Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_KB908466 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00013.13, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908477 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00024.24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908462 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00009.9, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_KB908456 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00003.3, whole genome shotgun sequence 0 crisprs DEDDh,DinG,cas3 0 0 1 0
NZ_KB908463 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00010.10, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_KB908455 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00002.2, whole genome shotgun sequence 0 crisprs DinG,PD-DExK 0 0 2 2
NZ_KB908459 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00006.6, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_KB908467 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00014.14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908470 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00017.17, whole genome shotgun sequence 0 crisprs c2c9_V-U4,DEDDh 0 0 0 0
NZ_KB908472 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00019.19, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_KB908457 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00004.4, whole genome shotgun sequence 0 crisprs cas3,DEDDh 0 0 1 0
NZ_KB908468 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00015.15, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_KB908478 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00025.25, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908465 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00012.12, whole genome shotgun sequence 1 crisprs cas14j,WYL,cas1,cas3-cas2,cas8f,cas5f,cas7f,cas6f 1 17 0 0
NZ_KB908480 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00027.27, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908458 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00005.5, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_KB908479 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00026.26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908464 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00011.11, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908454 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00001.1, whole genome shotgun sequence 3 crisprs cas14j,DEDDh 0 0 2 0
NZ_KB908476 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00023.23, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908475 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00022.22, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_KB908474 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00021.21, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908461 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00008.8, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_KB908471 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00018.18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KB908473 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00020.20, whole genome shotgun sequence 0 crisprs cas14j 0 0 0 0
NZ_KB908460 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00007.7, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_KB908469 Oceanimonas smirnovii ATCC BAA-899 G364DRAFT_scaffold00016.16, whole genome shotgun sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_KB908456
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62643 : 176388 112 Aeromonas_virus(48.89%) capsid,protease,tail,portal,tRNA,holin,head,integrase,plate,terminase attL 103291:103350|attR 139877:139936
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_KB908465
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KB908465_1 36403-38530 TypeI-F I-F
35 spacers
cas6f,cas7f,cas5f,cas8f,cas3-cas2,cas1,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KB908465_1 1.28|38052|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 38052-38083 32 NZ_KB908455.1 230817-230848 1 0.969

1. spacer 1.28|38052|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to position: 230817-230848, mismatch: 1, identity: 0.969

tgattccatgtgtagccccggcccaggtagtg	CRISPR spacer
tgattccaggtgtagccccggcccaggtagtg	Protospacer
******** ***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 U32222 Bacteriophage 186, complete sequence 1130-1161 6 0.812
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 MN013087 Klebsiella phage vB_KpnS_Penguinator, complete genome 36969-37000 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 MW042802 Klebsiella phage 066039, complete genome 34219-34250 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 NC_049836 Klebsiella phage vB_KpnS_Call, complete genome 36938-36969 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 KY780482 Klebsiella phage KOX1, complete genome 35858-35889 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 NC_049834 Klebsiella phage vB_KpnS_IMGroot, complete genome 37741-37772 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 NC_047784 Klebsiella phage vB_KpnS_KpV522, complete genome 45101-45132 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 NC_049835 Klebsiella phage vB_KpnS_Domnhall, complete genome 36520-36551 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 MN013078 Klebsiella phage vB_KpnS_KingDDD, complete genome 36555-36586 7 0.781
NZ_KB908465_1 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37151-37182 32 NC_049837 Klebsiella phage vB_KpnS_Alina, complete genome 36936-36967 7 0.781
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 300164-300195 7 0.781
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 614954-614985 7 0.781
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 430029-430060 7 0.781
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 53545-53576 7 0.781
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 298165-298196 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 180530-180561 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 MK433577 Klebsiella phage ST512-KPC3phi13.6, complete genome 23751-23782 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 MK433581 Klebsiella phage ST258-KPC3phi16.1, complete genome 23751-23782 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 NC_049454 Klebsiella phage ST15-OXA48phi14.1, complete genome 11713-11744 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 MK416011 Klebsiella phage ST437-OXA245phi4.1, complete genome 23751-23782 7 0.781
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 JQ809663 Stenotrophomonas phage Smp131, complete genome 2755-2786 7 0.781
NZ_KB908465_1 1.29|38112|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 38112-38143 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 501598-501629 7 0.781
NZ_KB908465_1 1.29|38112|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 38112-38143 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 351739-351770 7 0.781
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1074129-1074160 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1535396-1535427 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1102215-1102246 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 808556-808587 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1561220-1561251 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1621124-1621155 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 511034-511065 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 140614-140645 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 259518-259549 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1632149-1632180 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1637953-1637984 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1810136-1810167 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 378872-378903 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1379904-1379935 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 464326-464357 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1621122-1621153 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1935974-1936005 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1556784-1556815 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1105832-1105863 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1593353-1593384 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2077478-2077509 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1639609-1639640 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 832448-832479 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1349248-1349279 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1569505-1569536 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1599779-1599810 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1564323-1564354 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 740762-740793 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 808403-808434 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1475990-1476021 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1523957-1523988 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1563808-1563839 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1651089-1651120 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 740762-740793 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 573260-573291 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1649480-1649511 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 740763-740794 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 808381-808412 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1551688-1551719 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 573260-573291 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1649480-1649511 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1527131-1527162 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1365474-1365505 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 573260-573291 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1470333-1470364 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1535560-1535591 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1552334-1552365 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 573264-573295 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1649480-1649511 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1649480-1649511 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1649480-1649511 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 401683-401714 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1551710-1551741 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1557190-1557221 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1535541-1535572 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1537838-1537869 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1590787-1590818 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1629986-1630017 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1646795-1646826 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1551710-1551741 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 573260-573291 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1658377-1658408 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 740759-740790 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1551710-1551741 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1551710-1551741 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1649483-1649514 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 395737-395768 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 740765-740796 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 395737-395768 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1535522-1535553 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1703059-1703090 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 808661-808692 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1621138-1621169 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1637982-1638013 8 0.75
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 60497-60528 8 0.75
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP049817 Monaibacterium sp. ALG8 plasmid unnamed6, complete sequence 3966-3997 8 0.75
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 368467-368498 8 0.75
NZ_KB908465_1 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37452-37483 32 MT375525 Pelagibacter phage Greip EXVC02, complete genome 21992-22023 8 0.75
NZ_KB908465_1 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37752-37783 32 NZ_CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 61992-62023 8 0.75
NZ_KB908465_1 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37752-37783 32 NC_010631 Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence 264663-264694 8 0.75
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 NC_049342 Escherichia phage 500465-1, complete genome 7620-7651 8 0.75
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 CP025900 Escherichia phage sp., complete genome 7620-7651 8 0.75
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 206202-206233 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 39318-39349 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 40541-40572 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 24887-24918 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 366225-366256 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 248884-248915 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 38502-38533 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 24890-24921 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 294129-294160 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 24893-24924 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 453814-453845 8 0.75
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 39623-39654 8 0.75
NZ_KB908465_1 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36731-36762 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1296987-1297018 9 0.719
NZ_KB908465_1 1.7|36791|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36791-36822 32 MT661596 Proteus phage 10, complete genome 101914-101945 9 0.719
NZ_KB908465_1 1.10|36971|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36971-37002 32 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 529358-529389 9 0.719
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 183501-183532 9 0.719
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP025614 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed2, complete sequence 114601-114632 9 0.719
NZ_KB908465_1 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37692-37723 32 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 224247-224278 9 0.719
NZ_KB908465_1 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37692-37723 32 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 17395-17426 9 0.719
NZ_KB908465_1 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37692-37723 32 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 94735-94766 9 0.719
NZ_KB908465_1 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37992-38023 32 NZ_CP045419 Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence 639183-639214 9 0.719
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 MW084976 Bacillus phage Kirov, complete genome 50182-50213 9 0.719
NZ_KB908465_1 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT 38352-38383 32 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 76717-76748 9 0.719
NZ_KB908465_1 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT 38472-38502 31 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 456043-456073 9 0.71
NZ_KB908465_1 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT 38472-38502 31 NZ_CP016290 Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence 21061-21091 9 0.71
NZ_KB908465_1 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT 38472-38502 31 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 74374-74404 9 0.71
NZ_KB908465_1 1.1|36431|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36431-36462 32 KT997858 Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome 9372-9403 10 0.688
NZ_KB908465_1 1.3|36551|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 36551-36582 32 NZ_CP032532 Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence 88967-88998 10 0.688
NZ_KB908465_1 1.17|37391|33|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37391-37423 33 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 386694-386726 10 0.697
NZ_KB908465_1 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37452-37483 32 HQ317391 Cyanophage S-SSM6a genomic sequence 50951-50982 10 0.688
NZ_KB908465_1 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37452-37483 32 GU071098 Synechococcus phage S-SSM7, complete genome 162799-162830 10 0.688
NZ_KB908465_1 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37752-37783 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 147315-147346 10 0.688
NZ_KB908465_1 1.30|38172|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 38172-38203 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 73295-73326 10 0.688
NZ_KB908465_1 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT 38292-38323 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1222440-1222471 10 0.688
NZ_KB908465_1 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT 37211-37242 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 396038-396069 11 0.656
NZ_KB908465_1 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT 38352-38383 32 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 122644-122675 11 0.656
NZ_KB908465_1 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT 38352-38383 32 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 58387-58418 11 0.656
NZ_KB908465_1 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT 38352-38383 32 NZ_CP023455 Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence 13516-13547 11 0.656

1. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to U32222 (Bacteriophage 186, complete sequence) position: , mismatch: 6, identity: 0.812

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggcactggctcgccaaaggtgaacgcctccat	Protospacer
**... ** ******************** **

2. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MN013087 (Klebsiella phage vB_KpnS_Penguinator, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

3. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MW042802 (Klebsiella phage 066039, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

4. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049836 (Klebsiella phage vB_KpnS_Call, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

5. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to KY780482 (Klebsiella phage KOX1, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

6. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049834 (Klebsiella phage vB_KpnS_IMGroot, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

7. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_047784 (Klebsiella phage vB_KpnS_KpV522, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

8. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049835 (Klebsiella phage vB_KpnS_Domnhall, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

9. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MN013078 (Klebsiella phage vB_KpnS_KingDDD, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

10. spacer 1.13|37151|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049837 (Klebsiella phage vB_KpnS_Alina, complete genome) position: , mismatch: 7, identity: 0.781

atgctgcgaggttcgatgggtaaggctgacaa	CRISPR spacer
atgctgcgcggtgcgatgggtaaattcgataa	Protospacer
******** *** **********. ..**.**

11. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.781

tgtagca-tgatgcggtctatcagcgcgtcgat	CRISPR spacer
-atggcgccgatgcggtcgatcagcgcgtccat	Protospacer
 .*.**. .********* *********** **

12. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.781

tgtagca-tgatgcggtctatcagcgcgtcgat	CRISPR spacer
-atggcgccgatgcggtcgatcagcgcgtccat	Protospacer
 .*.**. .********* *********** **

13. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

tgtagca-tgatgcggtctatcagcgcgtcgat	CRISPR spacer
-atggcgccgatgcggtcgatcagcgcgtccat	Protospacer
 .*.**. .********* *********** **

14. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

tgtagca-tgatgcggtctatcagcgcgtcgat	CRISPR spacer
-atggcgccgatgcggtcgatcagcgcgtccat	Protospacer
 .*.**. .********* *********** **

15. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.781

tgtagca-tgatgcggtctatcagcgcgtcgat	CRISPR spacer
-atggcgccgatgcggtcgatcagcgcgtccat	Protospacer
 .*.**. .********* *********** **

16. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
gggatcgggtcgccaaaggtaaacgcctccga	Protospacer
** .* **************.******** . 

17. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MK433577 (Klebsiella phage ST512-KPC3phi13.6, complete genome) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggaatgggatcgccaaagctgaacgcctgggt	Protospacer
** .****.********* ********* ..*

18. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MK433581 (Klebsiella phage ST258-KPC3phi16.1, complete genome) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggaatgggatcgccaaagctgaacgcctgggt	Protospacer
** .****.********* ********* ..*

19. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049454 (Klebsiella phage ST15-OXA48phi14.1, complete genome) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggaatgggatcgccaaagctgaacgcctgggt	Protospacer
** .****.********* ********* ..*

20. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MK416011 (Klebsiella phage ST437-OXA245phi4.1, complete genome) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggaatgggatcgccaaagctgaacgcctgggt	Protospacer
** .****.********* ********* ..*

21. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to JQ809663 (Stenotrophomonas phage Smp131, complete genome) position: , mismatch: 7, identity: 0.781

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggctgggcctcgccaaaggtgaaggcctcgat	Protospacer
**.  **  ************** *****.**

22. spacer 1.29|38112|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

---tacgttaaaaacgaggccggcatcctgaccaa	CRISPR spacer
aaacacgt---gaaccaggccggcatccagaccaa	Protospacer
   .****   .*** ************ ******

23. spacer 1.29|38112|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

---tacgttaaaaacgaggccggcatcctgaccaa	CRISPR spacer
aaacacgt---gaaccaggccggcatccagaccaa	Protospacer
   .****   .*** ************ ******

24. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

25. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

26. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

27. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

28. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

29. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

30. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

31. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

32. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

33. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

34. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

35. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

36. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

37. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

38. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

39. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

40. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

41. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

42. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

43. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

44. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

45. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

46. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

47. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

48. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

49. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

50. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

51. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

52. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

53. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

54. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

55. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

56. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

57. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

58. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

59. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

60. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

61. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

62. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

63. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

64. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

65. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

66. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

67. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

68. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

69. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

70. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

71. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

72. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

73. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

74. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

75. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

76. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

77. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

78. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

79. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

80. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

81. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

82. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

83. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

84. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

85. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

86. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

87. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

88. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

89. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

90. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

91. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

92. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

93. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

94. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

95. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

96. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

97. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

98. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

99. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
atcacatcaccgattacgtctatgccggcgat	Protospacer
 . *.. *********.********** ****

100. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
accacatcgccgattacgtctatgccggcgat	Protospacer
 * *.. *.*******.********** ****

101. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
accacatcgccgattacgtctatgccggcgat	Protospacer
 * *.. *.*******.********** ****

102. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
accacatcgccgattacgtctatgccggcgat	Protospacer
 * *.. *.*******.********** ****

103. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
accacatcgccgattacgtctatgccggcgat	Protospacer
 * *.. *.*******.********** ****

104. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
cgcactatgatgcggtctatgaccgcgtcggc	Protospacer
.*.* .************** * *******..

105. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049817 (Monaibacterium sp. ALG8 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
tcggcccagatgcgggctatcagcgcctcgat	Protospacer
*  . *  ******* ********** *****

106. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
cgcactatgatgcggtctatgaccgcgtcggc	Protospacer
.*.* .************** * *******..

107. spacer 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MT375525 (Pelagibacter phage Greip EXVC02, complete genome) position: , mismatch: 8, identity: 0.75

tggctatggtgatgtagattattctgatgatg	CRISPR spacer
ttaatttgttgatgtagataattctgatgttt	Protospacer
* . * ** ********** ********* * 

108. spacer 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tgctgataattttgtgcagtattccaaaatcg	CRISPR spacer
gttttaaaattttgtggagtattccaaaatgt	Protospacer
  .* * ********* *************  

109. spacer 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_010631 (Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence) position: , mismatch: 8, identity: 0.75

tgctgataattttgtgcagtattccaaaatcg	CRISPR spacer
cgacgataattttgggcagtagtccaacttct	Protospacer
.* .********** ****** *****  ** 

110. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 8, identity: 0.75

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggcaccgggtcgccaaagctgaacgcctctgc	Protospacer
**... ************ ********** ..

111. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 8, identity: 0.75

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
ggcaccgggtcgccaaagctgaacgcctctgc	Protospacer
**... ************ ********** ..

112. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
gggttcgggtcgccaaaggtaaaagcctccga	Protospacer
**  * **************.** ***** . 

113. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

114. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg	CRISPR spacer
tcagcgccgagcaggtggcgcaattggcgggg	Protospacer
 *******.********* ***** *    **

115. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

116. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg	CRISPR spacer
tcagcgccgagcaggtggcgcaattggcgggg	Protospacer
 *******.********* ***** *    **

117. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

118. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

119. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

120. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

121. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

122. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg-----	CRISPR spacer
tcagcgccgagcaggtggcgca-----attggcgggc	Protospacer
 *******.********* ***     *****     

123. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 8, identity: 0.75

acagcgccaagcaggtggagcaatggtattgg	CRISPR spacer
tcagcgccgagcaggtggcgcaattggcgggg	Protospacer
 *******.********* ***** *    **

124. spacer 1.6|36731|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

tcgatgacaccgattatgtctatgccgtcgat	CRISPR spacer
gctatgacatcgcttatgtctatgcctcgcac	Protospacer
 * ******.** ************* .  *.

125. spacer 1.7|36791|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to MT661596 (Proteus phage 10, complete genome) position: , mismatch: 9, identity: 0.719

actttgacgcttaaagaaggtgataccgttgt	CRISPR spacer
gctaatacggctaaagaaggtgataccgtaaa	Protospacer
.**   *** .****************** . 

126. spacer 1.10|36971|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 9, identity: 0.719

-------tgctctcttgatggtcaaaatataacttttaa	CRISPR spacer
ataatggtg-------gatggtcaaaatataattttgaa	Protospacer
       **       ****************.*** **

127. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
aggctgatgatgcggtcgatcagcgagtcgcg	Protospacer
 *    *********** ******* ****  

128. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025614 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
tccgcgatggtgcggtccatcagcgcgtccac	Protospacer
* ..  ***.*******.*********** *.

129. spacer 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 9, identity: 0.719

gctaacagtaatgaagatgaattcgccggtta	CRISPR spacer
cctaaaagtaatggagatgaattcgaagtagt	Protospacer
 **** *******.***********  *    

130. spacer 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 9, identity: 0.719

gctaacagtaatgaagatgaattcgccggtta	CRISPR spacer
cctaaaagtaatggagatgaattcgaagtagt	Protospacer
 **** *******.***********  *    

131. spacer 1.22|37692|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 9, identity: 0.719

gctaacagtaatgaagatgaattcgccggtta	CRISPR spacer
cctaaaagtaatggagatgaattcgaagtagt	Protospacer
 **** *******.***********  *    

132. spacer 1.27|37992|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045419 (Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence) position: , mismatch: 9, identity: 0.719

ggtgtggggtcgccaaaggtgaacgcctcaat	CRISPR spacer
tcaatggggtagtcaaaggtgaacgccgaagt	Protospacer
   .****** *.**************  *.*

133. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.719

acagcgccaagcaggtggagcaatggtattgg	CRISPR spacer
attatatcaagcaggtggaacaacggtattgc	Protospacer
*. ....************.***.******* 

134. spacer 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.719

gtgagcaaagccattgccgaggccataggtgt	CRISPR spacer
ggggatgaagccattgccaaggtcataggtca	Protospacer
* *....***********.***.*******  

135. spacer 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tgatcgggcacggcgttgccttgatgtgtta	CRISPR spacer
ggatcgggctcggcgttgcctggagcaagga	Protospacer
 ******** *********** **   .  *

136. spacer 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP016290 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

tgatcgggcacggcgttgccttgatgtgtta	CRISPR spacer
ggatcgggctcggcgttgcctggagcaagga	Protospacer
 ******** *********** **   .  *

137. spacer 1.35|38472|31|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.71

tgatcgggcacggcgttgccttgatgtgtta	CRISPR spacer
ggatcgggctcggcgttgcctggaacagggg	Protospacer
 ******** *********** **   *  .

138. spacer 1.1|36431|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to KT997858 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome) position: , mismatch: 10, identity: 0.688

agtaaatcatgtttcgcttgcaggctggcgct	CRISPR spacer
accgggccacgtttcgctcgcaggctggcggg	Protospacer
* .....**.********.***********  

139. spacer 1.3|36551|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 10, identity: 0.688

gctggcaaacctcatttttcgtttaaaatata	CRISPR spacer
agtttcaaaccacatttttcgttaaaaactgt	Protospacer
. *  ****** *********** ****.   

140. spacer 1.17|37391|33|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

cagtggatggtgatgtgttagttgatatttttt	CRISPR spacer
atatttttggtgatgtgtttggtgatattttcg	Protospacer
  .*   ************ * *********. 

141. spacer 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to HQ317391 (Cyanophage S-SSM6a genomic sequence) position: , mismatch: 10, identity: 0.688

tggctatggtgatgtagattattctgatgatg	CRISPR spacer
taatgatggtgatgtagatgactctgattcat	Protospacer
*... ************** *.******    

142. spacer 1.18|37452|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to GU071098 (Synechococcus phage S-SSM7, complete genome) position: , mismatch: 10, identity: 0.688

tggctatggtgatgtagattattctgatgatg	CRISPR spacer
taatgatggtgatgtagatgactctgattcat	Protospacer
*... ************** *.******    

143. spacer 1.23|37752|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 10, identity: 0.688

tgctgataattttgtgcagtattccaaaatcg	CRISPR spacer
tttaaataattttgtgcaatattgcaaatcaa	Protospacer
* . .*************.**** **** . .

144. spacer 1.30|38172|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

aagtacacgcgccgcgggttggaagacggcca	CRISPR spacer
ttcggcctgcgccgcgcgttggaagaccgccg	Protospacer
    .* .******** ********** ***.

145. spacer 1.32|38292|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acagcgccaagcaggtggagcaatggtattgg	CRISPR spacer
gatgcgccacccaggtggagcaatggcggcag	Protospacer
.  ******  ***************.. ..*

146. spacer 1.14|37211|32|NZ_KB908465|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.656

tgtagcatgatgcggtctatcagcgcgtcgat	CRISPR spacer
gccgagctgatgaggtccatcagcgcgtcgtc	Protospacer
  ...  ***** ****.************ .

147. spacer 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 11, identity: 0.656

gtgagcaaagccattgccgaggccataggtgt	CRISPR spacer
acattgaaagccattgccgagaccattggacg	Protospacer
...   ***************.**** **   

148. spacer 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 11, identity: 0.656

gtgagcaaagccattgccgaggccataggtgt	CRISPR spacer
acattgaaagccattgccgagaccattggacg	Protospacer
...   ***************.**** **   

149. spacer 1.33|38352|32|NZ_KB908465|CRISPRCasFinder,CRT matches to NZ_CP023455 (Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

gtgagcaaagccattgccgaggccataggtgt	CRISPR spacer
catcgcaaagcccttgccgacgccatattcca	Protospacer
    ******** ******* ******  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_KB908457
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 124281 : 134601 13 Powai_lake_megavirus(12.5%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_KB908475
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KB908475_1 90-247 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_KB908455
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 198613 : 256223 69 Escherichia_phage(12.12%) terminase,lysis,tail,portal,protease NA
DBSCAN-SWA_2 262016 : 270179 15 Vibrio_phage(33.33%) integrase attL 265335:265350|attR 272815:272830
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_KB908455.1|WP_019933870.1|249231_249519_-|hypothetical-protein 249231_249519_- 95 aa aa AcrIF6 NA NZ_KB908455.1_248807_249185_- 198613-256223 yes
NZ_KB908455.1|WP_019933881.1|254519_254681_-|hypothetical-protein 254519_254681_- 53 aa aa NA HTH_XRE NA 198613-256223 yes
6. NZ_KB908454
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KB908454_1 172226-172356 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KB908454_2 208493-208590 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KB908454_3 446719-446914 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 107902 : 119640 10 uncultured_Mediterranean_phage(25.0%) tRNA NA
DBSCAN-SWA_2 197344 : 205850 8 Enterobacteria_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_KB908460
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 72312 : 83336 9 Mycobacterium_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_KB908469
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38330 : 48378 9 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage