonas phage CF124, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

284. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511013 (Pseudomonas phage BR161, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

285. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

286. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511009 (Pseudomonas phage CF136, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

287. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

288. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

289. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

290. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 1, identity: 0.969

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgccccagcagcttggcaagctctgggacat	Protospacer
*** ****************************

291. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcactctggatcggatcgactgat	Protospacer
************ *******************

292. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

293. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

294. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

295. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

296. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

297. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggaacgctggatcggatcgactgat	Protospacer
********* **********************

298. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

299. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggaacgctggatcggatcgactgat	Protospacer
********* **********************

300. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcactctggatcggatcgactgat	Protospacer
************ *******************

301. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggaacgctggatcggatcgactgat	Protospacer
********* **********************

302. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

303. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

304. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

305. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

306. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgctggatcggatcgactgat	Protospacer
******.*************************

307. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 1, identity: 0.969

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcactctggatcggatcgactgat	Protospacer
************ *******************

308. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511008 (Pseudomonas phage CF124, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

309. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511013 (Pseudomonas phage BR161, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

310. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511002 (Pseudomonas phage CF57, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

311. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511009 (Pseudomonas phage CF136, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

312. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511003 (Pseudomonas phage CF65, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

313. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

314. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MK511005 (Pseudomonas phage CF81, partial genome) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

315. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 1, identity: 0.968

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cgccccagcagcttggcaagctctgggacat	Protospacer
** ****************************

316. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcactctggatcggatcgactgat	Protospacer
*********** *******************

317. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

318. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

319. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

320. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

321. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

322. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggaacgctggatcggatcgactgat	Protospacer
******** **********************

323. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

324. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggaacgctggatcggatcgactgat	Protospacer
******** **********************

325. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcactctggatcggatcgactgat	Protospacer
*********** *******************

326. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggaacgctggatcggatcgactgat	Protospacer
******** **********************

327. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

328. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

329. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

330. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

331. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgctggatcggatcgactgat	Protospacer
*****.*************************

332. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 1, identity: 0.968

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcactctggatcggatcgactgat	Protospacer
*********** *******************

333. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719194 (Pseudomonas phage Ps60, complete genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

334. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgaattgcaacgtcgccacggta	Protospacer
***********..*******************

335. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

336. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

337. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

338. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

339. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

340. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

341. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

342. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

343. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

344. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

345. spacer 1.2|1370|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 2, identity: 0.938

tcggaccagcgggttgcaacgtcgccacggta	CRISPR spacer
tcggaccagcgggtggcgacgtcgccacggta	Protospacer
************** **.**************

346. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

347. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

348. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

349. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

350. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

351. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

352. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

353. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

354. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

355. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

356. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

357. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

358. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

359. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

360. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

361. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

362. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

363. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

364. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

365. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

366. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

367. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcctcgatcagggttgttgtggattgcaaaga	Protospacer
** *****************.***********

368. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 2, identity: 0.938

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtcggtagcttctccagctcgctccaatccga	Protospacer
*** ************.***************

369. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 2, identity: 0.938

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
accgccgattcgctttgcaggatatttgtcga	Protospacer
** **.**************************

370. spacer 1.12|1970|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 2, identity: 0.938

acggctgattcgctttgcaggatatttgtcga	CRISPR spacer
acggccgattcgctttgcagaatatttgtcga	Protospacer
*****.**************.***********

371. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 2, identity: 0.938

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggctgctggagcagctggatatca	Protospacer
**********.* *******************

372. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 2, identity: 0.938

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttcttggagcagttggatatca	Protospacer
*************.********.*********

373. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 2, identity: 0.938

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggctgctggagcagctggatatca	Protospacer
**********.* *******************

374. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389225 (UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcaccagatcgata	Protospacer
*************************.***** 

375. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 2, identity: 0.938

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcacaagatcgatc	Protospacer
********************** **.******

376. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcaaggcggatcgtatgcaccaggtcgatc	Protospacer
****.******* *******************

377. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 2, identity: 0.938

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
catcgaggcggagcgtatgcacaagatcgatc	Protospacer
********************** **.******

378. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

379. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacggatactgcgacggcggacacggcggca	Protospacer
************************ **.****

380. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

381. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

382. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

383. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

384. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

385. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

386. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggaactgcgacggcggacagggtggca	Protospacer
******. ************************

387. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

388. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 2, identity: 0.938

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
gtacgggtactgcgacggtggacagggtggca	Protospacer
******.***********.*************

389. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

390. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

391. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

392. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

393. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

394. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

395. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

396. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

397. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

398. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 2, identity: 0.938

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaatggcacgttggatcggatcgactgat	Protospacer
******.******.******************

399. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

400. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MH719191 (Pseudomonas phage Fc22, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

401. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacggatactgcgacggcggacacggcggca	Protospacer
*********************** **.****

402. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_006548 (Pseudomonas phage B3, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

403. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

404. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to AF232233 (Bacteriophage B3, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

405. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

406. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

407. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511057 (Pseudomonas phage CF5, partial genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

408. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

409. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

410. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

411. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MH719189 (Pseudomonas phage Fc02, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

412. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

413. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK934841 (Pseudomonas phage UMP151, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

414. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to KM389238 (UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

415. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

416. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to JX495041 (Pseudomonas phage JBD18, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggaactgcgacggcggacagggtggca	Protospacer
*****. ************************

417. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 2, identity: 0.935

tacggatactgcgacggcggacagggtggca	CRISPR spacer
tacgggtactgcgacggtggacagggtggca	Protospacer
*****.***********.*************

418. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

419. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

420. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

421. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

422. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

423. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

424. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

425. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

426. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

427. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 2, identity: 0.935

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaatggcacgttggatcggatcgactgat	Protospacer
*****.******.******************

428. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

429. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

430. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

431. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

432. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389243 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

433. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

434. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

435. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

436. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

437. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

438. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

439. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

440. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

441. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

442. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

443. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

444. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 3, identity: 0.906

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tcttgagggtctggtgctcatagtccaggaca	Protospacer
**** **************.***********.

445. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH719191 (Pseudomonas phage Fc22, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

446. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_006548 (Pseudomonas phage B3, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

447. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to AF232233 (Bacteriophage B3, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

448. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511057 (Pseudomonas phage CF5, partial genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

449. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MH719189 (Pseudomonas phage Fc02, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

450. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK934841 (Pseudomonas phage UMP151, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

451. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to KM389238 (UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

452. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to JX495041 (Pseudomonas phage JBD18, complete genome) position: , mismatch: 3, identity: 0.906

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
atacgggaactgcgacggcggacagggtggca	Protospacer
.*****. ************************

453. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 5, identity: 0.844

gctcaacggcacgctggatcggatcga--ctgat	CRISPR spacer
gctcaacggcatgctggaccggatcgaggccg--	Protospacer
***********.******.********  *.*  

454. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 5, identity: 0.839

ctcaacggcacgctggatcggatcga--ctgat	CRISPR spacer
ctcaacggcatgctggaccggatcgaggccg--	Protospacer
**********.******.********  *.*  

455. spacer 1.3|1430|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

atgagggcggtacgggtggacgccatgctgtt	CRISPR spacer
agcggggcgggacgggtggacgccatcctgat	Protospacer
*  .****** *************** *** *

456. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK819239 (Pseudomonas phage vB_PaeP_YA3, complete genome) position: , mismatch: 6, identity: 0.812

catgccctccccggcaatagctggggcggaga	CRISPR spacer
cctctcctccccggcaatagctggggagggca	Protospacer
* * .********************* **. *

457. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389237 (UNVERIFIED: Pseudomonas phage F_HA1208sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

458. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719191 (Pseudomonas phage Fc22, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

459. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719195 (Pseudomonas phage Ps59, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

460. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_027992 (Pseudomonas phage JBD25, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

461. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK511057 (Pseudomonas phage CF5, partial genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

462. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719192 (Pseudomonas phage Ps56, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

463. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719190 (Pseudomonas phage H71, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

464. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719189 (Pseudomonas phage Fc02, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

465. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK934841 (Pseudomonas phage UMP151, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

466. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KM389233 (UNVERIFIED: Pseudomonas phage F_TK1727sp/MX560 clone contig00001 genomic sequence) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

467. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MH719193 (Pseudomonas phage H72, complete genome) position: , mismatch: 6, identity: 0.812

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
tccacagggtctggtgctcgtagtcgagcacc	Protospacer
**. .******************** ** ** 

468. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT887557 (Pseudomonas phage phi1, complete genome) position: , mismatch: 7, identity: 0.781

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccatccccggcaatagctgggtggagag	Protospacer
****** ******************  *....

469. spacer 1.9|1790|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013052 (Sinorhizobium americanum CCGM7 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.781

catgccctccccggcaatagctggggcggaga	CRISPR spacer
catgccctcccctgcaatagatgggacaaatg	Protospacer
************ ******* ****.*..* .

470. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MK524530 (Mycobacterium phage Pharaoh, complete genome) position: , mismatch: 7, identity: 0.781

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
gtctggagcttctccaactcgatccaggcttt	Protospacer
***** *************** ****. *.  

471. spacer 1.11|1910|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 7, identity: 0.781

acgcatggtcaactccgacgaacggctgttgt	CRISPR spacer
agccagtggcaactccgacgaacgcctgtggt	Protospacer
*  **  * *************** **** **

472. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to JQ680365 (Unidentified phage clone 2200_scaffold2278 genomic sequence) position: , mismatch: 7, identity: 0.781

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
ctgtgagggtctggtgctcgtagtcgacgaca	Protospacer
.. * ******************** * ***.

473. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcggcccagcagctcggccagctccgccgcgt	Protospacer
**************.*** *****.*  .*.*

474. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

475. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcacggcgtcggcggacagggtggcg	Protospacer
   ****   .** *** ****************.

476. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

477. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

478. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

479. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

480. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781

gtacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---cggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ****   .**.*** ****************.

481. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gctcaacggcatgctggaccggatcgaggcgg	Protospacer
***********.******.********   . 

482. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cggcccagcagctcggccagctccgccgcgt	Protospacer
*************.*** *****.*  .*.*

483. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.774

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
cggcccagcagctcggccagctcgcgcagct	Protospacer
*************.*** *****  * *  *

484. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

485. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcacggcgtcggcggacagggtggcg	Protospacer
   ***   .** *** ****************.

486. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

487. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

488. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

489. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

490. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.774

tacgga---tactgcgacggcggacagggtggca	CRISPR spacer
---ggacttcaccgcgtcggcggacagggtggcg	Protospacer
   ***   .**.*** ****************.

491. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctcaacggcatgctggaccggatcgaggcgg	Protospacer
**********.******.********   . 

492. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021745 (Agarilytica rhodophyticola strain 017 plasmid pSU1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
gtgccagccgttcctgaagcagctgagtttga	Protospacer
 .****** *******.********..* * *

493. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggtttctggaccagcaaggtgata	Protospacer
************.***** **** .*.*. .*

494. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggtttctggaccagcaaggtgata	Protospacer
************.***** **** .*.*. .*

495. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggtttctggaccagcaaggtgata	Protospacer
************.***** **** .*.*. .*

496. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

497. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

498. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

499. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

500. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

501. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

502. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 8, identity: 0.75

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gatcgaggcggagcgaatgcatcaggaacgac	Protospacer
 ************** *****.****   . *

503. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
ccggcccagcagctcggccagctcgcgcagct	Protospacer
 *************.*** *****  * *  *

504. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75

gtacggatactgcgacggcggacagggtggca-	CRISPR spacer
gcacgggtcctgcgacggcggaca-gccgctat	Protospacer
*.****.* *************** * .* .* 

505. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75

gtacggatactgcgacggcggacagggtggca-	CRISPR spacer
gcacgggtcctgcgacggcggaca-gccgctat	Protospacer
*.****.* *************** * .* .* 

506. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to MN536027 (Pseudomonas phage vB_Pae-SS2019XII, complete genome) position: , mismatch: 8, identity: 0.742

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
gcgcccagcagcttggccagctctgcctgct	Protospacer
  *************** *******     *

507. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.742

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
tcgcacagcaccttggcaagctctggctcga	Protospacer
. ** ***** ***************  *. 

508. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.742

tacggatactgcgacggcggacagggtggca-	CRISPR spacer
cacgggtcctgcgacggcggaca-gccgctat	Protospacer
.****.* *************** * .* .* 

509. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.742

tacggatactgcgacggcggacagggtggca-	CRISPR spacer
cacgggtcctgcgacggcggaca-gccgctat	Protospacer
.****.* *************** * .* .* 

510. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ggcaacggcacgctggcgcggatcgtgtgga	Protospacer
  **************  *******  **. 

511. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ggcaacggcacgctggcgcggatcgtgtggc	Protospacer
  **************  *******  **..

512. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.742

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gtcaacggcacgctggacctgatcatgtact	Protospacer
 ****************.* ****.  *. *

513. spacer 1.1|1310|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719

gacaaccagctggctcagccggttgtgctcaa	CRISPR spacer
cagcgccagctggcgcagccggtcgtgcccgg	Protospacer
 *  .********* ********.****.*..

514. spacer 1.3|1430|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atgagggcggtacgggtggacgccatgctgtt	CRISPR spacer
cgggatacggtacggttggacgccaagctgct	Protospacer
  *.. .******** ********* ****.*

515. spacer 1.13|2030|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NC_024123 (Pseudomonas phage KPP25 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

tctttagggtctggtgctcgtagtccaggacg	CRISPR spacer
cgagacaggtctggtgctcgaagtcgaggacg	Protospacer
.     .************* **** ******

516. spacer 1.15|2150|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgtgttggccgggcgcctggcgtccgcaga	CRISPR spacer
ggcgtggtggccgggcggctggcgcagttggg	Protospacer
****** ********** ******.   ..*.

517. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
ccgccagcggttccggcagcagcgagaagggg	Protospacer
************** * ****** .** .  .

518. spacer 1.16|2210|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to KT001914 (Caulobacter phage Seuss, complete genome) position: , mismatch: 9, identity: 0.719

ccgccagcggttcctggagcagctggatatca	CRISPR spacer
gagccagaagttcctggagcagctgacggcca	Protospacer
  ***** .****************.  ..**

519. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
tctgctggcggagcgtctgcatcaggtcgagg	Protospacer
. *   ********** ****.********  

520. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gttcgaggcggagcggatgcaccgggaacgac	Protospacer
  ************* *******.**   . *

521. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gttcgaggcggagcgaatgcaccgggaacgac	Protospacer
  ************* *******.**   . *

522. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gttcgaggcggagcgaatgcaccgggaacgac	Protospacer
  ************* *******.**   . *

523. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gttcgaggcggagcgaatgcaccgggaacgac	Protospacer
  ************* *******.**   . *

524. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gttcgaggcggagcgaatgcaccgggaacgac	Protospacer
  ************* *******.**   . *

525. spacer 1.17|2270|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MN693917 (Marine virus AFVG_250M787, complete genome) position: , mismatch: 9, identity: 0.719

catcgaggcggagcgtatgcaccaggtcgatc	CRISPR spacer
gcacacgccggagcgtgtgcaccagttcgatt	Protospacer
   *. * ********.******** *****.

526. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MN693532 (Marine virus AFVG_25M340, complete genome) position: , mismatch: 9, identity: 0.719

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
tattccaagatatttaaaagcatcaacagaaa	Protospacer
   ** ******** ************.. .*

527. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MN536027 (Pseudomonas phage vB_Pae-SS2019XII, complete genome) position: , mismatch: 9, identity: 0.719

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
tgcgcccagcagcttggccagctctgcctgct	Protospacer
   *************** *******     *

528. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 9, identity: 0.719

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
ctcgcacagcaccttggcaagctctggctcga	Protospacer
 . ** ***** ***************  *. 

529. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_AP018668 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence) position: , mismatch: 9, identity: 0.719

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gaagaacggcacgctggggcggatcgagcgcg	Protospacer
*   *************. ******** .*  

530. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
cggcaacggcacgctggcgcggatcgtgtgga	Protospacer
   **************  *******  **. 

531. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
cggcaacggcacgctggcgcggatcgtgtggc	Protospacer
   **************  *******  **..

532. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
cgtcaacggcacgctggacctgatcatgtact	Protospacer
  ****************.* ****.  *. *

533. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 9, identity: 0.71

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
aatcccagctgcttcgcaagctctggaatcg	Protospacer
 . ****** **** ***********.*.  

534. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
aatcccagctgcttcgcaagctctggaatcg	Protospacer
 . ****** **** ***********.*.  

535. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
aatcccagctgcttcgcaagctctggaatcg	Protospacer
 . ****** **** ***********.*.  

536. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggccgataccgcgacggcggacagggccaag	Protospacer
 .* *****.****************. . .

537. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511042 (Pseudomonas phage CF126, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

538. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511040 (Pseudomonas phage CF63, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

539. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511051 (Pseudomonas phage BR181, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

540. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511041 (Pseudomonas phage CF69, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

541. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511049 (Pseudomonas phage BR326, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

542. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511045 (Pseudomonas phage BR208, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

543. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511044 (Pseudomonas phage BR197, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

544. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511050 (Pseudomonas phage BR150, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

545. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511048 (Pseudomonas phage BR320, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

546. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511046 (Pseudomonas phage BR313, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

547. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511047 (Pseudomonas phage BR319, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

548. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511043 (Pseudomonas phage BR228, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

549. spacer 1.24|2451|31|NZ_ASRD01000188|PILER-CR matches to MK511039 (Pseudomonas phage CF24, partial genome) position: , mismatch: 9, identity: 0.71

tacggatactgcgacggcggacagggtggca	CRISPR spacer
ggcggatactgcgccggcggactggtcgaac	Protospacer
 .*********** ******** ** .*.  

550. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 9, identity: 0.71

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
gacaacggcacgctggagcagatcgaggacg	Protospacer
  *************** *.******  .  

551. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_AP018668 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence) position: , mismatch: 9, identity: 0.71

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
aagaacggcacgctggggcggatcgagcgcg	Protospacer
   *************. ******** .*  

552. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.71

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
tggaacggcacgccggttcggatcgatcctt	Protospacer
.  **********.** *********..  *

553. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.71

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
tggaacggcacgccggttcggatcgatcctt	Protospacer
.  **********.** *********..  *

554. spacer 1.25|2511|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcaacggcacgctggatcggatcgactgat	CRISPR spacer
atggacggcacagtggatcggatcgacgtcg	Protospacer
 * .*******. **************    

555. spacer 1.4|1490|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

ggcaggacgcgctgtcctacgcccaacgtgaa	CRISPR spacer
tgcagcacgcgctgtccgacgcccgcatcgtc	Protospacer
 **** *********** ******.   .*  

556. spacer 1.5|1550|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 10, identity: 0.688

ttcccgcctgatatgtacctaatgttcatatt	CRISPR spacer
tatccgcctgaaatgttcctaatgttttcccg	Protospacer
* .******** **** *********. . . 

557. spacer 1.6|1610|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018284 (Chondrocystis sp. NIES-4102 plasmid plasmid3 DNA, complete genome) position: , mismatch: 10, identity: 0.688

tcgtcgatcagggttgttgtagattgcaaaga	CRISPR spacer
tcgtctatcagagttgttgtagaacatcccaa	Protospacer
***** *****.*********** ...   .*

558. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
gcgccatcaagcgcgacgtggaagcgctgatg	Protospacer
. . ***********.********.***    

559. spacer 1.8|1730|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 10, identity: 0.688

agagcatcaagcgcggcgtggaagtgctttat	CRISPR spacer
aatacatcgagcgcggcgtggaggtgccggcg	Protospacer
*. .****.*************.****.    

560. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 10, identity: 0.688

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
acgtcgcgcttctcgaactcgctccattcctg	Protospacer
.. *   ******* *********** *** .

561. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 10, identity: 0.688

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
acgtcgcgcttctcgaactcgctccattcctg	Protospacer
.. *   ******* *********** *** .

562. spacer 1.10|1850|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.688

gtctgtagcttctccaactcgctccaatccga	CRISPR spacer
acgtcgcgcttctcgaactcgctccattcctg	Protospacer
.. *   ******* *********** *** .

563. spacer 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gactttgcgccgcctggttcggtcctggtgct	CRISPR spacer
tcaatgaaaccgcctggtttggtgctggtgct	Protospacer
    * . .**********.*** ********

564. spacer 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gactttgcgccgcctggttcggtcctggtgct	CRISPR spacer
tcaatgaaaccgcctggtttggtgctggtgct	Protospacer
    * . .**********.*** ********

565. spacer 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 10, identity: 0.688

gactttgcgccgcctggttcggtcctggtgct	CRISPR spacer
tcaatgaaaccgcctggtttggtgctggtgct	Protospacer
    * . .**********.*** ********

566. spacer 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gactttgcgccgcctggttcggtcctggtgct	CRISPR spacer
tcaatgaaaccgcctggtttggtgctggtgct	Protospacer
    * . .**********.*** ********

567. spacer 1.14|2090|32|NZ_ASRD01000188|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 10, identity: 0.688

gactttgcgccgcctggttcggtcctggtgct	CRISPR spacer
tcaatgaaaccgcctggtttggtgctggtgct	Protospacer
    * . .**********.*** ********

568. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MN694153 (Marine virus AFVG_250M457, complete genome) position: , mismatch: 10, identity: 0.688

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
agttccaagatatttaaaagcatcaacagaac	Protospacer
.  ** ******** ************.. . 

569. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP032528 (Bacillus megaterium NCT-2 plasmid pNCT2_1, complete sequence) position: , mismatch: 10, identity: 0.688

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
gtcaaaaatatattgaaaagcatcatcgcaat	Protospacer
*.   *** **************** **  . 

570. spacer 1.19|2330|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MN693930 (Marine virus AFVG_250M489, complete genome) position: , mismatch: 10, identity: 0.688

gcatcaaagatattgaaaagcatcaacgacga	CRISPR spacer
agttccaagatatttaaaagcatcaaatgaaa	Protospacer
.  ** ******** ***********  . .*

571. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 10, identity: 0.688

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
caatcccagctgcttcgcaagctctggaatcg	Protospacer
  . ****** **** ***********.*.  

572. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 10, identity: 0.688

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
gtcaagcagcagtatggcaagctctgggaagc	Protospacer
*. .  ******. *************** ..

573. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
caatcccagctgcttcgcaagctctggaatcg	Protospacer
  . ****** **** ***********.*.  

574. spacer 1.20|2390|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcggcccagcagcttggcaagctctgggacat	CRISPR spacer
caatcccagctgcttcgcaagctctggaatcg	Protospacer
  . ****** **** ***********.*.  

575. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511042 (Pseudomonas phage CF126, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

576. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511040 (Pseudomonas phage CF63, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

577. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511051 (Pseudomonas phage BR181, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

578. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511041 (Pseudomonas phage CF69, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

579. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511049 (Pseudomonas phage BR326, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

580. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511045 (Pseudomonas phage BR208, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

581. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511044 (Pseudomonas phage BR197, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

582. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511050 (Pseudomonas phage BR150, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

583. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511048 (Pseudomonas phage BR320, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

584. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511046 (Pseudomonas phage BR313, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

585. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511047 (Pseudomonas phage BR319, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

586. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511043 (Pseudomonas phage BR228, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

587. spacer 1.21|2450|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to MK511039 (Pseudomonas phage CF24, partial genome) position: , mismatch: 10, identity: 0.688

gtacggatactgcgacggcggacagggtggca	CRISPR spacer
tggcggatactgcgccggcggactggtcgaac	Protospacer
  .*********** ******** ** .*.  

588. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 10, identity: 0.688

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
cgacaacggcacgctggagcagatcgaggacg	Protospacer
   *************** *.******  .  

589. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctggaacggcacgccggttcggatcgatcctt	Protospacer
 .  **********.** *********..  *

590. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 10, identity: 0.688

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
ctggaacggcacgccggttcggatcgatcctt	Protospacer
 .  **********.** *********..  *

591. spacer 1.22|2510|32|NZ_ASRD01000188|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 10, identity: 0.688

gctcaacggcacgctggatcggatcgactgat	CRISPR spacer
catggacggcacagtggatcggatcgacgtcg	Protospacer
  * .*******. **************    

592. spacer 1.23|2391|31|NZ_ASRD01000188|PILER-CR matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 10, identity: 0.677

cggcccagcagcttggcaagctctgggacat	CRISPR spacer
tcaagcagcagtatggcaagctctgggaagc	Protospacer
. .  ******. *************** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ASRD01000041
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 797 : 34835 52 Pseudomonas_phage(91.84%) capsid,tail,portal,terminase,holin,protease,head NA
DBSCAN-SWA_2 78143 : 87172 8 Bacillus_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ASRD01000041.1|WP_038819808.1|33102_33501_-|hypothetical-protein 33102_33501_- 132 aa aa AcrIF11 NA NA 797-34835 yes
NZ_ASRD01000041.1|WP_023106490.1|3940_4207_-|hypothetical-protein 3940_4207_- 88 aa aa NA HTH_LUXR NA 797-34835 yes
NZ_ASRD01000041.1|WP_123809179.1|4279_4462_-|hypothetical-protein 4279_4462_- 60 aa aa NA HTH_LUXR NA 797-34835 yes
5. NZ_ASRD01000118
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6192 : 27292 26 uncultured_Caudovirales_phage(30.43%) tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ASRD01000080
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000080_1 63598-63690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ASRD01000031
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24596 : 67162 51 Pseudomonas_phage(73.81%) terminase,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ASRD01000094
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000094_1 37490-37877 Orphan I-F
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510971 Pseudomonas phage CF79, partial genome 37232-37263 0 1.0
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 KM389225 UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence 17170-17201 0 1.0
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510970 Pseudomonas phage CF67, partial genome 15734-15765 0 1.0
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510992 Pseudomonas phage BR144, partial genome 656-687 0 1.0
NZ_ASRD01000094_1 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37698-37729 32 MK511012 Pseudomonas phage BR153, partial genome 11530-11561 0 1.0
NZ_ASRD01000094_1 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37758-37789 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 25549-25580 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 AY394005 Bacteriophage D3112, complete genome 35850-35881 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 35701-35732 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511036 Pseudomonas phage BR327, partial genome 35359-35390 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511031 Pseudomonas phage BR52, partial genome 29026-29057 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511034 Pseudomonas phage BR243, partial genome 35666-35697 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511033 Pseudomonas phage BR205, partial genome 35731-35762 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511017 Pseudomonas phage CF23, partial genome 35682-35713 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK144667 Pseudomonas phage Spike, complete genome 35728-35759 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511018 Pseudomonas phage CF28, partial genome 35391-35422 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511026 Pseudomonas phage CF121, partial genome 35634-35665 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 35364-35395 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NC_005178 Pseudomonas phage D3112, complete genome 35850-35881 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511022 Pseudomonas phage CF74, partial genome 38295-38326 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 DQ631426 Pseudomonas phage DMS3, complete genome 34625-34656 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511030 Pseudomonas phage CF213, partial genome 35632-35663 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511025 Pseudomonas phage CF118, partial genome 35661-35692 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511023 Pseudomonas phage CF77, partial genome 35632-35663 0 1.0
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK511029 Pseudomonas phage CF183, partial genome 36416-36447 0 1.0
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 NC_030931 Pseudomonas phage phi2, complete genome 37022-37053 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510993 Pseudomonas phage BR201, partial genome 37943-37974 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510984 Pseudomonas phage BR200, partial genome 3124-3155 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510971 Pseudomonas phage CF79, partial genome 40048-40079 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510970 Pseudomonas phage CF67, partial genome 18550-18581 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 KJ959591 Pseudomonas phage PAN70, partial genome 18505-18536 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 KY707339 Pseudomonas phage JBD68, complete genome 18403-18434 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510990 Pseudomonas phage BR133, partial genome 21832-21863 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510968 Pseudomonas phage CF55, partial genome 19899-19930 1 0.969
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 MK510969 Pseudomonas phage CF60, partial genome 4720-4751 1 0.969
NZ_ASRD01000094_1 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37758-37789 32 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 5446-5477 1 0.969
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MH719194 Pseudomonas phage Ps60, complete genome 37811-37842 1 0.969
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MH719192 Pseudomonas phage Ps56, complete genome 37951-37982 1 0.969
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 KU199708 Pseudomonas phage JBD69, complete genome 35074-35105 1 0.969
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510962 Pseudomonas phage CF3, partial genome 8064-8095 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510987 Pseudomonas phage BR233, partial genome 15677-15708 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510984 Pseudomonas phage BR200, partial genome 308-339 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510965 Pseudomonas phage CF34, partial genome 29704-29735 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510974 Pseudomonas phage CF140, partial genome 15647-15678 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 NC_007805 Pseudomonas phage F10, complete genome 15744-15775 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510978 Pseudomonas phage CF208, partial genome 15787-15818 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510988 Pseudomonas phage BR299, partial genome 15733-15764 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510976 Pseudomonas phage CF165, partial genome 36387-36418 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 24665-24696 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 KJ959591 Pseudomonas phage PAN70, partial genome 15691-15722 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510990 Pseudomonas phage BR133, partial genome 19016-19047 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510975 Pseudomonas phage CF145, partial genome 15963-15994 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510969 Pseudomonas phage CF60, partial genome 1904-1935 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MK510986 Pseudomonas phage BR213, partial genome 15672-15703 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 DQ163912 Bacteriophage F10, complete genome 15744-15775 2 0.938
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 KM389225 UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence 14354-14385 2 0.938
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 JQ067085 Pseudomonas phage PaMx73, complete genome 34705-34736 2 0.938
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NC_030918 Pseudomonas phage JBD93, complete genome 34754-34785 2 0.938
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 JX434032 Pseudomonas phage JBD30, complete genome 35081-35112 2 0.938
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 MG707188 Pseudomonas phage TC7, partial genome 2295-2326 3 0.906
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 82072-82103 8 0.75
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 644014-644045 8 0.75
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 639916-639947 8 0.75
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 660499-660530 8 0.75
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 654338-654369 8 0.75
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 639916-639947 8 0.75
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 202820-202851 9 0.719
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 33566-33597 9 0.719
NZ_ASRD01000094_1 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37578-37609 32 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 85015-85046 9 0.719
NZ_ASRD01000094_1 1.3|37638|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37638-37669 32 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 26274-26305 9 0.719
NZ_ASRD01000094_1 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37698-37729 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 72184-72215 9 0.719
NZ_ASRD01000094_1 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37698-37729 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1205187-1205218 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_KY362367 Pseudomonas coronafaciens pv. garcae strain 2708 plasmid pPg2708, complete sequence 16612-16643 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP026559 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence 44578-44609 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_LT963404 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP2, complete sequence 39923-39954 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 592410-592441 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 CP050261 Pseudomonas coronafaciens strain X-1 plasmid unnamed1 61609-61640 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP042805 Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence 49464-49495 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_LT985190 Pseudomonas syringae group genomosp. 3 strain CFBP 3800 plasmid PP1, complete sequence 42977-43008 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 CP046442 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence 75632-75663 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_LT963413 Pseudomonas syringae isolate CFBP3840 plasmid PP4, complete sequence 44363-44394 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NC_005919 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326B, complete sequence 11656-11687 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP047263 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326B, complete sequence 11656-11687 9 0.719
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 NZ_CP026566 Pseudomonas avellanae strain R2leaf plasmid p4_tig8, complete sequence 13695-13726 9 0.719
NZ_ASRD01000094_1 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37518-37549 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 524033-524064 10 0.688
NZ_ASRD01000094_1 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37698-37729 32 NZ_CP014581 Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence 136423-136454 10 0.688
NZ_ASRD01000094_1 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37758-37789 32 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 118337-118368 10 0.688
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MF472892 Mycobacterium phage TreyKay, complete genome 13871-13902 10 0.688
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 KX641264 Mycobacterium phage LindNT, complete genome 13871-13902 10 0.688
NZ_ASRD01000094_1 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT 37818-37849 32 MK016503 Mycobacterium phage Prithvi, complete genome 13871-13902 10 0.688

1. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 0, identity: 1.0

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggccgagaccgacaagtcgaagcgcacgg	Protospacer
********************************

2. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KM389225 (UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggccgagaccgacaagtcgaagcgcacgg	Protospacer
********************************

3. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 0, identity: 1.0

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggccgagaccgacaagtcgaagcgcacgg	Protospacer
********************************

4. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510992 (Pseudomonas phage BR144, partial genome) position: , mismatch: 0, identity: 1.0

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggccgagaccgacaagtcgaagcgcacgg	Protospacer
********************************

5. spacer 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511012 (Pseudomonas phage BR153, partial genome) position: , mismatch: 0, identity: 1.0

agcaaggcatccggaaacgggccttgggtcac	CRISPR spacer
agcaaggcatccggaaacgggccttgggtcac	Protospacer
********************************

6. spacer 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 0, identity: 1.0

aaggagcaccacgacatggtcagagcaaaccc	CRISPR spacer
aaggagcaccacgacatggtcagagcaaaccc	Protospacer
********************************

7. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

8. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

9. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

10. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

11. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

12. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

13. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

14. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

15. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

16. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

17. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

18. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

19. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

20. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

21. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

22. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

23. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

24. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 0, identity: 1.0

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgccaagccggaaaccgaggc	Protospacer
********************************

25. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 1, identity: 0.969

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggcagagaccgacaagtcgaagcgcacgg	Protospacer
****** *************************

26. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510993 (Pseudomonas phage BR201, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

27. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510984 (Pseudomonas phage BR200, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

28. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510971 (Pseudomonas phage CF79, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

29. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510970 (Pseudomonas phage CF67, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

30. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KJ959591 (Pseudomonas phage PAN70, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

31. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KY707339 (Pseudomonas phage JBD68, complete genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

32. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

33. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510968 (Pseudomonas phage CF55, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

34. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 1, identity: 0.969

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgatgcc	Protospacer
******************************* 

35. spacer 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 1, identity: 0.969

aaggagcaccacgacatggtcagagcaaaccc	CRISPR spacer
aaggagcaccacgacatggtcagagcagaccc	Protospacer
***************************.****

36. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MH719194 (Pseudomonas phage Ps60, complete genome) position: , mismatch: 1, identity: 0.969

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgcccagccggaaaccgaggc	Protospacer
*************** ****************

37. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MH719192 (Pseudomonas phage Ps56, complete genome) position: , mismatch: 1, identity: 0.969

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcttcgcccagccggaaaccgaggc	Protospacer
*************** ****************

38. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 1, identity: 0.969

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagttcatcgccaagccggaaaccgaggc	Protospacer
********* **********************

39. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510962 (Pseudomonas phage CF3, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

40. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

41. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510984 (Pseudomonas phage BR200, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

42. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510965 (Pseudomonas phage CF34, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

43. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

44. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_007805 (Pseudomonas phage F10, complete genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

45. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

46. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

47. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

48. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

49. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KJ959591 (Pseudomonas phage PAN70, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

50. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510990 (Pseudomonas phage BR133, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

51. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

52. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510969 (Pseudomonas phage CF60, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

53. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

54. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to DQ163912 (Bacteriophage F10, complete genome) position: , mismatch: 2, identity: 0.938

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcacgg	Protospacer
*.*******.**********************

55. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KM389225 (UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00001 genomic sequence) position: , mismatch: 2, identity: 0.938

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
tgttcgtagccgatatcgctgcacgcgacgcc	Protospacer
****************************.** 

56. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 2, identity: 0.938

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tcctagctcttcgcccagccggaaaccgaggc	Protospacer
******.******** ****************

57. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 2, identity: 0.938

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tccaagttcttcgcccagccggaaaccgaggc	Protospacer
*** *********** ****************

58. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 2, identity: 0.938

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tccaagttcttcgcccagccggaaaccgaggc	Protospacer
*** *********** ****************

59. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 3, identity: 0.906

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gttggccgaaaccgacaagtcgaagcgcactg	Protospacer
*.*******.******************** *

60. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 8, identity: 0.75

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
gctggccgagaccgacgagtcgatgaagtcct	Protospacer
****************.****** * .  *  

61. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.75

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccggt--ttcgaccagccggaaaccgaggc	Protospacer
    *..**  **** * ****************

62. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.75

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccggt--ttcgaccagccggaaaccgaggc	Protospacer
    *..**  **** * ****************

63. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.75

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccggt--ttcgaccagccggaaaccgaggc	Protospacer
    *..**  **** * ****************

64. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.75

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccggt--ttcgaccagccggaaaccgaggc	Protospacer
    *..**  **** * ****************

65. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccggt--ttcgaccagccggaaaccgaggc	Protospacer
    *..**  **** * ****************

66. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
acctccctgccgatatcgcggcacgcgacgcc	Protospacer
  .** . *********** ********.** 

67. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
acctccctgccgatatcgcggcacgcgacgcc	Protospacer
  .** . *********** ********.** 

68. spacer 1.2|37578|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 9, identity: 0.719

tgttcgtagccgatatcgctgcacgcgatgca	CRISPR spacer
acctccctgccgatatcgcggcacgcgacgcc	Protospacer
  .** . *********** ********.** 

69. spacer 1.3|37638|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 9, identity: 0.719

gaggggccgtatcgacggtgattgatgcgaca	CRISPR spacer
gtgctgccggatcgaaggtgattgatgctgag	Protospacer
* *  **** ***** ************ . .

70. spacer 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

agcaaggcatccggaaacgggccttgggtcac	CRISPR spacer
agcaaggcctccggaaacgcgccgcaattgat	Protospacer
******** ********** *** ... * *.

71. spacer 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.719

agcaaggcatccggaaacgggccttgggtcac	CRISPR spacer
cgcaaggcatcccgaaccgggcctacgatatt	Protospacer
 *********** *** *******  *.*  .

72. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY362367 (Pseudomonas coronafaciens pv. garcae strain 2708 plasmid pPg2708, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

73. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

74. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963404 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP2, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtaccacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

75. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.719

--tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
aaggccgg--cttcgaccagccggaaaccgaggg	Protospacer
    *..*  ***** * *************** 

76. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to CP050261 (Pseudomonas coronafaciens strain X-1 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

77. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042805 (Pseudomonas amygdali pv. tabaci str. ATCC 11528 plasmid pTab1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtaccacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

78. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985190 (Pseudomonas syringae group genomosp. 3 strain CFBP 3800 plasmid PP1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

79. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to CP046442 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

80. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963413 (Pseudomonas syringae isolate CFBP3840 plasmid PP4, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

81. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_005919 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326B, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtaccacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

82. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047263 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326B, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtaccacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

83. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026566 (Pseudomonas avellanae strain R2leaf plasmid p4_tig8, complete sequence) position: , mismatch: 9, identity: 0.719

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
ctgtatcacttccacaagccggaaaccgaggt	Protospacer
.. ** . ****  *****************.

84. spacer 1.1|37518|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gctggccgagaccgacaagtcgaagcgcacgg	CRISPR spacer
atcggccgaggccgaccagtcgaagcagtccc	Protospacer
...*******.***** *********.  *  

85. spacer 1.4|37698|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 10, identity: 0.688

agcaaggcatccggaaacgggccttgggtcac	CRISPR spacer
ccaaaggcatccggaaaggggacttgcaaccg	Protospacer
   ************** *** **** . *  

86. spacer 1.5|37758|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 10, identity: 0.688

aaggagcaccacgacatggtcagagcaaaccc	CRISPR spacer
gccgtctacctcgacatcgtcagagcaaacag	Protospacer
.  *  .*** ****** ************  

87. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MF472892 (Mycobacterium phage TreyKay, complete genome) position: , mismatch: 10, identity: 0.688

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tgggcgttcttcaccaagacggaaaccggccg	Protospacer
*    *******.***** *********.   

88. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to KX641264 (Mycobacterium phage LindNT, complete genome) position: , mismatch: 10, identity: 0.688

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tgggcgttcttcaccaagacggaaaccggccg	Protospacer
*    *******.***** *********.   

89. spacer 1.6|37818|32|NZ_ASRD01000094|PILER-CR,CRISPRCasFinder,CRT matches to MK016503 (Mycobacterium phage Prithvi, complete genome) position: , mismatch: 10, identity: 0.688

tcctagttcttcgccaagccggaaaccgaggc	CRISPR spacer
tgggcgttcttcaccaagacggaaaccggccg	Protospacer
*    *******.***** *********.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ASRD01000125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000125_1 8669-8782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_ASRD01000064
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ASRD01000064.1|WP_025324765.1|134606_134999_-|hypothetical-protein 134606_134999_- 130 aa aa AcrIF3 NA NA No NA
NZ_ASRD01000064.1|WP_023086531.1|135574_135949_-|hypothetical-protein 135574_135949_- 124 aa aa AcrIF12 NA NZ_ASRD01000064.1_135348_135552_- No NA
11. NZ_ASRD01000186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000186_1 5244-5357 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_ASRD01000081
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000081_1 25803-25944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_ASRD01000072
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21992 : 56991 38 Pseudomonas_phage(60.0%) capsid,integrase,tRNA,coat attL 18272:18331|attR 29955:30036
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_ASRD01000111
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ASRD01000111_1 30594-30690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_ASRD01000059
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17833 : 25495 10 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage