Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AQOI01000351 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000626 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000153 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000233 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000243 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000386 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000102 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000314 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000011 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000531 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000779 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000224 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AQOI01000749 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000370 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000258 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000099 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000057 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000171 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000120 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000347 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000711 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000323 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000190 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000580 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000172 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000620 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000604 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000107 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 10 0 0
NZ_AQOI01000703 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000855 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000851 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000816 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000665 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000554 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AQOI01000737 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000173 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AQOI01000460 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000181 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000159 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000521 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000146 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000480 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000697 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000819 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000247 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000180 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000059 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AQOI01000504 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000572 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000281 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000594 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000144 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000039 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000317 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000561 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000658 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000608 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000524 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000266 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000645 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000468 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000547 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000104 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000141 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000371 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000879 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000195 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000839 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000538 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000189 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000622 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000216 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000849 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000100 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000048 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000501 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000809 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000529 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000607 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000685 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000304 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000340 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000630 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000642 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000508 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000068 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000238 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000030 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000328 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000788 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000151 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000202 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000426 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000691 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000237 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000535 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000787 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000207 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000249 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000830 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000275 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000605 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000094 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000650 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000343 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000307 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000020 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000694 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000183 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000194 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000152 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000176 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000432 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000174 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000287 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000759 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000854 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000319 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000487 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000395 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000648 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000309 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AQOI01000715 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000060 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000023 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000334 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000086 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000446 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000772 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000699 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000265 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000444 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000066 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000462 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000494 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000724 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000760 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000187 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000417 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000644 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000381 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000128 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000416 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AQOI01000639 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000169 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000149 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000818 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000853 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000092 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000443 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000056 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000135 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000789 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000808 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000716 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000835 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000253 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 3 0 0
NZ_AQOI01000404 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000399 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000105 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_AQOI01000702 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000085 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000042 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000193 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000372 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000448 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000192 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000455 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000115 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000294 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000061 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000231 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000616 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000748 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000431 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000778 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000643 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000686 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000411 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000041 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AQOI01000345 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000125 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000823 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000282 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000348 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000773 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000453 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000239 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000742 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000792 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000751 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000761 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000303 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000652 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000743 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000692 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000798 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000178 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000103 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000782 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000352 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000505 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000196 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000636 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000298 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000563 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000364 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000567 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000438 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000095 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AQOI01000222 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000108 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000376 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000827 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000080 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000427 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000800 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000755 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000705 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000346 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000670 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000544 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000026 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_AQOI01000414 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000507 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000326 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000166 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000467 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000143 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000083 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000621 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000388 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000422 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000676 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000072 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 4 0 0
NZ_AQOI01000477 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000821 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000856 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000558 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000285 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000457 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000589 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000136 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000458 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000130 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000803 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs Cas9_archaeal 0 0 0 0
NZ_AQOI01000114 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000188 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000543 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000496 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000708 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000820 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000035 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000325 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000678 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000162 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000590 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000618 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000641 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000838 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000595 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000070 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000632 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000420 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000015 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000392 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000079 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000318 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000746 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000848 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000225 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000017 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000098 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000300 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000306 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000815 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000698 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000469 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000332 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000825 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AQOI01000518 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000109 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000581 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000717 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000688 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000578 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000872 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000452 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000403 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000226 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000374 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000014 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000010 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000413 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000271 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000723 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000005 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000215 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000846 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000646 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000368 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000677 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000729 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000421 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000536 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000045 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000112 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_AQOI01000728 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000230 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000245 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000871 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000602 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000003 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000801 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000579 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000651 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000744 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000397 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000019 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000706 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000866 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000765 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000530 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000198 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 1 3 0 0
NZ_AQOI01000539 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000022 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas5,cas8c,cas7,cas4,cas1,cas2 0 0 0 0
NZ_AQOI01000147 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000869 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000664 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000387 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000673 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000116 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000213 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000740 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000757 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000758 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000522 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000165 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000375 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000064 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000852 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000548 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000028 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000075 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000312 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000436 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000071 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 3 0 0
NZ_AQOI01000168 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000784 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000470 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000696 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000834 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000065 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000484 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000807 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000874 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000073 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000596 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000832 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000051 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000054 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000437 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000167 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000219 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000280 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000412 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000592 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000492 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000764 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000811 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000551 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000278 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000603 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000284 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000510 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000657 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000331 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000875 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000155 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000562 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000597 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000043 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000656 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000263 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000587 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000246 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000037 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AQOI01000276 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000199 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000629 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_AQOI01000301 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000342 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000464 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000241 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000210 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000018 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000527 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000776 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000550 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000110 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000286 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000209 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000008 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000129 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000804 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000354 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000573 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000033 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000124 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AQOI01000481 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000379 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AQOI01000796 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000770 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000566 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000689 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000062 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000870 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000813 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000009 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000556 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000380 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000786 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000391 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000191 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AQOI01000687 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000208 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000148 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 3 0 0
NZ_AQOI01000569 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000016 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000700 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000877 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000736 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000672 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000402 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000509 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000668 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000140 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000721 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000793 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000495 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000034 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000836 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000133 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000666 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000291 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000797 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000583 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000440 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000031 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000812 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000817 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000490 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000753 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000025 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000299 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000170 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000234 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000324 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000389 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000344 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000267 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000273 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000337 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000769 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000532 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000093 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000377 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000321 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000878 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000777 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000640 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000400 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000382 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000447 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000865 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000138 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000617 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000806 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000586 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000001 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000726 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000211 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000615 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000311 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000828 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000634 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000378 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000754 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000156 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000738 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000055 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000625 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000791 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_AQOI01000475 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000824 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000506 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000525 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000398 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000861 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000465 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000557 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000078 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000067 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000058 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000709 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000113 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000214 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000288 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000272 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000612 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000201 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000355 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000182 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000362 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000424 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000089 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000036 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_AQOI01000680 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000565 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000619 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000701 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000667 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000261 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000662 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000683 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000096 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000251 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000087 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000478 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000418 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000218 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000606 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000228 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000185 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000117 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000486 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000520 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000137 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000235 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000649 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000279 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000123 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000069 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000405 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000262 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000250 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000613 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000675 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000363 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000833 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000439 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000357 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000186 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000795 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000184 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000002 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000802 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000308 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000576 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000588 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000519 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000482 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000814 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000514 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000790 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000534 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000127 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000794 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000434 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000517 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000131 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000132 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000359 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000360 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000555 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000727 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000410 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000704 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000500 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000315 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000718 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000097 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000745 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000863 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000082 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000471 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000373 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000684 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000624 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000101 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000154 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000441 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000305 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000269 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000118 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000523 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000007 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000396 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000783 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000367 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000369 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000406 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000206 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000570 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000763 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000497 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000335 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000433 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000552 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000145 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000631 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000831 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000393 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000264 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000358 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000623 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000134 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000847 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000423 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000730 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000614 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000541 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000322 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000750 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000252 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000074 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000799 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000232 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000091 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000609 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000179 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000712 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000390 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000810 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000394 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000242 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000435 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AQOI01000415 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000472 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000671 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000611 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000310 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000876 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000450 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000255 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000627 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000122 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000515 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_AQOI01000493 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000476 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000106 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000682 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000200 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000217 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000204 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000859 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000157 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000454 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000714 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000126 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000297 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000274 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000762 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000320 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000774 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000290 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000502 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000383 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000733 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000739 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000197 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000451 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000542 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000053 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000336 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000560 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000474 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000663 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000533 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000781 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000633 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000690 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000540 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000038 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000047 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000119 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000628 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000679 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000150 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000610 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000491 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000158 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000229 Xanthomonas sp. SHU 199, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_AQOI01000223 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000349 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000268 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000660 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000029 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000584 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000385 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000384 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000598 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000842 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000076 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000449 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000283 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000004 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000429 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000601 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000021 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000012 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000681 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000840 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000512 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000442 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000046 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000574 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000669 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000488 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000027 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_AQOI01000768 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000408 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000575 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000873 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000244 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000088 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000302 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000720 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000044 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000568 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000734 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000205 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000466 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000111 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000528 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_AQOI01000257 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000731 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000313 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000526 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000771 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000084 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000212 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000333 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000361 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000805 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000227 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000841 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000837 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000240 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000549 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000844 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000577 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000260 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000090 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000545 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000121 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000220 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000513 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000425 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000775 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000203 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000013 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000254 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000052 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000256 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000546 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000741 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000752 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000725 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000858 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000780 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000456 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000732 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000860 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000600 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000289 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000722 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000259 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000653 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000582 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000822 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000316 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000826 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000862 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000050 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000635 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000599 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000516 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000024 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000221 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000829 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000850 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000139 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000459 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000248 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000593 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000430 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000537 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000175 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000428 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000713 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000864 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000479 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000845 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000585 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000564 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000659 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000409 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000296 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000293 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000695 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000637 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000040 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000571 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000463 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000719 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000483 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000353 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000161 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000407 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000473 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000292 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000177 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000638 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000485 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000277 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000461 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000077 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_AQOI01000559 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000880 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000366 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000693 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000327 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000553 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000081 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000674 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000330 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000766 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000511 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000655 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000339 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000499 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000857 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000295 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000498 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000365 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000329 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000350 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000341 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000164 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000735 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000163 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000338 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000868 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000747 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000063 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000503 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000785 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000401 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000160 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000419 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000356 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000647 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000591 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000445 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000142 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000710 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000867 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000049 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_AQOI01000489 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000707 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000767 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000032 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000661 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000756 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000006 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000843 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000270 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000236 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_AQOI01000654 Xanthomonas sp. SHU 199, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AQOI01000148
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000148_1 3618-4438 Orphan I-C
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000148_1 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3979-4013 35 MH229865 Streptomyces phage LazerLemon, complete genome 36217-36251 5 0.857
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP053711 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence 61361-61395 6 0.829
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 142218-142252 6 0.829
NZ_AQOI01000148_1 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3979-4013 35 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 81313-81347 7 0.8
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 269420-269454 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 116585-116619 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1025465-1025499 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1025472-1025506 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 954262-954296 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 912017-912051 8 0.771
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 25536-25570 9 0.743
NZ_AQOI01000148_1 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3979-4013 35 NZ_AP014811 Methylorubrum populi strain P-1M plasmid pMPPM02, complete sequence 35858-35892 9 0.743
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1048339-1048373 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1645402-1645436 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 727776-727810 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 486959-486993 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 25996-26030 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1560360-1560394 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1107088-1107122 10 0.714
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 17160-17194 10 0.714
NZ_AQOI01000148_1 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3979-4013 35 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1425522-1425556 10 0.714
NZ_AQOI01000148_1 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 4110-4143 34 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1321143-1321176 10 0.706
NZ_AQOI01000148_1 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 4110-4143 34 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 852098-852131 10 0.706
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 115557-115591 11 0.686
NZ_AQOI01000148_1 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3780-3814 35 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 422980-423014 11 0.686
NZ_AQOI01000148_1 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 3979-4013 35 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 280515-280549 11 0.686
NZ_AQOI01000148_1 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT 4110-4143 34 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 725982-726015 11 0.676

1. spacer 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to MH229865 (Streptomyces phage LazerLemon, complete genome) position: , mismatch: 5, identity: 0.857

tgccacgccttctcggccgccacgtcctgcttgac	CRISPR spacer
tggcgtgccttctcggccgccgcgtgctgcttgac	Protospacer
** *..***************.*** *********

2. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.829

gccatcacgagcagggcgaacagcacgccgg-cgca	CRISPR spacer
gccatcacgagcaatgcgaacagcacgaagatcgc-	Protospacer
*************. ************  *. *** 

3. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.829

gccatcacgagcagggcgaacagcacgccgg-cgca	CRISPR spacer
gccatcacgagcaatgcgaacagcacgaagatcgc-	Protospacer
*************. ************  *. *** 

4. spacer 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.8

-tgccacgccttctcggccgccacgtcctgcttgac	CRISPR spacer
atggc-cgccttctcggccgccacctgctgcatcgc	Protospacer
 ** * ****************** * **** * .*

5. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
tcaatgtagagcagggcgaacagcatgccgccgcg	Protospacer
 * **   *****************.**** ***.

6. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
tcaatgtagagcagggcgaacagcatgccgccgcg	Protospacer
 * **   *****************.**** ***.

7. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca-	CRISPR spacer
ccgaccaccaccagggcgaacagcacgcc-gtacac	Protospacer
 * *.*** * ****************** *..** 

8. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca-	CRISPR spacer
ccgaccaccaccagggcgaacagcacgcc-gtacac	Protospacer
 * *.*** * ****************** *..** 

9. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca-	CRISPR spacer
ccgaccaccaccagggcgaacagcacgcc-gtacac	Protospacer
 * *.*** * ****************** *..** 

10. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771

gccatcacgagcagggcgaacagcacgccggcgca-	CRISPR spacer
ccgaccaccaccagggcgaacagcacgcc-gtacac	Protospacer
 * *.*** * ****************** *..** 

11. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 9, identity: 0.743

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
tacgtggcgagcagggcggccagcacgccggcgag	Protospacer
  *.* .***********. ************* .

12. spacer 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_AP014811 (Methylorubrum populi strain P-1M plasmid pMPPM02, complete sequence) position: , mismatch: 9, identity: 0.743

tgccacgccttctcggccgccacgtcctgcttgac	CRISPR spacer
tggatcgccttctcggccgccagttcctgccgaag	Protospacer
**   *****************  ******. .* 

13. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
ccgaacacgagcagcgcgagcagcacgccgctcgt	Protospacer
 * * ********* ****.********** .   

14. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

15. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
acaccggcgagcaggccgaacagcacgccgccgat	Protospacer
.*  . .******** ************** **  

16. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

17. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

18. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

19. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

20. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
agcaggtcgggccgggcgaacagcacgccggccag	Protospacer
. **   **.** *******************  .

21. spacer 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.714

tgccacgccttctcggccgccacgtcctgcttgac	CRISPR spacer
gacgccgccttcacggccgccacgtccggccgagc	Protospacer
 .*  ******* ************** **. ..*

22. spacer 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.706

cacaccgaacgatccggcatagcgcggccgtgca	CRISPR spacer
cttgccgatccatccggcatagcgcggcaccgtc	Protospacer
* ..**** * *****************  .*. 

23. spacer 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.706

cacaccgaacgatccggcatagcgcggccgtgca	CRISPR spacer
cttgccgatccatccggcatagcgcggcaccgtc	Protospacer
* ..**** * *****************  .*. 

24. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 11, identity: 0.686

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
atggcgccgaccagggcgaacagcaagccggcccc	Protospacer
.. ..  *** ************** ****** * 

25. spacer 1.3|3780|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.686

gccatcacgagcagggcgaacagcacgccggcgca	CRISPR spacer
acggcgccgaccagggcgaacagcaggccggccac	Protospacer
.* ..  *** ************** ******   

26. spacer 1.6|3979|35|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 11, identity: 0.686

tgccacgccttctcggccgccacgtcctgcttgac	CRISPR spacer
aggaccgcctgctcggccgccatgtcctgcggcgg	Protospacer
 *   ***** ***********.*******   . 

27. spacer 1.8|4110|34|NZ_AQOI01000148|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 11, identity: 0.676

cacaccgaacgatccggcatagcgcggccgtgca	CRISPR spacer
gctccttgccgatccggcatggcgcgcccgtgcc	Protospacer
  . *. . ***********.***** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AQOI01000586
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AQOI01000253
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000253_1 5682-6439 Orphan I-C
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27002-27036 0 1.0
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_007353 Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence 1140-1174 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JX469826 Uncultured bacterium plasmid pB12, complete sequence 16830-16864 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16674-16708 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 9794-9828 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 17692-17726 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_019369 Burkholderia cepacia plasmid pYS1, complete sequence 16379-16413 1 0.971
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31605-31639 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12814-12848 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25625-25659 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_008459 Bordetella pertussis plasmid pBP136 DNA, complete sequence 25801-25835 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 18140-18174 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 47272-47306 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 16388-16422 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 16389-16423 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 16396-16430 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16523-16557 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31898-31932 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 41036-41070 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 16397-16431 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 7988-8022 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65435-65469 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50741-50775 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17888-17922 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 16386-16420 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 16385-16419 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 16387-16421 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10990-11024 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49815-49849 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104027-104061 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 72234-72268 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 30908-30942 2 0.943
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 16397-16431 2 0.943
NZ_AQOI01000253_1 1.11|6375|34|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6375-6408 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 196891-196924 7 0.794
NZ_AQOI01000253_1 1.11|6375|34|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6375-6408 34 MN428048 Gordonia phage DobbysSock, complete genome 38412-38445 8 0.765
NZ_AQOI01000253_1 1.7|6112|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6112-6146 35 MH155867 Gordonia phage Easley, complete genome 43530-43564 9 0.743
NZ_AQOI01000253_1 1.7|6112|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6112-6146 35 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 160383-160417 10 0.714
NZ_AQOI01000253_1 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR 6046-6080 35 NC_017078 Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence 112131-112165 12 0.657

1. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctattgaacggctctggat	Protospacer
***********************************

2. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_007353 (Sphingomonas sp. A1 plasmid pA1 DNA, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

3. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

4. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

5. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

6. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

7. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 1, identity: 0.971

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaacggctctggat	Protospacer
*****************.*****************

8. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

9. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

10. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

11. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

12. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_008459 (Bordetella pertussis plasmid pBP136 DNA, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

13. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctattgaacgactttggat	Protospacer
**************************.**.*****

14. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgccattgaaaggctctggat	Protospacer
*****************.****** **********

15. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

16. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

17. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

18. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

19. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

20. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

21. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

22. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

23. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

24. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

25. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

26. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

27. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

28. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

29. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

30. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

31. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acacgcggcggcatcgccattgaacggctctggat	Protospacer
**.**************.*****************

32. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

33. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

34. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

35. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

36. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

37. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

38. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

39. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acgcgcggcggcatcgctatcgaacggctgtggat	Protospacer
********************.******** *****

40. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 2, identity: 0.943

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
acacgcggcggcatcgccattgaacggctctggat	Protospacer
**.**************.*****************

41. spacer 1.11|6375|34|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

-cgtcgtagatgggcgcggtccacggcatcgtggg	CRISPR spacer
gcgctg-aactgggcgcggtccacggaatcgcggg	Protospacer
 **..* *. **************** ****.***

42. spacer 1.11|6375|34|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to MN428048 (Gordonia phage DobbysSock, complete genome) position: , mismatch: 8, identity: 0.765

cgtcgtagatgggcgcggtccacggcatcgtggg	CRISPR spacer
tgaagaagatcggcgcggtccacggcaacgtaga	Protospacer
.*  * **** **************** ***.*.

43. spacer 1.7|6112|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to MH155867 (Gordonia phage Easley, complete genome) position: , mismatch: 9, identity: 0.743

gagggcggcgaggatgccagcgatgacg-gccaacg	CRISPR spacer
gtcggcggcgaggatgccagcgtcgacgagtccgt-	Protospacer
*  ******************* .**** *.* .. 

44. spacer 1.7|6112|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 10, identity: 0.714

gagggcggcgaggatgccagcgatgacggccaacg	CRISPR spacer
cacctcggcgaggctgccaccgatgacggcctgga	Protospacer
 *   ******** ***** *********** . .

45. spacer 1.6|6046|35|NZ_AQOI01000253|CRISPRCasFinder,CRT,PILER-CR matches to NC_017078 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence) position: , mismatch: 12, identity: 0.657

acgcgcggcggcatcgctattgaacggctctggat	CRISPR spacer
gaaatgggcggcatcgatattgagcggctctatca	Protospacer
. .   ********** ******.*******.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_AQOI01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 95 : 7970 16 Xylella_phage(28.57%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_AQOI01000072
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000072_1 18-507 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000072_1 1.1|49|36|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 49-84 36 LR743523 Xylella phage Usme genome assembly, chromosome: 1 3432-3467 1 0.972
NZ_AQOI01000072_1 1.1|49|36|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 49-84 36 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 10392-10427 1 0.972
NZ_AQOI01000072_1 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 116-149 34 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 219365-219398 8 0.765
NZ_AQOI01000072_1 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 116-149 34 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 216030-216063 8 0.765
NZ_AQOI01000072_1 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 116-149 34 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 216007-216040 8 0.765
NZ_AQOI01000072_1 1.4|246|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 246-279 34 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 2102305-2102338 8 0.765
NZ_AQOI01000072_1 1.4|246|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 246-279 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 38738-38771 8 0.765
NZ_AQOI01000072_1 1.5|311|35|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 311-345 35 MN937349 Stenotrophomonas phage vB_SmaS_BUCT548, complete genome 867-901 9 0.743
NZ_AQOI01000072_1 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT 116-149 34 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 155500-155533 10 0.706

1. spacer 1.1|49|36|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to LR743523 (Xylella phage Usme genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.972

aacccggtaggcgacgacacctattccgcatgccct	CRISPR spacer
aacccggtaggcgacgacacctattccgcctgccct	Protospacer
***************************** ******

2. spacer 1.1|49|36|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 1, identity: 0.972

aacccggtaggcgacgacacctattccgcatgccct	CRISPR spacer
aacccggtaggcgatgacacctattccgcatgccct	Protospacer
**************.*********************

3. spacer 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 8, identity: 0.765

gagtaggcgatcagccggtccatcgagccgtcga	CRISPR spacer
atgcaggcgatgagccggtccatcgagccagata	Protospacer
. *.******* *****************.   *

4. spacer 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.765

gagtaggcgatcagccggtccatcgagccgtcga	CRISPR spacer
atgcaggcgatgagccggtccatcgagccagata	Protospacer
. *.******* *****************.   *

5. spacer 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.765

gagtaggcgatcagccggtccatcgagccgtcga	CRISPR spacer
atgcaggcgatgagccggtccatcgagccagata	Protospacer
. *.******* *****************.   *

6. spacer 1.4|246|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.765

-gtttgaagccgggatgctggtaacgcctgaaggc	CRISPR spacer
tgtctg-ccccggcatgctggaaacgcctgaagcg	Protospacer
 **.**   **** ******* ***********  

7. spacer 1.4|246|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

-gtttgaagccgggatgctggtaacgcctgaaggc	CRISPR spacer
tgtctg-ccccggcatgctggaaacgcctgaagcg	Protospacer
 **.**   **** ******* ***********  

8. spacer 1.5|311|35|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to MN937349 (Stenotrophomonas phage vB_SmaS_BUCT548, complete genome) position: , mismatch: 9, identity: 0.743

cagaagtccgcatcaagatgcgcgatggcggtgtc	CRISPR spacer
ccaacgaaatcaccaagattcgcgatggcggtgtc	Protospacer
* .* *    **.****** ***************

9. spacer 1.2|116|34|NZ_AQOI01000072|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.706

gagtaggcgatcagccggtccatcgagccgtcga	CRISPR spacer
ataatgtccatcagccggtccagcgaggcgtcgg	Protospacer
. .  * * ************* **** *****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_AQOI01000036
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2400 : 12326 9 Enterobacteria_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_AQOI01000105
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000105_1 3607-3704 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_AQOI01000791
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000791_1 6062-6162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_AQOI01000071
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000071_1 2-821 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000071_1 1.6|362|34|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT 362-395 34 NZ_CP034303 Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-4, complete sequence 42300-42333 8 0.765
NZ_AQOI01000071_1 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT 624-659 36 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 498717-498752 10 0.722
NZ_AQOI01000071_1 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT 624-659 36 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1143943-1143978 10 0.722
NZ_AQOI01000071_1 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT 624-659 36 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 172688-172723 10 0.722
NZ_AQOI01000071_1 1.3|165|34|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT 165-198 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 299229-299262 11 0.676

1. spacer 1.6|362|34|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034303 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-4, complete sequence) position: , mismatch: 8, identity: 0.765

taccgagaattgcgccctcgtcttcattgatatt	CRISPR spacer
cactacgaactgcgccctcttcttcattgacgtt	Protospacer
.**.. ***.********* **********..**

2. spacer 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 10, identity: 0.722

ctgtgtgacggcagcgcccagttcgtcgacgtcaag	CRISPR spacer
cgccgtgacggccgcggccagttcgtcgaccatctg	Protospacer
*  .******** *** *************  .  *

3. spacer 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 10, identity: 0.722

ctgtgtgacggcagcgcccagttcgtcgacgtcaag	CRISPR spacer
cgccgtgacggccgcggccagttcgtcgaccatctg	Protospacer
*  .******** *** *************  .  *

4. spacer 1.10|624|36|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 10, identity: 0.722

ctgtgtgacggcagcgcccagttcgtcgacgtcaag	CRISPR spacer
cgcttccacggcggcggccagttcgtcgacgtcgtc	Protospacer
*  * . *****.*** ****************.  

5. spacer 1.3|165|34|NZ_AQOI01000071|PILER-CR,CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 11, identity: 0.676

tcgcttgcagcgaaaccgtgccggccgtgtacgg	CRISPR spacer
agatcggcatcgaaaccgtgccggccctgttcac	Protospacer
  ... *** **************** *** *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_AQOI01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7905 : 29576 35 Vibrio_phage(15.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_AQOI01000027.1|WP_017907426.1|21473_21761_+|hypothetical-protein 21473_21761_+ 95 aa aa AcrIC10 HTH_Hin_like NA 7905-29576 NA
11. NZ_AQOI01000229
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000229_1 5316-5434 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_AQOI01000112
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1082 : 7882 7 uncultured_Caudovirales_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_AQOI01000107
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000107_1 3938-4291 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 700057-700088 3 0.906
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 348491-348522 3 0.906
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 701921-701953 4 0.879
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3246573-3246605 4 0.879
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 122334-122366 5 0.848
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 411397-411429 5 0.848
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 151972-152001 5 0.833
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 190229-190260 5 0.844
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 178957-178988 5 0.844
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 90519-90550 5 0.844
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 3004-3035 5 0.844
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_MK047609 Pseudomonas aeruginosa strain 121156 plasmid pNECK1, complete sequence 6578-6609 5 0.844
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 768184-768216 6 0.818
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 837583-837615 6 0.818
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 102544-102576 6 0.818
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 185275-185307 6 0.818
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 MN234226 Mycobacterium phage Curiosium, complete genome 10288-10320 6 0.818
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 240046-240075 6 0.8
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 MK937611 Gordonia phage Verity, complete genome 4143-4172 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR594670 Variovorax sp. SRS16 plasmid 5 30823-30852 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP043477 Xanthomonas hyacinthi strain CFBP 1156 plasmid unnamed, complete sequence 23884-23913 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_019378 Burkholderia cepacia plasmid pIJB1, complete sequence 7696-7725 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR594674 Variovorax sp. PBL-E5 plasmid 4 64183-64212 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR594665 Variovorax sp. RA8 plasmid 4 30823-30852 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_025029 Uncultured bacterium pAKD4 plasmid pAKD4, complete sequence 7698-7727 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 586245-586274 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 197388-197417 6 0.8
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 114239-114268 6 0.8
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 181372-181403 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 62558-62589 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 165495-165526 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 363841-363872 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 778240-778271 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 247311-247342 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 828262-828293 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3246568-3246599 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 984862-984893 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 349409-349440 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 130401-130432 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 669978-670009 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 85556-85587 6 0.812
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_019408 Caulobacter phage CcrRogue, complete genome 41127-41158 6 0.812
NZ_AQOI01000107_1 1.9|4125|29|NZ_AQOI01000107|CRT 4125-4153 29 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 203219-203247 6 0.793
NZ_AQOI01000107_1 1.9|4125|29|NZ_AQOI01000107|CRT 4125-4153 29 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 489236-489264 6 0.793
NZ_AQOI01000107_1 1.9|4125|29|NZ_AQOI01000107|CRT 4125-4153 29 NZ_LR594664 Variovorax sp. RA8 plasmid 3 311758-311786 6 0.793
NZ_AQOI01000107_1 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder 3962-3991 30 KY092481 Streptomyces phage PapayaSalad, complete genome 18793-18822 7 0.767
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 198017-198049 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1188889-1188921 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1096268-1096300 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 53219-53251 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 287855-287887 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 828267-828299 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 180689-180721 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 217317-217349 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 984856-984888 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 391434-391466 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 289947-289979 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP015369 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p2, complete sequence 12605-12637 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 235948-235980 7 0.788
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 44449-44481 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 494459-494491 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 409110-409142 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 856351-856383 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 856364-856396 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 856364-856396 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 856353-856385 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 856353-856385 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 856364-856396 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 856375-856407 7 0.788
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 856353-856385 7 0.788
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 4765-4794 7 0.767
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 112076-112105 7 0.767
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP021919 Sagittula sp. P11 plasmid unnamed5, complete sequence 13365-13394 7 0.767
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NC_047992 Microbacterium phage Zeta1847, complete genome 37249-37278 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 115839-115868 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 2022-2051 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 547363-547392 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1186300-1186329 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1156341-1156370 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 535683-535712 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1252523-1252552 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 129539-129568 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 540591-540620 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 533327-533356 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 758786-758815 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1200232-1200261 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 889015-889044 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 794138-794167 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 874988-875017 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 456420-456449 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 396611-396640 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1322120-1322149 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 474324-474353 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 686292-686321 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 557125-557154 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1327045-1327074 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1099338-1099367 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1186306-1186335 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 357454-357483 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 83483-83512 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 AB451219 Ralstonia phage RSB1 DNA, complete genome 17866-17895 7 0.767
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_011201 Ralstonia phage RSB1, complete genome 17866-17895 7 0.767
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490843-490874 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1188884-1188915 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 326340-326371 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP013071 Sphingobium indicum B90A plasmid pSRL1, complete sequence 68179-68210 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 61011-61042 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 514152-514183 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 447453-447484 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 582172-582203 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 139194-139225 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 535904-535935 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 391440-391471 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 289942-289973 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1042723-1042754 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 260-291 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 634633-634664 7 0.781
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 KY676784 Streptomyces phage ToastyFinz, complete genome 19194-19225 7 0.781
NZ_AQOI01000107_1 1.9|4125|29|NZ_AQOI01000107|CRT 4125-4153 29 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 6505-6533 7 0.759
NZ_AQOI01000107_1 1.10|4179|29|NZ_AQOI01000107|CRT 4179-4207 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 935249-935277 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 151967-151995 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1928390-1928418 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 357460-357488 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 377341-377369 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 83489-83517 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 114245-114273 7 0.759
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 157436-157464 7 0.759
NZ_AQOI01000107_1 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder 3962-3991 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 501971-502000 8 0.733
NZ_AQOI01000107_1 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder 3962-3991 30 MT711975 Streptomyces phage Alderaan, complete genome 25209-25238 8 0.733
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 215678-215710 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1699149-1699181 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP009405 Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence 31074-31106 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 220372-220404 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP011276 Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence 45115-45147 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 175312-175344 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP035420 Leisingera sp. NJS204 plasmid unnamed3, complete sequence 137865-137897 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP022994 Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence 102540-102572 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 800440-800472 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 174262-174294 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 57446-57478 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 18413-18445 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 101660-101692 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 85550-85582 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 10636-10668 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 77330-77362 8 0.758
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 97528-97560 8 0.758
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 MN234216 Streptomyces phage Gilgamesh, complete genome 81167-81199 8 0.758
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 151425-151457 8 0.758
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP017591 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence 45048-45077 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 13949-13978 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_LR594664 Variovorax sp. RA8 plasmid 3 311763-311792 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 866907-866936 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 489230-489259 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 167399-167428 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP018853 Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.3, complete sequence 9164-9193 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 351097-351126 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP018857 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence 10056-10085 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 412223-412252 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP046100 Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence 187986-188015 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP046254 Sphingobium sp. CAP-1 plasmid p1, complete sequence 144308-144337 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP024080 Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC47, complete sequence 23076-23105 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 465389-465418 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 17626-17655 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 28296-28325 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NC_020798 Xanthomonas axonopodis Xac29-1 plasmid pXAC47, complete sequence 23078-23107 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 583220-583249 8 0.733
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NC_014007 Sphingobium japonicum UT26S plasmid pCHQ1, complete sequence 6067-6096 8 0.733
NZ_AQOI01000107_1 1.5|4184|30|NZ_AQOI01000107|CRISPRCasFinder 4184-4213 30 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1530685-1530714 8 0.733
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1928384-1928413 8 0.733
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 315045-315074 8 0.733
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 391795-391824 8 0.733
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 202381-202410 8 0.733
NZ_AQOI01000107_1 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder 4238-4267 30 NC_008741 Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence 65216-65245 8 0.733
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1336892-1336923 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1626628-1626659 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 768190-768221 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 837578-837609 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 153743-153774 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490279-490310 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032923 Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence 490399-490430 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 1096263-1096294 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 175318-175349 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 411403-411434 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP009405 Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence 31069-31100 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP020717 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence 38081-38112 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1058836-1058867 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 337786-337817 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 160989-161020 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 215673-215704 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 111034-111065 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 426876-426907 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 664831-664862 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1066973-1067004 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 398744-398775 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1568609-1568640 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 559236-559267 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 602568-602599 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 290626-290657 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 566541-566572 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1573150-1573181 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 802064-802095 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 180399-180430 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP041161 Leisingera aquaemixtae strain R2C4 plasmid unnamed7 5012-5043 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022994 Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence 102546-102577 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 800435-800466 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 76475-76506 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 801613-801644 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 18408-18439 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604418-604449 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604421-604452 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604424-604455 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604427-604458 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604430-604461 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604433-604464 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 101666-101697 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 340984-341015 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 482673-482704 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 10631-10662 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 77336-77367 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 14464-14495 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 110353-110384 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190034-190065 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190037-190068 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 12463-12494 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 791845-791876 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 614416-614447 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1979237-1979268 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 25174-25205 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 793088-793119 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 130388-130419 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1124797-1124828 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 166557-166588 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 36692-36723 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 226096-226127 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 133443-133474 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 603650-603681 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 231427-231458 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 22916-22947 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 1874-1905 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 10062-10093 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 77472-77503 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 529854-529885 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 98102-98133 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MH015255 Ruegeria phage vB_RpoS-V10, complete genome 37457-37488 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30644-30675 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30647-30678 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30650-30681 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30653-30684 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30656-30687 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 32266-32297 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT711975 Streptomyces phage Alderaan, complete genome 17566-17597 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241605 Achromobacter phage AMA1, complete genome 45326-45357 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241605 Achromobacter phage AMA1, complete genome 45332-45363 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK962627 Achromobacter phage vB_AxyS_19-32_Axy06, complete genome 2440-2471 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK962627 Achromobacter phage vB_AxyS_19-32_Axy06, complete genome 2443-2474 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 KP202969 Achromobacter phage JWX, complete genome 811-842 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 KP202969 Achromobacter phage JWX, complete genome 47166-47197 8 0.75
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP054921 Streptomyces sp. NA03103 plasmid unnamed1, complete sequence 112892-112923 8 0.75
NZ_AQOI01000107_1 1.9|4125|29|NZ_AQOI01000107|CRT 4125-4153 29 MK937611 Gordonia phage Verity, complete genome 4149-4177 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 547369-547397 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1186295-1186323 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1156336-1156364 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 535689-535717 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1252518-1252546 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 129545-129573 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 540597-540625 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 533333-533361 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 801725-801753 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 758781-758809 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 149362-149390 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1200238-1200266 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 889021-889049 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 794144-794172 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 874983-875011 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 456426-456454 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 396606-396634 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1322126-1322154 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 474319-474347 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 686298-686326 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 557131-557159 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1327040-1327068 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP021115 Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence 56510-56538 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1099333-1099361 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1186301-1186329 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_008741 Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence 65211-65239 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 AB451219 Ralstonia phage RSB1 DNA, complete genome 17861-17889 8 0.724
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NC_011201 Ralstonia phage RSB1, complete genome 17861-17889 8 0.724
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 6709-6741 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 61016-61048 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 130406-130438 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 166551-166583 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP023453 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence 21327-21359 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP023453 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence 52372-52404 9 0.727
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 25438-25470 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 44403-44435 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 MH976511 Gordonia phage Gaea, complete genome 12322-12354 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 MH450129 Gordonia phage Ribeye, complete genome 12913-12945 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 MT723941 Gordonia phage YorkOnyx, complete genome 12268-12300 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 KY092482 Streptomyces phage Mojorita, complete genome 5778-5810 9 0.727
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 KY092480 Streptomyces phage Picard, complete genome 5778-5810 9 0.727
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 360928-360957 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 203224-203253 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 103653-103682 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 350770-350799 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 194351-194380 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 119282-119311 9 0.7
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 392235-392264 9 0.7
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 293027-293058 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 98414-98445 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 83554-83585 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 82927-82958 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1217853-1217884 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 98414-98445 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 82948-82979 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1904803-1904834 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1908470-1908501 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 82927-82958 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1217860-1217891 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 98389-98420 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1881193-1881224 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LN868941 Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence 51803-51834 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 259067-259098 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 209747-209778 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP031419 Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence 90393-90424 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 287850-287881 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1279734-1279765 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2796448-2796479 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1216720-1216751 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 234304-234335 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 369095-369126 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1554472-1554503 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 301206-301237 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 2221-2252 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 70265-70296 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1144780-1144811 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 59648-59679 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1091382-1091413 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 280379-280410 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023453 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence 21322-21353 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023453 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence 52367-52398 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 39471-39502 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1101774-1101805 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP018048 Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence 252980-253011 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP014514 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence 114408-114439 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 250615-250646 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 106395-106426 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 180618-180649 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 510593-510624 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 141055-141086 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 259077-259108 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 57441-57472 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 449032-449063 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 604415-604446 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 339603-339634 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 521718-521749 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1810577-1810608 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 161794-161825 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1936415-1936446 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1105391-1105422 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 78739-78770 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190040-190071 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190076-190107 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 106395-106426 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 305658-305689 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 106405-106436 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 106424-106455 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 106395-106426 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1475549-1475580 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1524398-1524429 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1564249-1564280 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 572819-572850 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1649921-1649952 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 572819-572850 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1649921-1649952 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 572819-572850 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP011276 Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence 45121-45152 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 572823-572854 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1649921-1649952 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1649921-1649952 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1649921-1649952 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 211432-211463 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1647236-1647267 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 572819-572850 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 22919-22950 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1658818-1658849 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1649924-1649955 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 395296-395327 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 395296-395327 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 792777-792808 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 117483-117514 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241607 Achromobacter phage AMA2, complete genome 30641-30672 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MH746817 Achromobacter phage vB_Ade_ART, complete genome 33207-33238 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MN304824 Catenulispora phage 69_17, complete genome 37536-37567 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MT241605 Achromobacter phage AMA1, complete genome 45329-45360 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK962627 Achromobacter phage vB_AxyS_19-32_Axy06, complete genome 2437-2468 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK376954 Gordonia phage WhoseManz, complete genome 58406-58437 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK376954 Gordonia phage WhoseManz, complete genome 58415-58446 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MH669007 Gordonia phage Marietta, complete genome 58746-58777 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MH669007 Gordonia phage Marietta, complete genome 58755-58786 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK327944 Escherichia phage vB_EcoM_G2540-3, complete genome 158645-158676 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 102816-102847 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 286546-286577 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1403232-1403263 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 813365-813396 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 813368-813399 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 11813-11844 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 1266-1297 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP027026 Streptomyces sp. WAC00288 plasmid p4, complete sequence 23467-23498 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 239075-239106 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023721 Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence 119714-119745 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 24790-24821 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 24793-24824 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 304562-304593 9 0.719
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 304565-304596 9 0.719
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 586240-586268 9 0.69
NZ_AQOI01000107_1 1.11|4233|29|NZ_AQOI01000107|CRT 4233-4261 29 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 197394-197422 9 0.69
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 117488-117520 10 0.697
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP014514 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence 114413-114445 10 0.697
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 768926-768958 10 0.697
NZ_AQOI01000107_1 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder 4130-4159 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 484135-484164 10 0.667
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 89943-89974 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1371857-1371888 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MN103533 Mycobacterium phage Weirdo19, complete genome 12358-12389 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 541828-541859 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 474208-474239 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 233637-233668 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 791002-791033 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5550367-5550398 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 61002-61033 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 440600-440631 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 134458-134489 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 193533-193564 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 188832-188863 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 622605-622636 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 592568-592599 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 713851-713882 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 80237-80268 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190079-190110 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP039906 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623b, complete sequence 40011-40042 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1755074-1755105 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 185813-185844 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 MK801723 Gordonia phage Coeur, complete genome 1564-1595 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 3628-3659 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 189539-189570 10 0.688
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 77730-77761 10 0.688
NZ_AQOI01000107_1 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder 4016-4048 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 111039-111071 11 0.667
NZ_AQOI01000107_1 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder 4073-4105 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 48925-48957 11 0.667
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP035420 Leisingera sp. NJS204 plasmid unnamed3, complete sequence 137860-137891 11 0.656
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 134316-134347 11 0.656
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1714103-1714134 11 0.656
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 JN698994 Mycobacterium phage DS6A, complete genome 24475-24506 11 0.656
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 73441-73472 12 0.625
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 2072205-2072236 12 0.625
NZ_AQOI01000107_1 1.7|4011|32|NZ_AQOI01000107|CRT 4011-4042 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 131687-131718 12 0.625

1. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.906

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgcggccgaggcggccgccgcgat	Protospacer
*********** ***** ************.*

2. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgcggccgaggcggccgccgcgat	Protospacer
*********** ***** ************.*

3. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.879

-tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
gcgccg-cgccgacgtggccgccgcggtcgccga	Protospacer
 .**** ********.************** ***

4. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.879

tgccgccgccgacgcggccgccgcggtcg-acga	CRISPR spacer
tccggccgccgacgccgccgccgcggtcgcacg-	Protospacer
* * *********** ************* *** 

5. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.848

-tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ccaccg-cgccgacgcgccggccgcggtcgacga	Protospacer
 ..*** ********** * **************

6. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 5, identity: 0.848

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
cgccgccgcccgcgcggccgccgcgg-cgacgca	Protospacer
.********* .************** *****  

7. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 5, identity: 0.833

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcttgccggcgtctgcgt	Protospacer
.  ********************** *** 

8. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

ttcgat--gccgccgccgacgcggccgccgcggt	CRISPR spacer
--cgatgcgccgccgccgacgcggcagccgcagc	Protospacer
  ****  ***************** *****.*.

9. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 5, identity: 0.844

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aagttc---gccgccgccgacggggccgccgcgct	Protospacer
   ***   ************* ********** *

10. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 5, identity: 0.844

ttcgatgccgccgccgacgcggccgc-cgcggt	CRISPR spacer
ctcgaggccgccgccgtcgcggccgcgagcgg-	Protospacer
.**** ********** *********  **** 

11. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

ttcgatgcc-gccgccgacgcggccgccgcggt	CRISPR spacer
-ttggtgccggccgccgcctcggccgccgcggt	Protospacer
 *.*.**** ******* * *************

12. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_MK047609 (Pseudomonas aeruginosa strain 121156 plasmid pNECK1, complete sequence) position: , mismatch: 5, identity: 0.844

ttcgatgccgccgccgacgcggccgc-cgcggt	CRISPR spacer
tccgaagccgccgccgtcgcggccgcgcacgg-	Protospacer
*.*** ********** ********* *.*** 

13. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 6, identity: 0.818

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
tgccgccgccgtcgcagccgccgcgg-cgctggt	Protospacer
*********** ***.********** ** .*. 

14. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 6, identity: 0.818

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
tgccgccgccgtcgcagccgccgcgg-cgctggt	Protospacer
*********** ***.********** ** .*. 

15. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 6, identity: 0.818

-tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ccggcg-cgccgagacggccgccgcggtcgacgc	Protospacer
 .* ** ****** .****************** 

16. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.818

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
tgccgccgcccccgcggccgccgc-gccggcggc	Protospacer
**********  ************ *.**.**. 

17. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to MN234226 (Mycobacterium phage Curiosium, complete genome) position: , mismatch: 6, identity: 0.818

tgccgc-cgccgacgcggccgccgcggtcgacga	CRISPR spacer
-gccgtgcgccgccgtggccgccgcggtcgacac	Protospacer
 ****. ***** **.****************. 

18. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
tgtcgatgatctgcgcgccgttggcgacct	Protospacer
 *.*  **.************.********

19. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 6, identity: 0.8

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
ggcccttggtctgcgcgtcgtcaacaatct	Protospacer
.****************.****..*.*.**

20. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594670 (Variovorax sp. SRS16 plasmid 5) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

21. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP043477 (Xanthomonas hyacinthi strain CFBP 1156 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

22. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_019378 (Burkholderia cepacia plasmid pIJB1, complete sequence) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

23. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594674 (Variovorax sp. PBL-E5 plasmid 4) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

24. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594665 (Variovorax sp. RA8 plasmid 4) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

25. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_025029 (Uncultured bacterium pAKD4 plasmid pAKD4, complete sequence) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
caaggccgtgctgattgccggcgtcggcag	Protospacer
 *  *****.*** **************.*

26. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg--	CRISPR spacer
cgtcgccgtgctgcttgccggcg--agcgggc	Protospacer
 .*******.*************  .****  

27. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgtcggcgg--	CRISPR spacer
cgtcgccgtgctgcttgccggcg--agcgggc	Protospacer
 .*******.*************  .****  

28. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.8

gatcgccgtactgcttgccggcgt--cggcgg	CRISPR spacer
catcgccgtgctgctggccggcgtgctggc--	Protospacer
 ********.***** ********  .***  

29. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgaaaccgccgccgacgcggccgccgcgac	Protospacer
 .*** .***********************..

30. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgccgcggacgcggccgacgcggc	Protospacer
 . *********** ********** *****.

31. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctgcaggccgccgacgccgcggccgccgcggt	Protospacer
.*  * ******* ** ***************

32. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacggtgccgccgccgaagcggccgccgacgt	Protospacer
  **.************ **********  **

33. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
atcgatgacgccgccgatgcggccgctcgggt	Protospacer
 ****** *********.********.  ***

34. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

--ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ccttcg--ggcgcggccgacgcggccgacgcggc	Protospacer
  ****  * *** ************* *****.

35. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatg-ccgccgccgacgcggccgccgcggt	CRISPR spacer
-ccgttgaccgccgccgtcgcggtcgccgcggc	Protospacer
 .** ** ********* *****.********.

36. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tgccttccggccgccgacgccgccgccgcggt	Protospacer
* *  * * *********** ***********

37. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatg-ccgccgccgacgcggccgccgcggt	CRISPR spacer
-ccgttgaccgccgccgtcgcggtcgccgcggc	Protospacer
 .** ** ********* *****.********.

38. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 6, identity: 0.812

ttcga--tgccgccgccgacgcggccgccgcggt	CRISPR spacer
--cgatttcccgacgccgacgcggcggccgcggc	Protospacer
  ***  * *** ************ *******.

39. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcttagccgccgccgccgccgccgccgcggg	Protospacer
***   ********** *** ********** 

40. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatg-ccgccgccgacgcggccgccgcggt	CRISPR spacer
-gtgatgaccgccggcgaggcggccgccgcggc	Protospacer
  .**** ****** *** *************.

41. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tgcgcggacgccgccgcggcggccgccgcggt	Protospacer
* **  * ********  **************

42. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.812

ttcgatgccgccgccgacgcggccg-ccgcggt	CRISPR spacer
atggatgccgccgccgccgccgccgcccgcga-	Protospacer
 * ************* *** **** *****. 

43. spacer 1.9|4125|29|NZ_AQOI01000107|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.793

ggacaag---cccttggtctgcgcgccgtcgg	CRISPR spacer
---caggttctccttggtcagcgcgccgtcgg	Protospacer
   **.*   .******** ************

44. spacer 1.9|4125|29|NZ_AQOI01000107|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

ggacaagcccttggtctgcgcgccgtcgg	CRISPR spacer
cgtcgagcccttggtcggcgggccgtcga	Protospacer
 * *.*********** *** *******.

45. spacer 1.9|4125|29|NZ_AQOI01000107|CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 6, identity: 0.793

ggacaagc---ccttggtctgcgcgccgtcgg	CRISPR spacer
---cacgtccgcctcggtctgcgcgccgtcgg	Protospacer
   ** *.   ***.*****************

46. spacer 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder matches to KY092481 (Streptomyces phage PapayaSalad, complete genome) position: , mismatch: 7, identity: 0.767

tgcccttgtccaactgcgtggcgaccaggc	CRISPR spacer
cgcccttgtcccactgcgtggtgagcggca	Protospacer
.********** *********.** *.*  

47. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ccccatcgccgacgcggcctccgtggtcgacgc	Protospacer
. **..************* ***.******** 

48. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ctcccccgccgccgcggccgccgcggtcgagcg	Protospacer
. ** ****** ******************  .

49. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ccccgccgccgaggccgccgccgcggtgatcga	Protospacer
. ********** ** *********** . ***

50. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cccgggcgccgacgcggccgccgcggtgggcgc	Protospacer
. * * ********************* *.** 

51. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgaccccgacgcggccgccgcacgcgccgc	Protospacer
***** * ****************.  ** ** 

52. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
gaccgccgccgtcgcggtcgccgcgg-cggcgtt	Protospacer
 .********* *****.******** **.**  

53. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 7, identity: 0.788

tgccg-ccgccgacgcggccgccgcggtcgacga	CRISPR spacer
-gctgcccgccgccgcggcggccgcggtcgagcc	Protospacer
 **.* ****** ****** ***********   

54. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 7, identity: 0.788

tgccg-ccgccgacgcggccgccgcggtcgacga	CRISPR spacer
-gctgcccgccgccgcggcggccgcggtcgagcc	Protospacer
 **.* ****** ****** ***********   

55. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
gaccgccgccgtcgcggtcgccgcgg-cggcgtt	Protospacer
 .********* *****.******** **.**  

56. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
cttcgccgccgccggggccgccgcggt-gatgac	Protospacer
. .******** ** ************ **.** 

57. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.788

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
cttcgccgccgccggggccgccgcggt-gatgac	Protospacer
. .******** ** ************ **.** 

58. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP015369 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p2, complete sequence) position: , mismatch: 7, identity: 0.788

-tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
gcgccg-cgccgacgcggccgccgccgccgagcg	Protospacer
 .**** ****************** *.***  .

59. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

-tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ctagcgct-tcgacggcgccgccgcggtcgacga	Protospacer
 *. ***. .*****  *****************

60. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 7, identity: 0.788

tgccg-ccgccgacgcggccgccgcggtcgacga	CRISPR spacer
-gctgaccgccgacgcggccgccgccctcgtggt	Protospacer
 **.* *******************  ***  * 

61. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

62. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

63. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

64. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

65. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

66. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

67. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

68. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

69. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

70. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
tgcgccaggcgatctctgcgcgctcgccgaggt	Protospacer
** . * *****.** **************** 

71. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.767

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gcaccaggatccgcgcgccgtcggcgacct	Protospacer
.  **  *.**.******************

72. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.767

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
tgacgagggtctgcgcgccgtcatcgacct	Protospacer
 * *   ***************. ******

73. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021919 (Sagittula sp. P11 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gcgccttggtctgcgcctcgtcggcggcgt	Protospacer
.  ************* .********.* *

74. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 7, identity: 0.767

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
ccgccaaggtctccgcgccgtcgccgacct	Protospacer
   **  ***** ********** ******

75. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
ccacgccgtactgcttgccggcggcgtcct	Protospacer
   ******************** ** *  

76. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
ccacgccgtactgcttgccggcggcgtcct	Protospacer
   ******************** ** *  

77. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

78. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

79. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

80. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

81. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

82. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

83. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

84. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

85. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

86. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

87. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

88. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

89. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

90. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

91. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

92. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

93. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

94. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

95. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

96. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

97. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

98. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
acgcgccgtactgcatgccggcgtcatcag	Protospacer
.  *********** **********. *.*

99. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
gatcgccgtactgcttggcgacgctgatga	Protospacer
***************** **.**..*..*.

100. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
gatcgccgtactgcttggcgacgctgatga	Protospacer
***************** **.**..*..*.

101. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to AB451219 (Ralstonia phage RSB1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
gatcaccgtgctgcttgccggcgcagccaa	Protospacer
****.****.*************. * *..

102. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_011201 (Ralstonia phage RSB1, complete genome) position: , mismatch: 7, identity: 0.767

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
gatcaccgtgctgcttgccggcgcagccaa	Protospacer
****.****.*************. * *..

103. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgatgccgacgccgacgcggacgccgatgc	Protospacer
 .******** *********** *****  *.

104. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggactcccccgccgccgcggccgccgcggt	Protospacer
 . **. ** ****** ***************

105. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgc--cgccgccgacgcggccgccgcggt	CRISPR spacer
--cgactctacgccgccgacgcggccggggcggc	Protospacer
  ***. *  *****************  ****.

106. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgtggacgccgccgccgcggccgccgcgga	Protospacer
 .**  * ******** ************** 

107. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgcggccgcggcggc	Protospacer
 .** .********** ********* ****.

108. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgcggccgacgcggcggatcagct	Protospacer
*********** *********** * .  * *

109. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtggcggccgccggcgccgcggccgccgcgat	Protospacer
 * *  ******* ** *************.*

110. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accattgccgccgcggccgcggccgccgcgat	Protospacer
 .*. ********* * *************.*

111. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcgatgacgccgccgacccggccgcggtcct	Protospacer
 ****** ********** ******* *.  *

112. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tcccacgacgccgtcgacgccgccgccgcgga	Protospacer
*.* *.* *****.****** ********** 

113. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgcgacttcgccgccgccggggccgccgcggt	Protospacer
. ***. .******** ** ************

114. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgcgacttcgccgccgccggggccgccgcggt	Protospacer
. ***. .******** ** ************

115. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cttgatgccgccgacgacgaggccgccaacgt	Protospacer
.*.********** ***** *******.  **

116. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgtcgacgccgacgacgcgcccgccgcggt	Protospacer
 .** .* ***** ******* **********

117. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgcgacttcgccgccgccggggccgccgcggt	Protospacer
. ***. .******** ** ************

118. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 7, identity: 0.781

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtcggcgccgccgccacggccgccgcggt	Protospacer
.* * .* ******** *.*************

119. spacer 1.9|4125|29|NZ_AQOI01000107|CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

ggacaagcccttggtctgcgcgccgtcgg	CRISPR spacer
ggacaagcccttgatctgcgcggaaccct	Protospacer
*************.********  ..*  

120. spacer 1.10|4179|29|NZ_AQOI01000107|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.759

ttccacgctgcccacctgggcgccagact	CRISPR spacer
ttcctcgatgcccacctgggcgccttcgc	Protospacer
**** ** ****************    .

121. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
tagtcacgcgccgtactgcttgccggcgt	Protospacer
*  . .  *********************

122. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
aactcgatcgccgtactggttggcggcga	Protospacer
  *. ************* *** ***** 

123. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gatctgatcgccgtactgcttggcgacgc	Protospacer
  .* ***************** **.**.

124. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
ctccagatcgccgtcctgcgtgccatggc	Protospacer
.************* **** ****.  *.

125. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
aatctgatcgccgtactgcttggcgacgc	Protospacer
  .* ***************** **.**.

126. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
tcgggcatcgccgtgctgctggccggcgt	Protospacer
*.  . ********.***** ********

127. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 7, identity: 0.759

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
cagcagatcgccgtgctgctcgccggagc	Protospacer
.  ***********.*****.***** *.

128. spacer 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tgcccttgtccaactgcgtggcgaccaggc	CRISPR spacer
cgcccttgtccagctgggtggcgagctcct	Protospacer
.***********.*** ******* *   .

129. spacer 1.1|3962|30|NZ_AQOI01000107|CRISPRCasFinder matches to MT711975 (Streptomyces phage Alderaan, complete genome) position: , mismatch: 8, identity: 0.733

tgcccttgtccaactgcgtggcgaccaggc	CRISPR spacer
cgcccttgtcccactgcgtggtgaggggaa	Protospacer
.********** *********.**  .*. 

130. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cgccgccgccgaagcggccgccggggcgcccgg	Protospacer
.*********** ********** **.   **.

131. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
accggacgccgacccggccgccccggtcgacct	Protospacer
  * * ******* ******** ********  

132. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP009405 (Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
gaccgccgccgatgcggccgccgcgctcaagat	Protospacer
 .**********.************ **.* . 

133. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tctcgccgccgccgcgaccgccgcggtcgggct	Protospacer
* .******** ****.************.   

134. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP011276 (Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgccgccgccgccgccgccgccgaacccgc	Protospacer
*********** *** ******** *    ** 

135. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ctccgccgccgtcgcggccgccgccgtactcgc	Protospacer
. ********* ************ **   ** 

136. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgccgccgccgccgccgccgctttcacggt	Protospacer
*********** *** ********  **.  * 

137. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga-	CRISPR spacer
atccgccgccgacgcggcagcggcgg-gggcgcc	Protospacer
  **************** ** ****  *.**  

138. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
acgcgccgacgacgcggccgacgcggtgaacca	Protospacer
   ***** *********** ****** .** *

139. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgacctgttcgccgcggcggccgcggtcgacga	Protospacer
** * .  .** ****** **************

140. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
caccgccgccgacgccaccgccgcggcggccgc	Protospacer
..************* .*********. * ** 

141. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgacgccggcgcggccgccgccggtgcagc	Protospacer
***** *****.************ * .*  * 

142. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgacgccggcgcggccgccgccggtgcagc	Protospacer
***** *****.************ * .*  * 

143. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ggacgccgccgcggcggccgccgcggtggcctt	Protospacer
 * ********  ************** * *  

144. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgacgccggcgcggccgccgccggtgcagc	Protospacer
***** *****.************ * .*  * 

145. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
tgccgacgccggcgcggccgccgccggtgcagc	Protospacer
***** *****.************ * .*  * 

146. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cgtcctcgccgacgcggtcgccgcggccgagca	Protospacer
.*.* .***********.********.***  *

147. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 8, identity: 0.758

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
ccaggccgtcgacctgtccgcgctcgccgagcg	Protospacer
. ...*** ******** ************* *

148. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.758

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
gggtgcgagcgacctctgcgcgctcgcccaggc	Protospacer
 ** .* .******* ************ *** 

149. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gcgttttggtctgcgcgccgccgacgaccc	Protospacer
.  ..***************.**.*****.

150. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gcgttttggtctgcgcgccgccgacgaccc	Protospacer
.  ..***************.**.*****.

151. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
ccgcctcggtctgcgcgccgtcggctgtcc	Protospacer
   ***.****************** ..*.

152. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gccggagggtctgcgcgccttcggcgactt	Protospacer
. *    ************ ********.*

153. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
agcccttggtcggcgggccgtcgagccggt	Protospacer
*********** *** *******.     *

154. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
tcgcgctggtctccgccccgtcggcgaccg	Protospacer
   * .****** *** ************ 

155. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP018853 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.3, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
taaccttagtgtgcgcgccgtcggcgcttt	Protospacer
 . ****.** *************** ..*

156. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
cggcgaaggtctgcgcgccggcggcgacgg	Protospacer
 * *   ************* *******  

157. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP018857 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
taaccttagtgtgcgcgccgtcggcgcttt	Protospacer
 . ****.** *************** ..*

158. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
ccgcctcgctctgcgcgccgtcggcggtcc	Protospacer
   ***.* *****************..*.

159. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
tctgatgggtctgcgcaccgtcggcgacgt	Protospacer
  .  * *********.*********** *

160. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP046254 (Sphingobium sp. CAP-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gagcgatggtctgcgcggcgtcggcgagcg	Protospacer
.. *  *********** ********* * 

161. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP024080 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC47, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
taaccttagtgtgcgcgccgtcggcgcttt	Protospacer
 . ****.** *************** ..*

162. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gccggagggtctgcgcgccttcggcgactt	Protospacer
. *    ************ ********.*

163. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gagcgatggtctgcgcggcgtcggcgagcg	Protospacer
.. *  *********** ********* * 

164. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
cctcgccggtctgcgcaccgtcggcgacgt	Protospacer
  .* ..*********.*********** *

165. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_020798 (Xanthomonas axonopodis Xac29-1 plasmid pXAC47, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
taaccttagtgtgcgcgccgtcggcgcttt	Protospacer
 . ****.** *************** ..*

166. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gccggagggtctgcgcgccttcggcgactt	Protospacer
. *    ************ ********.*

167. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_014007 (Sphingobium japonicum UT26S plasmid pCHQ1, complete sequence) position: , mismatch: 8, identity: 0.733

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gagcgatggtctgcgcggcgtcggcgagcg	Protospacer
.. *  *********** ********* * 

168. spacer 1.5|4184|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.733

cgctgcccacctgggcgccagactggacgg	CRISPR spacer
gaatgcccacttgggcggcagactggaata	Protospacer
 . *******.****** *********  .

169. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.733

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
gatcgccgtactggttggcggcgagcacat	Protospacer
************* *** *****   .*. 

170. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 8, identity: 0.733

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
cgtcgctgtactgcttgcgggcgtcgctat	Protospacer
 .****.*********** ******* .. 

171. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.733

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
tgttgccgtactgcttgccgacgtccttga	Protospacer
 .*.****************.****  .*.

172. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.733

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
ccgagccgtacttcgtgccggcgtcggacg	Protospacer
    ******** * ************  *

173. spacer 1.6|4238|30|NZ_AQOI01000107|CRISPRCasFinder matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 8, identity: 0.733

gatcgccgtactgcttgccggcgtcggcgg	CRISPR spacer
cgccgccgtactgcttgccggtgtactcga	Protospacer
 ..******************.**   **.

174. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagttccgccgccgacgcggccggcgcgac	Protospacer
  *..* ****************** ****..

175. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggactcccccgccgccgcggccgccgcgat	Protospacer
 . **. ** ****** *************.*

176. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aatactgccgccgccgtcgcagccgccgcggc	Protospacer
  .. *********** ***.**********.

177. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aatactgccgccgccgtcgcagccgccgcggc	Protospacer
  .. *********** ***.**********.

178. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tacggcatcgccgccgacgccgccggcgcgga	Protospacer
* **....************ **** ***** 

179. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgacgccgacgcggacgccgatgc	Protospacer
 . ******* *********** *****  *.

180. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032923 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgacgccgacgcggacgccgatgc	Protospacer
 . ******* *********** *****  *.

181. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gaccgccccgccgccgaggccgccgccgcggt	Protospacer
  * .. ********** ** ***********

182. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgctccgccgccgtcgcggccgccgccgt	Protospacer
 .* .. ********* ************ **

183. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctgcccgccgccgcccgcgcggccgccgcggc	Protospacer
.*   .********* .**************.

184. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP009405 (Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctgttgaccgccgccgatgcggccgccgcgct	Protospacer
.*    .**********.************ *

185. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggcagccgccgccgccgcggccgccgccgc	Protospacer
 . *  ********** ************ *.

186. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagttccgccgccgacgcggccggcgcgaa	Protospacer
  *..* ****************** ****. 

187. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
atcgatgccgccgccgatccggccgcgtgcct	Protospacer
 ****************. *******     *

188. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagttccgccgccgacgcggccggcgcgac	Protospacer
  *..* ****************** ****..

189. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgcgccgccgccgaagcggccgccggggc	Protospacer
 .* ..*********** ********** **.

190. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcgaactggccgaggacgcggccgccgcggt	Protospacer
  ***  . ****  *****************

191. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcgatccggccgccgacgcggccgagtggga	Protospacer
 ***** * ****************    ** 

192. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcgacgccgccgccgacgcggccggcaagcc	Protospacer
  ***.******************* *. * .

193. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctgatggccgccgccgccgcggccgccgccat	Protospacer
.* .  ********** ************ .*

194. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggctatgccgccgccgaggtggccgccgaagg	Protospacer
  * ************* *.******** .* 

195. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcgatgccgccgccgatgcgtccgcgggctc	Protospacer
 ****************.*** **** *   .

196. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagctccgccgccgacgcggccggcgcgat	Protospacer
  *... ****************** ****.*

197. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgcagccgccgccgacgcaggcgccgctga	Protospacer
 .**  **************.* ****** * 

198. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagctccgccgccgacgcggccggcgcgat	Protospacer
  *... ****************** ****.*

199. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgccgccgtcgcggcgaggccagg	Protospacer
**************** ****** .   *.* 

200. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagctccgccgccgacgcggccggcgcgat	Protospacer
  *... ****************** ****.*

201. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcgatgacgtcgccgacgcggccgtgcagga	Protospacer
.****** **.**************.   ** 

202. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgggggcgccgccggcgcggccgctgcggg	Protospacer
  **. * ********.*********.**** 

203. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP041161 (Leisingera aquaemixtae strain R2C4 plasmid unnamed7) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcgctgccgccgccgacgcgggcgatggtga	Protospacer
.*** ***************** ** .*  * 

204. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgcatccgccgccgacgcggcagcggcggg	Protospacer
  **   **************** ** **** 

205. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tacagacgcgccgacgacgcggccgacgcggt	Protospacer
* *..   ***** *********** ******

206. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgccacgccgccgccgccggggccgccgctgg	Protospacer
. * *.********** ** ********* * 

207. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcgatgacgtcgccgacgcggccgtgcagga	Protospacer
.****** **.**************.   ** 

208. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

209. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

210. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

211. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

212. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

213. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

214. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

215. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

216. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcgatggcgacgccgacgcggccgacttcgc	Protospacer
 ****** ** ************** * . *.

217. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgcgagatcgtcgccgacgcggcggccgcggc	Protospacer
. *** ..**.************ *******.

218. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

219. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

220. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcgacgccgccgacgacgcggccgtacaggg	Protospacer
 ****.******* ***********.   ** 

221. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt-	CRISPR spacer
atcgatgtcgccgccggcgcggcc-tgtcggca	Protospacer
 ******.********.******* .  ***. 

222. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccattgccgccgccgccgccgccgccgccgc	Protospacer
 .*. *********** *** ******** *.

223. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
attgccgccgccgccgccgccgccgccgccgc	Protospacer
 *.* .********** *** ******** *.

224. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

225. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtggatgccgccgcccgcgcggccgcggaagg	Protospacer
 * ************ .********* * .* 

226. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcgatgccgccgccgtcgctgccgacattga	Protospacer
.*************** *** **** *.. * 

227. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
acctttgccgccactgacgcggccgccgcttt	Protospacer
 .*  *******.*.**************  *

228. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

229. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccttgccgccgccgaggcgggcgccgccga	Protospacer
 .*  ************ **** ****** * 

230. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgtggatgccggcgacccggccgccgcggt	Protospacer
 .**  * .**** **** *************

231. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
acctttgccgctgccgacgcggcggccgcctt	Protospacer
 .*  ******.*********** *****  *

232. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgat--gccgccgccgacgcggccgccgcggt	CRISPR spacer
--caaccgctcgcggccgacgcggccgcggcggt	Protospacer
  *.*.   .*** ************** *****

233. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgacggggccgacgccct	Protospacer
 .** .************* ***** ***  *

234. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgaaaccgccgccgacgcggccgctggagc	Protospacer
 .*** .*******************.* .*.

235. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttgatttccgccgctgacgcggcagccgcgcc	Protospacer
** . * *******.******** ****** .

236. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aacaagatcgctgacgacgcggccgccgcggt	Protospacer
  *.* ..***.* ******************

237. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aacaagatcgctgacgacgcggccgccgcggt	Protospacer
  *.* ..***.* ******************

238. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgcgccgccgccgccgccgccgccgccgcagc	Protospacer
. ** .********** *** ********.*.

239. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

240. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgccgccgccgcggccgcggccgccgcgaa	Protospacer
  ** .******** * *************. 

241. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

-ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagcagtg-cgccgccgacgcggtcgcagcggc	Protospacer
   *..** **************.*** ****.

242. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt----	CRISPR spacer
gccgaggccgccgccgacgcgaccg----ggttcgg	Protospacer
 .*** ***************.***    ***    

243. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggtgccgacgccggcgcggccgccgccgg	Protospacer
   *.***** *****.************ * 

244. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MH015255 (Ruegeria phage vB_RpoS-V10, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccctgccgccgccgccgccgccgccgccct	Protospacer
 .*  *********** *** ********  *

245. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

246. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

247. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

248. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

249. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgctat	Protospacer
 .** .********** *** ******** .*

250. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tttaccgccgccgccgccgccgccgccgccgc	Protospacer
**.. .********** *** ******** *.

251. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT711975 (Streptomyces phage Alderaan, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcatggccggcgccgacgcggccgtcgccat	Protospacer
.**.  **** **************.*** .*

252. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241605 (Achromobacter phage AMA1, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cttactgccgccgccgccgccgccgccgccgc	Protospacer
.*.. *********** *** ******** *.

253. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241605 (Achromobacter phage AMA1, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

254. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

255. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgccgccgccgccgccgccgccgccgccgc	Protospacer
 .** .********** *** ******** *.

256. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to KP202969 (Achromobacter phage JWX, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcaccgccgccgccgccgccgccgccgccgc	Protospacer
.**. .********** *** ******** *.

257. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to KP202969 (Achromobacter phage JWX, complete genome) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctcaccgccgccgccgccgccgccgccgccgc	Protospacer
.**. .********** *** ******** *.

258. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccacgacggcgccgacgcgaccgccgcggc	Protospacer
 .* *.* ** **********.*********.

259. spacer 1.9|4125|29|NZ_AQOI01000107|CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 8, identity: 0.724

ggacaagcccttggtctgcgcgccgtcgg	CRISPR spacer
ctgctggcccttggtctgcgcgtcgtcaa	Protospacer
  .* .****************.****..

260. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

261. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

262. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

263. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

264. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

265. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

266. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

267. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

268. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgacgaccgtcgtactgcttgccggcgg	Protospacer
 .   **.**.***************** 

269. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

270. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcacaggtcgacgtactgcttgccggtca	Protospacer
 . ***.*** ***************.  

271. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

272. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

273. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

274. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

275. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

276. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

277. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

278. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

279. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

280. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

281. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

282. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP021115 (Rhodobacteraceae bacterium strain G7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
aaaaagatcgccgtcctgcttggcggccg	Protospacer
    ********** ******* ****  

283. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

284. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gcgctacgcgccgtactgcatgccggcgt	Protospacer
 . * .  *********** *********

285. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
gagaacgccgccgtactgcttgccggtgt	Protospacer
    * ..******************.**

286. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to AB451219 (Ralstonia phage RSB1 DNA, complete genome) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
acggcgatcaccgtgctgcttgccggcgc	Protospacer
 .   ****.****.*************.

287. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NC_011201 (Ralstonia phage RSB1, complete genome) position: , mismatch: 8, identity: 0.724

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
acggcgatcaccgtgctgcttgccggcgc	Protospacer
 .   ****.****.*************.

288. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
gagctccgccgatccggccgccgcggtcgagtc	Protospacer
 . * *******. ****************   

289. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cgccgccgccgccgcggccgcggcggcttcctg	Protospacer
.********** ********* ****..  * .

290. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
agccgccgccgccgccgccgccgcgggctggcc	Protospacer
 ********** *** ********** * .   

291. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
gctcgcggccgacgcggccgcggcggtcctccg	Protospacer
  .*** ************** ******  * .

292. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP023453 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ggctgccgccgaggcggccgccgcgcgtctcgc	Protospacer
 **.******** ************  .  ** 

293. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP023453 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
ggctgccgccgaggcggccgccgcgcgtctcgc	Protospacer
 **.******** ************  .  ** 

294. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cctgcccgccgacgcggtcgccggggtcgtcaa	Protospacer
. .  ************.***** ***** *.*

295. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
ccaagccggcgacctgttcgcgctcgccgccaa	Protospacer
. .*.************ ***********  ..

296. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to MH976511 (Gordonia phage Gaea, complete genome) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
gatcatcggcgacctgttcgcgcgcgccgagtt	Protospacer
 .  *.*********** ***** *******  

297. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to MH450129 (Gordonia phage Ribeye, complete genome) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
gatcatcggcgacctgttcgcgcgcgccgagtt	Protospacer
 .  *.*********** ***** *******  

298. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to MT723941 (Gordonia phage YorkOnyx, complete genome) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
gatcatcggcgacctgttcgcgcgcgccgagtt	Protospacer
 .  *.*********** ***** *******  

299. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
cgccgagggcgacctgtccgcgctccccgagtg	Protospacer
.*  .  ********** ******* ***** *

300. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to KY092480 (Streptomyces phage Picard, complete genome) position: , mismatch: 9, identity: 0.727

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
cgccgagggcgacctgtccgcgctccccgagtg	Protospacer
.*  .  ********** ******* ***** *

301. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
caataatggtctgcgcgccatcgccgaccg	Protospacer
 . .  *************.*** ***** 

302. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
tctccttggtcagcgcgccgtcggtgtgta	Protospacer
  .******** ************.*  . 

303. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gagtgatggtctgcgcggcgtcggcgagcg	Protospacer
.. .  *********** ********* * 

304. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
caataatggtctgcgcgccatcgccgaccg	Protospacer
 . .  *************.*** ***** 

305. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
caataatggtctgcgcgccatcgccgaccg	Protospacer
 . .  *************.*** ***** 

306. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
taataatggtctgcgcgccatcgccgaccg	Protospacer
 . .  *************.*** ***** 

307. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gatgctgggtctgcgccccgtcggcgatag	Protospacer
... ** ********* **********.  

308. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccgatgccggcgccgccgcggccgcgatgag	Protospacer
 .******** ***** ********* ..*. 

309. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

310. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

311. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

312. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgccgccgccgcggcagcaaaggc	Protospacer
 . ************* ****** ** . **.

313. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

314. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

315. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

316. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

317. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

318. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgccgccgccgcggcagcaaaggc	Protospacer
 . ************* ****** ** . **.

319. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

320. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

321. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LN868941 (Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcactggcccccgacgacgcggccgccgcggc	Protospacer
 .    *** *** *****************.

322. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcgatgccgccgccgtcgcgggcgaaggctt	Protospacer
  ************** ***** **  *   *

323. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccggtgccgccgcggacgcggccgggcaggg	Protospacer
 .**.********* **********    ** 

324. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP031419 (Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcactggcccccgacgacgcggccgccgcggc	Protospacer
 .    *** *** *****************.

325. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
acgtatgccgaccccgacgcggccgccgcacg	Protospacer
 .  ****** * ****************.  

326. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

327. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accaccaccgacgtcgacgcggccgccgcggc	Protospacer
 .*. ..*** **.*****************.

328. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
caccacgccgccgccgaccaggccgccgccca	Protospacer
. * *.************  *********   

329. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
agcgtcaccgccaccggcgcggccgccgcgaa	Protospacer
  ** ..*****.***.*************. 

330. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aacgatgccgccgccggcgcgggcgacctcct	Protospacer
  **************.***** ** * .  *

331. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcatcgcagccgccgacgcggccgccgcttc	Protospacer
  *. .** ********************  .

332. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgatgccgccgccgccgcgggcgtgaacgt	Protospacer
  ************** ***** **. .  **

333. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggtcgccgccgccgaggaggccgccgccgc	Protospacer
 . * .*********** * ********* *.

334. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

335. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgccgccgccgcggcagcaaaggc	Protospacer
 . ************* ****** ** . **.

336. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtattcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

337. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggatgccgccgccgccgcggcagcaaaggc	Protospacer
 . ************* ****** ** . **.

338. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gtcaatgccgccgccgacgcgaccgcgagatc	Protospacer
 **.*****************.**** . . .

339. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023453 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gaggcggctgccgccgaggcggccgccgcgcg	Protospacer
   *  **.******** ************  

340. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023453 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgagcggctgccgccgaggcggccgccgcgcg	Protospacer
.  *  **.******** ************  

341. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
agggagttcgccgccgccgcggcggccgcggc	Protospacer
   **  .******** ****** *******.

342. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

343. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgccgccgctgcggccatgaagta	Protospacer
**************** .******.. . *  

344. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
atgaccgccgccgccgtcgccgccgccgcgta	Protospacer
 * . .********** *** *********  

345. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
tcggccgccgtcgccgacccggccgccgcctg	Protospacer
*. * .****.******* **********   

346. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

347. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgccaccgaggcggccattcgcgc	Protospacer
************.**** ******...   *.

348. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

349. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

350. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

351. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggccaccgccgccgacgccaccgccgcggc	Protospacer
 . * ..************* .*********.

352. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgtcccgccgccgccgccgccgccgccgccgc---	Protospacer
   ..** .********** *** ********   

353. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

354. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgcgccgccgccgaagccgccgccgccga	Protospacer
 .* ..*********** ** ******** * 

355. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgaaggacgccgccgacgcggcggtcgcggc	Protospacer
 . .* * *************** *.*****.

356. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

357. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgatgccgctgccgatgcggccggactggg	Protospacer
  *********.*****.*******   .** 

358. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

359. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

360. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

361. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---gccgccgccgccgccgccgccgccgccgcccg	Protospacer
   * .********** *** ******** *.   

362. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gccaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

363. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

364. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cccgtcgccgccgccgccgccgccgccgccaa	Protospacer
..** .********** *** ******** . 

365. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

366. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

367. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtgttcgccaccgacgcggccgtcgcggc	Protospacer
.* *   .****.************.*****.

368. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

369. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

370. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

371. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

372. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

373. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

374. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

375. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

376. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP011276 (Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
atatttgccgccgccgccgccgccgccgccga---	Protospacer
   **.* .********** *** *******    

377. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

378. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

379. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

380. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

381. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgccaccgaggcggccattcgcgc	Protospacer
************.**** ******...   *.

382. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

383. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

384. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgcgcgccgccgccgccgccgccgccgccgc---	Protospacer
   . ** .********** *** ********   

385. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

386. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

387. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

388. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ggcattgccgccgccgccgaggccgccgacga	Protospacer
  *. *********** ** ********  * 

389. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cccgtgaacgccgcccacgcggccgacgcgga	Protospacer
..**  . ******* ********* ***** 

390. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ccggtcaccgccgccgacgcggtcaccgcggc	Protospacer
.. * ..***************.*.******.

391. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241607 (Achromobacter phage AMA2, complete genome) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
acgaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

392. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MH746817 (Achromobacter phage vB_Ade_ART, complete genome) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctaaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

393. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MN304824 (Catenulispora phage 69_17, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagaaggccgccgccgatgccgccgccgcgca	Protospacer
   .* ***********.** *********  

394. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MT241605 (Achromobacter phage AMA1, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---actgccgccgccgccgccgccgccgccgccgc	Protospacer
   . *********** *** ******** *.   

395. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctaaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

396. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggccgacgcggccgacgcggccgacgcggc	Protospacer
 . * .* *** ************* *****.

397. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggccgacgcggccgacgcggccgacgcggc	Protospacer
 . * .* *** ************* *****.

398. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MH669007 (Gordonia phage Marietta, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggccgacgcggccgacgcggccgacgcggc	Protospacer
 . * .* *** ************* *****.

399. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MH669007 (Gordonia phage Marietta, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcggccgacgcggccgacgcggccgacgcggc	Protospacer
 . * .* *** ************* *****.

400. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK327944 (Escherichia phage vB_EcoM_G2540-3, complete genome) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cctgttgccgccgccgccgccgccgccgcctc	Protospacer
...* *********** *** ********  .

401. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacgatgccgccgccggcgcgggcgacctcct	Protospacer
  **************.***** ** * .  *

402. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgggagacgtcgccgacgcggccgccgagga	Protospacer
 . *. * **.***************** ** 

403. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ctggtacttgccgccgacgcggtcgccgccgt	Protospacer
.* *   ..*************.****** **

404. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

405. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accgccgccgccgccgccgccgccgccgccac	Protospacer
 .** .********** *** ******** ..

406. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

----ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagctcc----ccggcggcgacgcggccgccgcgcg	Protospacer
    *.*    *** ** ****************  

407. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

----ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagctcc----ccggcggcgacgcggccgccgcgcg	Protospacer
    *.*    *** ** ****************  

408. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP027026 (Streptomyces sp. WAC00288 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

----ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagctcc----ccggcggcgacgcggccgccgcgcg	Protospacer
    *.*    *** ** ****************  

409. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cccgttgccgccgccgacgaggccgaccccag	Protospacer
..** ************** ***** * * . 

410. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gggggtgccgacgccgacgcgggcgccgtcat	Protospacer
   *.***** *********** *****. .*

411. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accgccgccgccgccgccgccgccgccgccac	Protospacer
 .** .********** *** ******** ..

412. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 9, identity: 0.719

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
accaccgccgccgccgccgccgccgccgccgc---	Protospacer
    .** .********** *** ********   

413. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---ggcgccgccgccgccgccgccgccgccgccgg	Protospacer
   *..********** *** ******** *.   

414. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.719

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---ggtggcgccgccgccgccgccgccgccgccgc	Protospacer
   *.** ******** *** ******** *.   

415. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 9, identity: 0.69

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
cgatgcgtcgccgtgctgcttgccggcga	Protospacer
.  .. .*******.************* 

416. spacer 1.11|4233|29|NZ_AQOI01000107|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.69

ttccagatcgccgtactgcttgccggcgt	CRISPR spacer
cgatgcgtcgccgtgctgcttgccggcga	Protospacer
.  .. .*******.************* 

417. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 10, identity: 0.697

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
caccgccgccgacgcggtcaccgcggcgaccct	Protospacer
..***************.*.******. . *  

418. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.697

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
cgccgccgccgtcgccgccgccgcgtatctcct	Protospacer
.********** *** *********  .  *  

419. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.697

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
cgccgccggcggcctgggcgcgctcgccgccat	Protospacer
.*  .******.**** ************  . 

420. spacer 1.4|4130|30|NZ_AQOI01000107|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 10, identity: 0.667

agcccttggtctgcgcgccgtcggcgacct	CRISPR spacer
gctggccggtctgcgcgccgtcgccgacgg	Protospacer
. .  ..**************** ****  

421. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---gaatccgccgccgccgaagccgccgccgcccg	Protospacer
   **  ********* ** .******** *.   

422. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gacagctccgccgccgacacggccggcgcgaa	Protospacer
  *... ***********.****** ****. 

423. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagggggccgccgccgacatggccgccgccca	Protospacer
   *. ************..*********   

424. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---gccaccgccgccgccgccgccgccgccgccgg	Protospacer
   * ..********* *** ******** *.   

425. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cacgatgccgccgccgaagctgccgaaatgca	Protospacer
. *************** ** ****  ..*  

426. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
caggtcgccgccgacgacgaggccgccgcctc	Protospacer
.  * .******* ***** *********  .

427. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
acgatcggcgccgccgccgcggctgccgcggc	Protospacer
 . . .* ******** ******.*******.

428. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gaccgcgccgccgccgacgccgcagccgccgc---	Protospacer
   . ** .******* ** ***.********   

429. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 10, identity: 0.688

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcctcgaacgccgccgccgccgccgccgcggc---	Protospacer
   *. .*.********** *** ***** **   

430. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccggaacgccgcggacgcggtcgccgcggc	Protospacer
 .* . . ****** *******.********.

431. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cacgatgccgccgccttcgcggccgaagaccc	Protospacer
. *************  ********  *   .

432. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgcgcccggccgccgaggtggccgccgcggt	Protospacer
 .  .. * ******** *.************

433. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
caggaggacgccgccgacgcggccgcactgta	Protospacer
.  ** * ******************  .*  

434. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cacgatgccgccgccgaagctgccgaaatgca	Protospacer
. *************** ** ****  ..*  

435. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gagcgcgccgacgccgacgcggccgcggccgc	Protospacer
    ..**** *************** ** *.

436. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgtgccgccgccgccgccgccgccggcca	Protospacer
 .* .*********** *** *******    

437. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
aagcgggccgccgccgaggcggccaccgcgtg	Protospacer
    . *********** ******.*****  

438. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---accgccgccgccgccgccgccgccgccgccca	Protospacer
   . .********** *** ******** *.   

439. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP039906 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623b, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gatgatgccgccgccgaccgggccgccaaata	Protospacer
  .***************  *******. .  

440. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgtgccgccgccgccgccgccgccggcca	Protospacer
 .* .*********** *** *******    

441. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
catcgcgccgccgacgatgcggccgccgcgtc	Protospacer
. . ..******* ***.************ .

442. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to MK801723 (Gordonia phage Coeur, complete genome) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgatcgccgccgccggcccggccgccgcgac	Protospacer
 . . .**********.* ***********..

443. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cagctcaccgccgccgaggccgccgccgcgct	Protospacer
.    ..********** ** ********* *

444. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ttcgatgccgccaccgaggcggctattcgcgc	Protospacer
************.**** *****....   *.

445. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcccgccccgccgccgccgcgcccgccgcgtg	Protospacer
 .* .. ********* **** ********  

446. spacer 1.2|4016|33|NZ_AQOI01000107|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.667

tgccgccgccgacgcggccgccgcggtcgacga	CRISPR spacer
actggccgaggacgcggccgccgcggtcctgtt	Protospacer
  . ****  ******************     

447. spacer 1.3|4073|33|NZ_AQOI01000107|CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.667

tggaaccggcgacctgtgcgcgctcgccgaggg	CRISPR spacer
cctcgcccgccacctgtgcgcgctcgccgcccc	Protospacer
.   .** ** ******************    

448. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
agctttgccgccgccgccgccgccgccgcttt---	Protospacer
   **.* .********** *** *****. .   

449. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
ccgccggccgccgccgccgcggccaccgcctg	Protospacer
..    ********** *******.****   

450. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 11, identity: 0.656

ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
cgggatgcggcggccgacgcggccgcaagcca	Protospacer
.  ***** ** ************** .    

451. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to JN698994 (Mycobacterium phage DS6A, complete genome) position: , mismatch: 11, identity: 0.656

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---aaaaccgccgccgccggcgccgccgccgcccg	Protospacer
   .* .********* **  ******** *.   

452. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 12, identity: 0.625

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---ggtgctgccgccgccgacggtgccgccggccg	Protospacer
   *.***.******* **  * .***** *    

453. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.625

---ttcgatgccgccgccgacgcggccgccgcggt	CRISPR spacer
gcgctggccgacgccgacgcggcggccgccac---	Protospacer
   .* * .* ***** **  *********.*   

454. spacer 1.7|4011|32|NZ_AQOI01000107|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 12, identity: 0.625

ttcgatgccgccgccgacgcggccgccgcggt---	CRISPR spacer
---gagacggccgccgccgccgcggtcgccgccca	Protospacer
   ** .* ******* *** ** *.*** *.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_AQOI01000198
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AQOI01000198_1 5-429 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AQOI01000198_1 1.1|36|36|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 36-71 36 NZ_AQOI01000586.1 7511-7546 1 0.972

1. spacer 1.1|36|36|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to position: 7511-7546, mismatch: 1, identity: 0.972

cgcctcgatgctgtatctggtcacgcgcgccaagaa	CRISPR spacer
cgccgcgatgctgtatctggtcacgcgcgccaagaa	Protospacer
**** *******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 608222-608255 6 0.824
NZ_AQOI01000198_1 1.3|167|35|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 167-201 35 NZ_CP021994 Cryobacterium sp. LW097 plasmid unnamed1 138116-138150 7 0.8
NZ_AQOI01000198_1 1.2|103|33|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 103-135 33 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 480286-480318 8 0.758
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 281774-281807 9 0.735
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1422043-1422076 9 0.735
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1026132-1026165 9 0.735
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 893675-893708 9 0.735
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 526722-526755 9 0.735
NZ_AQOI01000198_1 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT 233-266 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 429851-429884 9 0.735

1. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.824

aagctcgcgacgccgaatgcgcagctgtccgagc--	CRISPR spacer
ccgctcgcgccgccgaatgcgcatctg--cgagctg	Protospacer
  ******* ************* ***  *****  

2. spacer 1.3|167|35|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021994 (Cryobacterium sp. LW097 plasmid unnamed1) position: , mismatch: 7, identity: 0.8

aatgagccg---cacagcgccgtgcgcgcctgcatcct	CRISPR spacer
---gagctgtttcacagcgtcgagcgcgcctgcatccg	Protospacer
   ****.*   *******.** ************** 

3. spacer 1.2|103|33|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.758

ttgcgcgccttctcgacgccgctcgcccacttg	CRISPR spacer
atccgcgccttctcgaagacgctcgccagccgg	Protospacer
 * ************* * ******** .*. *

4. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

5. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

6. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

7. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

8. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

9. spacer 1.4|233|34|NZ_AQOI01000198|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

aagctcgcgacgccgaatgcgcagctgtccgagc	CRISPR spacer
acggcggtgaagccgaatgcgcagctgaccgact	Protospacer
* * . *.** **************** **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage