Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_KE159710 Oscillibacter sp. 1-3 acPPL-supercont1.5, whole genome shotgun sequence 0 crisprs DEDDh,RT 0 0 2 0
NZ_KE159704 Oscillibacter sp. 1-3 acPPL-supercont1.10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KE159714 Oscillibacter sp. 1-3 acPPL-supercont1.9, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KE159703 Oscillibacter sp. 1-3 acPPL-supercont1.1, whole genome shotgun sequence 2 crisprs RT,DinG,csa3 3 0 3 0
NZ_KE159711 Oscillibacter sp. 1-3 acPPL-supercont1.6, whole genome shotgun sequence 2 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2,WYL 0 7 4 0
NZ_KE159713 Oscillibacter sp. 1-3 acPPL-supercont1.8, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_KE159708 Oscillibacter sp. 1-3 acPPL-supercont1.3, whole genome shotgun sequence 0 crisprs csa3,RT 0 0 1 0
NZ_KE159712 Oscillibacter sp. 1-3 acPPL-supercont1.7, whole genome shotgun sequence 2 crisprs cas14j 1 0 0 0
NZ_KE159707 Oscillibacter sp. 1-3 acPPL-supercont1.2, whole genome shotgun sequence 3 crisprs DinG,cas14j,RT,WYL 1 0 2 1
NZ_KE159705 Oscillibacter sp. 1-3 acPPL-supercont1.11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KE159706 Oscillibacter sp. 1-3 acPPL-supercont1.12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KE159709 Oscillibacter sp. 1-3 acPPL-supercont1.4, whole genome shotgun sequence 2 crisprs DEDDh,RT,WYL,cas14j,c2c9_V-U4 1 0 2 0

Results visualization

1. NZ_KE159710
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 358302 : 415369 54 Staphylococcus_virus(10.53%) integrase,transposase attL 390423:390438|attR 425428:425443
DBSCAN-SWA_2 431029 : 439813 10 Erysipelothrix_phage(33.33%) integrase attL 432394:432406|attR 436511:436523
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_KE159708
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 226279 : 250576 22 Bacillus_phage(66.67%) transposase,integrase attL 221177:221191|attR 260647:260661
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_KE159712
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159712_1 6466-6551 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159712_2 130779-130887 TypeV NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KE159712_2 2.2|130846|17|NZ_KE159712|CRISPRCasFinder 130846-130862 17 NZ_KE159711.1 66673-66689 2 0.882

1. spacer 2.2|130846|17|NZ_KE159712|CRISPRCasFinder matches to position: 66673-66689, mismatch: 2, identity: 0.882

cagtattagaaccctct	CRISPR spacer
cagaattggaaccctct	Protospacer
*** ***.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_KE159711
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159711_1 55597-56569 TypeI I-C
14 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159711_2 57612-58986 TypeI I-C
20 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_KE159711_2 2.7|58046|35|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 58046-58080 35 MH539650 Siphoviridae sp. isolate ctcf5, complete genome 18474-18508 3 0.914
NZ_KE159711_1 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 56503-56535 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4936087-4936119 7 0.788
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 AP013380 Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S31-C41 21322-21355 7 0.794
NZ_KE159711_1 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 56503-56535 33 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 263461-263493 8 0.758
NZ_KE159711_2 2.2|57711|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57711-57743 33 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 174178-174210 8 0.758
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_006903 Onion yellows phytoplasma plasmid unknown, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_019167 Onion yellows phytoplasma plasmid EcOYNIM_1998, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_019168 Onion yellows phytoplasma plasmid EcOYNIM_1999, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_019169 Onion yellows phytoplasma plasmid EcOYNIM_2000, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_019170 Onion yellows phytoplasma plasmid EcOYNIM_2002-2004, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_019171 Onion yellows phytoplasma plasmid EcOYNIM_2005, complete sequence 12-45 8 0.765
NZ_KE159711_2 2.15|58584|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 58584-58617 34 NZ_CP019881 Komagataeibacter nataicola strain RZS01 plasmid pKNA06, complete sequence 11054-11087 8 0.765
NZ_KE159711_1 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 56503-56535 33 MK411746 Arthrobacter phage Sonali, complete genome 32481-32513 9 0.727
NZ_KE159711_1 1.2|55697|35|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 55697-55731 35 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2159503-2159537 10 0.714
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NC_012088 Onion yellows phytoplasma plasmid EcOYW1, complete sequence 12-45 10 0.706
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 27943-27976 10 0.706
NZ_KE159711_2 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 57912-57945 34 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 20810-20843 10 0.706
NZ_KE159711_2 2.9|58182|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT 58182-58215 34 NZ_CP008890 Dermacoccus nishinomiyaensis strain M25 plasmid unnamed, complete sequence 24698-24731 10 0.706

1. spacer 2.7|58046|35|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to MH539650 (Siphoviridae sp. isolate ctcf5, complete genome) position: , mismatch: 3, identity: 0.914

tgtcccgcagggctggcgggtgctccgtgtacttt	CRISPR spacer
taccccgcagggctggcgggcgctccgtgtacttt	Protospacer
*..*****************.**************

2. spacer 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788

gtgaagacccggtcgtcggccttggcgacgatg	CRISPR spacer
ccgatcacccggtcgtcgaccttggtgacgacg	Protospacer
 .**  ************.******.*****.*

3. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to AP013380 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S31-C41) position: , mismatch: 7, identity: 0.794

--ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
tgctgctga--cattcttccttttttaatattagct	Protospacer
  ** .***  *******.*************.** 

4. spacer 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.758

gtgaagacccggtcgtcggccttggcgacgatg	CRISPR spacer
gagaagaccaggttgtcggccttggccggggcg	Protospacer
* ******* ***.************ . *..*

5. spacer 2.2|57711|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

gtgaaggttttccgcgccggaggctccggcctc	CRISPR spacer
atgcgggttttccgcgccgggcgctccggtccg	Protospacer
.** .***************. *******.*. 

6. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_006903 (Onion yellows phytoplasma plasmid unknown, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

7. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_019167 (Onion yellows phytoplasma plasmid EcOYNIM_1998, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

8. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_019168 (Onion yellows phytoplasma plasmid EcOYNIM_1999, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

9. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_019169 (Onion yellows phytoplasma plasmid EcOYNIM_2000, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

10. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_019170 (Onion yellows phytoplasma plasmid EcOYNIM_2002-2004, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

11. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_019171 (Onion yellows phytoplasma plasmid EcOYNIM_2005, complete sequence) position: , mismatch: 8, identity: 0.765

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaatattattt	Protospacer
  ****** **** ****************. . 

12. spacer 2.15|58584|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019881 (Komagataeibacter nataicola strain RZS01 plasmid pKNA06, complete sequence) position: , mismatch: 8, identity: 0.765

atcagcctgtcctggccgtttagag----cttgggaca	CRISPR spacer
aacagcctgtccgggccgtttagggccatctcgg----	Protospacer
* ********** **********.*    **.**    

13. spacer 1.14|56503|33|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 9, identity: 0.727

gtgaagacccggtcgtcggccttggcgacgatg	CRISPR spacer
tcgcggacccggtctccggccttggcgacggcc	Protospacer
 .* .********* .**************.. 

14. spacer 1.2|55697|35|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.714

ctggaggagaagtttaaggtgaagccagccctagg-----	CRISPR spacer
ttggaggagaagttttcggtgaag-----cctggaaggta	Protospacer
.**************  *******     ***.*.     

15. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NC_012088 (Onion yellows phytoplasma plasmid EcOYW1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
agcttgaaacattgtttcttttttaactttattt	Protospacer
  ****** **** ************. **. . 

16. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
caaacaaacaattctttcatttttaatattctcc	Protospacer
*   ..*** ******** ***********  * 

17. spacer 2.5|57912|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcttgaaccattctttcttttttaatattggca	CRISPR spacer
caaacaaacaattctttcatttttaatattctcc	Protospacer
*   ..*** ******** ***********  * 

18. spacer 2.9|58182|34|NZ_KE159711|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008890 (Dermacoccus nishinomiyaensis strain M25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

aattctccagcttctccgcgtccagcctgatgaa	CRISPR spacer
gaagcttcagcttctccgcttccagcctcgcgtt	Protospacer
.*  **.************ ******** ..*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 177398 : 208848 32 Bacillus_phage(25.0%) tRNA,integrase attL 194378:194393|attR 214942:214957
DBSCAN-SWA_2 327376 : 334648 8 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_3 367470 : 375775 11 Ochrobactrum_phage(16.67%) NA NA
DBSCAN-SWA_4 385342 : 401572 10 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_KE159707
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159707_2 276276-276418 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159707_1 275948-276091 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159707_3 768315-768409 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KE159707_3 3.1|768338|49|NZ_KE159707|CRISPRCasFinder 768338-768386 49 NZ_KE159707.1 768302-768350 1 0.98

1. spacer 3.1|768338|49|NZ_KE159707|CRISPRCasFinder matches to position: 768302-768350, mismatch: 1, identity: 0.98

agggtcggcgggggtggtctccccgtccttcttctcagggtcggcgggg	CRISPR spacer
agggtcggcgggagtggtctccccgtccttcttctcagggtcggcgggg	Protospacer
************.************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 86261 : 95228 11 Faecalibacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 205526 : 208753 7 Streptococcus_phage(100.0%) integrase,transposase attL 199773:199785|attR 213564:213576
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_KE159707.1|WP_016321673.1|99700_100450_-|hypothetical-protein 99700_100450_- 249 aa aa AcrIIA11 NA NA No NA
6. NZ_KE159703
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159703_1 593832-594012 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159703_2 1141167-1141255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 593997-594013 0 1.0
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 594001-594017 0 1.0
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 594005-594021 0 1.0
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 594009-594025 0 1.0
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 594013-594029 0 1.0
NZ_KE159703_1 1.1|593855|17|NZ_KE159703|CRISPRCasFinder 593855-593871 17 NZ_KE159703.1 594017-594033 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 593997-594013 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 594001-594017 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 594005-594021 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 594009-594025 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 594013-594029 0 1.0
NZ_KE159703_1 1.2|593895|17|NZ_KE159703|CRISPRCasFinder 593895-593911 17 NZ_KE159703.1 594017-594033 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 593997-594013 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 594001-594017 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 594005-594021 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 594009-594025 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 594013-594029 0 1.0
NZ_KE159703_1 1.4|593973|17|NZ_KE159703|CRISPRCasFinder 593973-593989 17 NZ_KE159703.1 594017-594033 0 1.0

1. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 593997-594013, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

2. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 594001-594017, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

3. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 594005-594021, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

4. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 594009-594025, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

5. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 594013-594029, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

6. spacer 1.1|593855|17|NZ_KE159703|CRISPRCasFinder matches to position: 594017-594033, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

7. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 593997-594013, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

8. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 594001-594017, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

9. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 594005-594021, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

10. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 594009-594025, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

11. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 594013-594029, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

12. spacer 1.2|593895|17|NZ_KE159703|CRISPRCasFinder matches to position: 594017-594033, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

13. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 593997-594013, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

14. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 594001-594017, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

15. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 594005-594021, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

16. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 594009-594025, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

17. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 594013-594029, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

18. spacer 1.4|593973|17|NZ_KE159703|CRISPRCasFinder matches to position: 594017-594033, mismatch: 0, identity: 1.0

tgcttgcttgcttgctt	CRISPR spacer
tgcttgcttgcttgctt	Protospacer
*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 501536 : 508242 7 Erysipelothrix_phage(28.57%) NA NA
DBSCAN-SWA_2 985396 : 991573 7 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1149964 : 1156052 6 Caulobacter_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_KE159709
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159709_1 657356-657418 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KE159709_2 657531-657595 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KE159709_1 1.1|657379|16|NZ_KE159709|CRISPRCasFinder 657379-657394 16 NZ_KE159712.1 6687-6702 0 1.0

1. spacer 1.1|657379|16|NZ_KE159709|CRISPRCasFinder matches to position: 6687-6702, mismatch: 0, identity: 1.0

ttaacatgagcttttt	CRISPR spacer
ttaacatgagcttttt	Protospacer
****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 202782 : 212734 9 Streptococcus_phage(33.33%) integrase attL 194527:194542|attR 208764:208779
DBSCAN-SWA_2 282863 : 405050 119 Faecalibacterium_phage(17.65%) plate,integrase,transposase,tail attL 294636:294652|attR 401289:401305
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage