Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ANEC01000024 Streptococcus agalactiae BSU260 ctg120000807549, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000025 Streptococcus agalactiae BSU260 ctg120000807550, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANEC01000019 Streptococcus agalactiae BSU260 ctg120000807544, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000031 Streptococcus agalactiae BSU260 ctg120000807556, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000015 Streptococcus agalactiae BSU260 ctg120000807540, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ANEC01000005 Streptococcus agalactiae BSU260 ctg120000807530, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000004 Streptococcus agalactiae BSU260 ctg120000807529, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000029 Streptococcus agalactiae BSU260 ctg120000807554, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2,csn2 0 7 1 0
NZ_ANEC01000026 Streptococcus agalactiae BSU260 ctg120000807551, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000022 Streptococcus agalactiae BSU260 ctg120000807547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000012 Streptococcus agalactiae BSU260 ctg120000807537, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000010 Streptococcus agalactiae BSU260 ctg120000807535, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000020 Streptococcus agalactiae BSU260 ctg120000807545, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANEC01000009 Streptococcus agalactiae BSU260 ctg120000807534, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000011 Streptococcus agalactiae BSU260 ctg120000807536, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000027 Streptococcus agalactiae BSU260 ctg120000807552, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANEC01000001 Streptococcus agalactiae BSU260 ctg120000807526, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000014 Streptococcus agalactiae BSU260 ctg120000807539, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_ANEC01000008 Streptococcus agalactiae BSU260 ctg120000807533, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANEC01000003 Streptococcus agalactiae BSU260 ctg120000807528, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000028 Streptococcus agalactiae BSU260 ctg120000807553, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_ANEC01000007 Streptococcus agalactiae BSU260 ctg120000807532, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ANEC01000030 Streptococcus agalactiae BSU260 ctg120000807555, whole genome shotgun sequence 1 crisprs NA 4 3 2 0
NZ_ANEC01000006 Streptococcus agalactiae BSU260 ctg120000807531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000017 Streptococcus agalactiae BSU260 ctg120000807542, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000016 Streptococcus agalactiae BSU260 ctg120000807541, whole genome shotgun sequence 0 crisprs cas3,csa3 0 0 1 0
NZ_ANEC01000021 Streptococcus agalactiae BSU260 ctg120000807546, whole genome shotgun sequence 1 crisprs csm6 0 0 1 0
NZ_ANEC01000013 Streptococcus agalactiae BSU260 ctg120000807538, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000018 Streptococcus agalactiae BSU260 ctg120000807543, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000002 Streptococcus agalactiae BSU260 ctg120000807527, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANEC01000023 Streptococcus agalactiae BSU260 ctg120000807548, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ANEC01000029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANEC01000029_1 263663-264097 TypeII II-A
6 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448736 Streptococcus phage Javan35, complete genome 6769-6794 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448956 Streptococcus phage Javan48, complete genome 8657-8682 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448781 Streptococcus phage Javan5, complete genome 6769-6794 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448749 Streptococcus phage Javan39, complete genome 8657-8682 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448938 Streptococcus phage Javan44, complete genome 6769-6794 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448911 Streptococcus phage Javan34, complete genome 6769-6794 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 MK448916 Streptococcus phage Javan36, complete genome 6769-6794 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448736 Streptococcus phage Javan35, complete genome 6766-6795 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448956 Streptococcus phage Javan48, complete genome 8654-8683 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448781 Streptococcus phage Javan5, complete genome 6766-6795 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448749 Streptococcus phage Javan39, complete genome 8654-8683 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448938 Streptococcus phage Javan44, complete genome 6766-6795 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448911 Streptococcus phage Javan34, complete genome 6766-6795 0 1.0
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK448916 Streptococcus phage Javan36, complete genome 6766-6795 0 1.0
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 MK448971 Streptococcus phage Javan52, complete genome 19451-19480 0 1.0
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 MK448956 Streptococcus phage Javan48, complete genome 18107-18136 0 1.0
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 MK448851 Streptococcus phage Javan14, complete genome 18773-18802 0 1.0
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448749 Streptococcus phage Javan39, complete genome 20005-20034 0 1.0
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MH853356 Streptococcus phage LF2, partial genome 43016-43045 0 1.0
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448749 Streptococcus phage Javan39, complete genome 20005-20033 0 1.0
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MH853356 Streptococcus phage LF2, partial genome 43017-43045 0 1.0
NZ_ANEC01000029_1 1.1|263703|26|NZ_ANEC01000029|PILER-CR 263703-263728 26 JX409894 Streptococcus phage LYGO9, complete genome 41612-41637 2 0.923
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 JX409894 Streptococcus phage LYGO9, complete genome 41611-41640 2 0.933
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448859 Streptococcus phage Javan170, complete genome 20220-20248 2 0.931
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448690 Streptococcus phage Javan169, complete genome 20578-20606 2 0.931
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448850 Streptococcus phage Javan132, complete genome 19807-19835 2 0.931
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448676 Streptococcus phage Javan131, complete genome 22730-22758 2 0.931
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448688 Streptococcus phage Javan161, complete genome 20173-20201 2 0.931
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448859 Streptococcus phage Javan170, complete genome 20220-20249 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448690 Streptococcus phage Javan169, complete genome 20578-20607 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448850 Streptococcus phage Javan132, complete genome 19807-19836 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448676 Streptococcus phage Javan131, complete genome 22730-22759 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448688 Streptococcus phage Javan161, complete genome 20173-20202 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448973 Streptococcus phage Javan522, complete genome 19671-19700 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448955 Streptococcus phage Javan478, complete genome 21048-21077 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448778 Streptococcus phage Javan493, complete genome 19213-19242 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448962 Streptococcus phage Javan496, complete genome 9204-9233 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448975 Streptococcus phage Javan526, complete genome 19995-20024 3 0.9
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448782 Streptococcus phage Javan501, complete genome 22353-22382 3 0.9
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448973 Streptococcus phage Javan522, complete genome 19671-19699 3 0.897
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448955 Streptococcus phage Javan478, complete genome 21048-21076 3 0.897
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448778 Streptococcus phage Javan493, complete genome 19213-19241 3 0.897
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448962 Streptococcus phage Javan496, complete genome 9204-9232 3 0.897
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448975 Streptococcus phage Javan526, complete genome 19995-20023 3 0.897
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448782 Streptococcus phage Javan501, complete genome 22353-22381 3 0.897
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 JX409894 Streptococcus phage LYGO9, complete genome 28656-28685 4 0.867
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 MK448675 Streptococcus phage Javan129, complete genome 20470-20499 4 0.867
NZ_ANEC01000029_1 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263966-263995 30 JX409895 Streptococcus phage JX01, complete genome 40503-40532 4 0.867
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 KC465899 Pelagibacter phage HTVC008M, complete genome 125202-125231 4 0.867
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 JX409894 Streptococcus phage LYGO9, complete genome 28657-28685 4 0.862
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 MK448675 Streptococcus phage Javan129, complete genome 20470-20498 4 0.862
NZ_ANEC01000029_1 1.9|263966|29|NZ_ANEC01000029|PILER-CR 263966-263994 29 JX409895 Streptococcus phage JX01, complete genome 40504-40532 4 0.862
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 5261-5289 5 0.828
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 45542-45570 5 0.828
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 51741-51769 5 0.828
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 51741-51769 5 0.828
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP035396 Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence 5260-5289 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP032856 Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence 45542-45571 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_MG557999 Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence 51740-51769 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_MF497781 Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence 51740-51769 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MT074138 Bacteroides phage DAC17, complete genome 95749-95778 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MT074136 Bacteroides phage DAC15, complete genome 96339-96368 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 15565-15594 6 0.8
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 AP014166 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS *** 5438-5467 6 0.8
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 42924-42952 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 8594-8622 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 682-710 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 16676-16704 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 19259-19287 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 5957-5985 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 7884-7912 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 27843-27871 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 16878-16906 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 326-354 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 31253-31281 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 14731-14759 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 21719-21747 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 31777-31805 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 16676-16704 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 33043-33071 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 682-710 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 7491-7519 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 55790-55818 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 107898-107926 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MT074138 Bacteroides phage DAC17, complete genome 95750-95778 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MT074136 Bacteroides phage DAC15, complete genome 96340-96368 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MN693256 Marine virus AFVG_25M339, complete genome 27548-27576 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MN855807 Siphoviridae sp. isolate 122, partial genome 13518-13546 6 0.793
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 FJ429185 Lactococcus phage P087, complete genome 18714-18742 6 0.793
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MG983840 Escherichia phage myPSH1131, complete genome 41563-41592 7 0.767
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MK373770 Escherichia phage vB_EcoP_WFI101126, complete genome 40651-40680 7 0.767
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MT446410 UNVERIFIED: Escherichia virus TH38, complete genome 54041-54070 7 0.767
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 NC_027395 Phage vB_EcoP_SU10, complete genome 42976-43005 7 0.767
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 MT446386 UNVERIFIED: Escherichia virus TH06, complete genome 5460-5489 7 0.767
NZ_ANEC01000029_1 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263699-263728 30 KP308307 Escherichia phage 172-1, complete genome 51406-51435 7 0.767
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NC_017073 Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC3, complete sequence 64611-64640 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_KR091915 Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence 42923-42952 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP025915 Escherichia coli strain 203740 plasmid p203740_35, complete sequence 8594-8623 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_LS999564 Escherichia coli isolate EC-TO143 plasmid 5, complete sequence 682-711 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_LN824136 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671 16675-16704 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP054370 Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence 19258-19287 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP006640 Escherichia coli PCN061 plasmid PCN061p4, complete sequence 5957-5986 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP029801 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence 7884-7913 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP015505 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence 27842-27871 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP026060 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence 16877-16906 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP024853 Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence 326-355 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_LT985287 Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence 31253-31282 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 14730-14759 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP027258 Escherichia coli strain EC11 plasmid unnamed3, complete sequence 21718-21747 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP019200 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence 31777-31806 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP023823 Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence 16675-16704 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP026025 Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence 33042-33071 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP018988 Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence 682-711 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_MK033500 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence 7491-7520 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_MK033501 Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence 55790-55819 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_MK033499 Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence 107898-107927 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MN693256 Marine virus AFVG_25M339, complete genome 27548-27577 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_LR215001 Mycoplasma conjunctivae strain NCTC10147 plasmid 5 7233-7262 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MN855807 Siphoviridae sp. isolate 122, partial genome 13518-13547 7 0.767
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 FJ429185 Lactococcus phage P087, complete genome 18714-18743 7 0.767
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP012103 Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence 20110-20138 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP009352 Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence 2297-2325 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NC_004952 Francisella novicida plasmid pFNL10, complete sequence 111-139 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NC_002109 Francisella tularensis plasmid pOM1, complete sequence 111-139 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 LC494302 Escherichia phage SP27 DNA, complete genome 245480-245508 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 230964-230992 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NC_027364 Escherichia phage PBECO 4, complete genome 39409-39437 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MH383160 Escherichia phage UB, complete genome 99996-100024 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MK327931 Escherichia phage vB_EcoM_G17, complete genome 256258-256286 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MK448636 Streptococcus satellite phage Javan749, complete genome 10387-10415 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 MN693101 Marine virus AFVG_25M559, complete genome 25634-25662 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 KT725776 Bacillus phage vB_BceS-MY192, partial genome 2349-2377 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 187103-187131 7 0.759
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 KM507819 Escherichia phage 121Q, complete genome 246579-246607 7 0.759
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 182880-182909 8 0.733
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NZ_CP043832 Bacillus sp. BS98 plasmid unnamed2 71255-71284 8 0.733
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NZ_CP020434 Bacillus sp. FDAARGOS_235 plasmid 1, complete sequence 216274-216303 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 70939-70968 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP012103 Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence 20110-20139 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_LR214953 Mycoplasma neurolyticum strain NCTC10166 plasmid 3 5510-5539 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP009352 Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence 2297-2326 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NZ_CP051681 Cohnella sp. MFER-1 plasmid unnamed1 74376-74405 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NC_004952 Francisella novicida plasmid pFNL10, complete sequence 110-139 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NC_002109 Francisella tularensis plasmid pOM1, complete sequence 110-139 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 LC494302 Escherichia phage SP27 DNA, complete genome 245480-245509 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 230963-230992 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 NC_027364 Escherichia phage PBECO 4, complete genome 39408-39437 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MH383160 Escherichia phage UB, complete genome 99995-100024 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MK327931 Escherichia phage vB_EcoM_G17, complete genome 256257-256286 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MN871445 UNVERIFIED: Serratia phage KpHz_2, complete genome 75797-75826 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MK448636 Streptococcus satellite phage Javan749, complete genome 10387-10416 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MN871444 UNVERIFIED: Serratia phage KpGz_1, complete genome 13324-13353 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 MN693101 Marine virus AFVG_25M559, complete genome 25633-25662 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 KT725776 Bacillus phage vB_BceS-MY192, partial genome 2349-2378 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 187103-187132 8 0.733
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 KM507819 Escherichia phage 121Q, complete genome 246579-246608 8 0.733
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP046030 Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence 15565-15593 8 0.724
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 NZ_CP051681 Cohnella sp. MFER-1 plasmid unnamed1 74377-74405 8 0.724
NZ_ANEC01000029_1 1.10|264032|29|NZ_ANEC01000029|PILER-CR 264032-264060 29 HQ683709 Planktothrix phage PaV-LD, complete genome 72162-72190 8 0.724
NZ_ANEC01000029_1 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 264032-264061 30 HQ683709 Planktothrix phage PaV-LD, complete genome 72162-72191 9 0.7
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NZ_CP009636 Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence 189787-189816 10 0.667
NZ_ANEC01000029_1 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT 263831-263860 30 NZ_CP053962 Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence 15230-15259 10 0.667

1. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

2. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

3. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

4. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

5. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

6. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

7. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

tgttatctgccattcaatactcctta	CRISPR spacer
tgttatctgccattcaatactcctta	Protospacer
**************************

8. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

9. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

10. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

11. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

12. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

13. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

14. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttgttatctgccattcaatactccttaaaa	Protospacer
******************************

15. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aaaatcatctttattgactgtttttccttc	Protospacer
******************************

16. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aaaatcatctttattgactgtttttccttc	Protospacer
******************************

17. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 0, identity: 1.0

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aaaatcatctttattgactgtttttccttc	Protospacer
******************************

18. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagtcgttatgatggatgactat	Protospacer
******************************

19. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagtcgttatgatggatgactat	Protospacer
******************************

20. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagtcgttatgatggatgacta	Protospacer
*****************************

21. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagtcgttatgatggatgacta	Protospacer
*****************************

22. spacer 1.1|263703|26|NZ_ANEC01000029|PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.923

tgttatctgccattcaatactcctta	CRISPR spacer
tattgtctgccattcaatactcctta	Protospacer
*.**.*********************

23. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 2, identity: 0.933

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
ttattgtctgccattcaatactccttaaaa	Protospacer
**.**.************************

24. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 2, identity: 0.931

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgacta	Protospacer
***********..****************

25. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 2, identity: 0.931

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgacta	Protospacer
***********..****************

26. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 2, identity: 0.931

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgacta	Protospacer
***********..****************

27. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.931

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgacta	Protospacer
***********..****************

28. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 2, identity: 0.931

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgacta	Protospacer
***********..****************

29. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgactac	Protospacer
***********..****************.

30. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgactac	Protospacer
***********..****************.

31. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgactac	Protospacer
***********..****************.

32. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgactac	Protospacer
***********..****************.

33. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgactac	Protospacer
***********..****************.

34. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

35. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

36. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

37. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

38. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

39. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 3, identity: 0.9

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttgttatgatggatgatttt	Protospacer
***********.**************.* *

40. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

41. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

42. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

43. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448962 (Streptococcus phage Javan496, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

44. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448975 (Streptococcus phage Javan526, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

45. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448782 (Streptococcus phage Javan501, complete genome) position: , mismatch: 3, identity: 0.897

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttgttatgatggatgattt	Protospacer
***********.**************.* 

46. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 4, identity: 0.867

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgatttt	Protospacer
***********..*************.* *

47. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 4, identity: 0.867

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgatttt	Protospacer
***********..*************.* *

48. spacer 1.7|263966|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 4, identity: 0.867

atcacaccagtcgttatgatggatgactat	CRISPR spacer
atcacaccagttattatgatggatgatttt	Protospacer
***********..*************.* *

49. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 4, identity: 0.867

-gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tgaatat-aaagattttaaaaaagtagattt	Protospacer
 ***.** **************** * ****

50. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 4, identity: 0.862

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgattt	Protospacer
***********..*************.* 

51. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 4, identity: 0.862

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgattt	Protospacer
***********..*************.* 

52. spacer 1.9|263966|29|NZ_ANEC01000029|PILER-CR matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 4, identity: 0.862

atcacaccagtcgttatgatggatgacta	CRISPR spacer
atcacaccagttattatgatggatgattt	Protospacer
***********..*************.* 

53. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
acacatgaatgattttaaaaaagaacttg	Protospacer
. ******* **************** * 

54. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
acacatgaatgattttaaaaaagaacttg	Protospacer
. ******* **************** * 

55. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 5, identity: 0.828

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagattttaaaaaagaacctt	Protospacer
*.. .********************* **

56. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 5, identity: 0.828

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagattttaaaaaagaacctt	Protospacer
*.. .********************* **

57. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
acacatgaatgattttaaaaaagaacttgg	Protospacer
. ******* **************** *  

58. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP032856 (Bacillus subtilis subsp. subtilis strain PJ-7 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
acacatgaatgattttaaaaaagaacttgg	Protospacer
. ******* **************** *  

59. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagattttaaaaaagaaccttc	Protospacer
*.. .********************* **.

60. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagattttaaaaaagaaccttc	Protospacer
*.. .********************* **.

61. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
aacaatgcaagactttaaaaaagaacatat	Protospacer
.*  *** ****.*************** *

62. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
aacaatgcaagactttaaaaaagaacatat	Protospacer
.*  *** ****.*************** *

63. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt---	CRISPR spacer
caccatgaaagattttagaaaag---atttagc	Protospacer
 * **************.*****   ****   

64. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to AP014166 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C61-MedDCM-OCT-S46-C82, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
taaagttaaagattctaaaaaagaagattt	Protospacer
 ** .* *******.********** ****

65. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

66. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

67. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

68. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

69. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

70. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

71. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

72. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

73. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

74. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

75. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

76. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

77. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

78. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

79. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

80. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

81. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

82. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

83. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

84. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gggggtgaaagatttcaaaaaagaacctt	Protospacer
*.. .**********.********** **

85. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
aacaatgcaagactttaaaaaagaacata	Protospacer
.*  *** ****.*************** 

86. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
aacaatgcaagactttaaaaaagaacata	Protospacer
.*  *** ****.*************** 

87. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MN693256 (Marine virus AFVG_25M339, complete genome) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
cagcatgaaagatttaaaaaaagaagaag	Protospacer
 *.************ ********* *  

88. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
caccatgaaagatattaaaaaagattact	Protospacer
 * ********** ********** .*.*

89. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 6, identity: 0.793

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
caccatgaaagatattaaaaaagattact	Protospacer
 * ********** ********** .*.*

90. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MG983840 (Escherichia phage myPSH1131, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

91. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK373770 (Escherichia phage vB_EcoP_WFI101126, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

92. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MT446410 (UNVERIFIED: Escherichia virus TH38, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

93. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NC_027395 (Phage vB_EcoP_SU10, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

94. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MT446386 (UNVERIFIED: Escherichia virus TH06, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

95. spacer 1.3|263699|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to KP308307 (Escherichia phage 172-1, complete genome) position: , mismatch: 7, identity: 0.767

ttgttatctgccattcaatactccttaaaa	CRISPR spacer
acatgatctgccatttaaaactccttaata	Protospacer
 ..* **********.** ********* *

96. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NC_017073 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC3, complete sequence) position: , mismatch: 7, identity: 0.767

aaaatcatctttattgactgtttttccttc	CRISPR spacer
ggcaagatctttattgcctgcttttccttc	Protospacer
.. *  ********** ***.*********

97. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

98. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

99. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

100. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

101. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

102. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

103. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

104. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

105. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

106. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

107. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

108. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

109. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

110. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

111. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

112. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

113. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

114. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

115. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

116. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gggggtgaaagatttcaaaaaagaaccttc	Protospacer
*.. .**********.********** **.

117. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MN693256 (Marine virus AFVG_25M339, complete genome) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
cagcatgaaagatttaaaaaaagaagaaga	Protospacer
 *.************ ********* *   

118. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_LR215001 (Mycoplasma conjunctivae strain NCTC10147 plasmid 5) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
ggaagataaaaattttaaaaaagagcattt	Protospacer
*.* .  ***.*************.*****

119. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MN855807 (Siphoviridae sp. isolate 122, partial genome) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
caccatgaaagatattaaaaaagattacta	Protospacer
 * ********** ********** .*.* 

120. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 7, identity: 0.767

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
caccatgaaagatattaaaaaagattacta	Protospacer
 * ********** ********** .*.* 

121. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP012103 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
aaacatcaaagattttaaaaaatgaggtc	Protospacer
.***** *************** .* .*.

122. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP009352 (Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaata	Protospacer
  .****** **************. ** 

123. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NC_004952 (Francisella novicida plasmid pFNL10, complete sequence) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaata	Protospacer
  .****** **************. ** 

124. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NC_002109 (Francisella tularensis plasmid pOM1, complete sequence) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaata	Protospacer
  .****** **************. ** 

125. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

126. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

127. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

128. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

129. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

130. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gtttataaaagattttaaaaaagaaatct	Protospacer
*  .**.******************  .*

131. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
aagagtagaagaatttaaaaaagaacatt	Protospacer
.*. .*..**** ****************

132. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
gtggatgattgattttaaaaaagaacaag	Protospacer
* . ****  *****************  

133. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

134. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.759

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacaga	Protospacer
  *.******* *** ***********  

135. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 8, identity: 0.733

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aggtagatctatattgactgttgttccttt	Protospacer
*..   **** *********** ******.

136. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP043832 (Bacillus sp. BS98 plasmid unnamed2) position: , mismatch: 8, identity: 0.733

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aggtagatctatattgactgttgttccttt	Protospacer
*..   **** *********** ******.

137. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP020434 (Bacillus sp. FDAARGOS_235 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733

aaaatcatctttattgactgtttttccttc	CRISPR spacer
aggtagatctatattgactgttgttccttt	Protospacer
*..   **** *********** ******.

138. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tatactagtagaatttaaaaaagaacattt	Protospacer
 *   *.. *** *****************

139. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP012103 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-4, complete sequence) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
aaacatcaaagattttaaaaaatgaggtcg	Protospacer
.***** *************** .* .*. 

140. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_LR214953 (Mycoplasma neurolyticum strain NCTC10166 plasmid 3) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
aattgataaaaattttaaaaaacaacattt	Protospacer
.* ..  ***.*********** *******

141. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP009352 (Francisella tularensis subsp. novicida F6168 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaatag	Protospacer
  .****** **************. **  

142. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP051681 (Cohnella sp. MFER-1 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcacatgaacgattttgaaaaagaaacggt	Protospacer
  ******* ******.********    *

143. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NC_004952 (Francisella novicida plasmid pFNL10, complete sequence) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaatag	Protospacer
  .****** **************. **  

144. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NC_002109 (Francisella tularensis plasmid pOM1, complete sequence) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
ttgcatgaacgattttaaaaaagagaatag	Protospacer
  .****** **************. **  

145. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

146. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

147. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

148. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

149. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

150. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MN871445 (UNVERIFIED: Serratia phage KpHz_2, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
attcctcttagatttaaaaaaagaacattt	Protospacer
.  * *   ****** **************

151. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MK448636 (Streptococcus satellite phage Javan749, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gtttataaaagattttaaaaaagaaatcta	Protospacer
*  .**.******************  .* 

152. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MN871444 (UNVERIFIED: Serratia phage KpGz_1, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
attcctcttagatttaaaaaaagaacattt	Protospacer
.  * *   ****** **************

153. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
aagagtagaagaatttaaaaaagaacattg	Protospacer
.*. .*..**** **************** 

154. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to KT725776 (Bacillus phage vB_BceS-MY192, partial genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
gtggatgattgattttaaaaaagaacaagg	Protospacer
* . ****  *****************   

155. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

156. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 8, identity: 0.733

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
tcatatgaaagctttgaaaaaagaacagaa	Protospacer
  *.******* *** ***********   

157. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP046030 (Staphylococcus chromogenes strain 1401 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
caccatgaaagattttagaaaagatttag	Protospacer
 * **************.****** .   

158. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to NZ_CP051681 (Cohnella sp. MFER-1 plasmid unnamed1) position: , mismatch: 8, identity: 0.724

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
tcacatgaacgattttgaaaaagaaacgg	Protospacer
  ******* ******.********    

159. spacer 1.10|264032|29|NZ_ANEC01000029|PILER-CR matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 8, identity: 0.724

gaacatgaaagattttaaaaaagaacatt	CRISPR spacer
ccacatgacagattttaacaaagaattgg	Protospacer
  ****** ********* ******.   

160. spacer 1.8|264032|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to HQ683709 (Planktothrix phage PaV-LD, complete genome) position: , mismatch: 9, identity: 0.7

gaacatgaaagattttaaaaaagaacattt	CRISPR spacer
ccacatgacagattttaacaaagaattggc	Protospacer
  ****** ********* ******.   .

161. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 10, identity: 0.667

aaaatcatctttattgactgtttttccttc	CRISPR spacer
ttaatcatctttattaactgtttaagaaat	Protospacer
  *************.*******      .

162. spacer 1.5|263831|30|NZ_ANEC01000029|CRISPRCasFinder,CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667

aaaatcatctttattgactgtttttccttc	CRISPR spacer
ttaatcatctttattaactgtttaagaaat	Protospacer
  *************.*******      .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 347238 : 356622 9 uncultured_Caudovirales_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ANEC01000030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANEC01000030_1 263368-264081 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ANEC01000030_1 1.11|263866|18|NZ_ANEC01000030|CRT 263866-263883 18 NZ_ANEC01000030.1 263194-263211 0 1.0
NZ_ANEC01000030_1 1.11|263866|18|NZ_ANEC01000030|CRT 263866-263883 18 NZ_ANEC01000030.1 263158-263175 1 0.944
NZ_ANEC01000030_1 1.12|263902|18|NZ_ANEC01000030|CRT 263902-263919 18 NZ_ANEC01000030.1 263062-263079 1 0.944
NZ_ANEC01000030_1 1.14|263974|18|NZ_ANEC01000030|CRT 263974-263991 18 NZ_ANEC01000030.1 263158-263175 1 0.944
NZ_ANEC01000030_1 1.16|264046|18|NZ_ANEC01000030|CRT 264046-264063 18 NZ_ANEC01000030.1 263158-263175 1 0.944
NZ_ANEC01000030_1 1.16|264046|18|NZ_ANEC01000030|CRT 264046-264063 18 NZ_ANEC01000030.1 263194-263211 2 0.889

1. spacer 1.11|263866|18|NZ_ANEC01000030|CRT matches to position: 263194-263211, mismatch: 0, identity: 1.0

agcactagcgcctcaacg	CRISPR spacer
agcactagcgcctcaacg	Protospacer
******************

2. spacer 1.11|263866|18|NZ_ANEC01000030|CRT matches to position: 263158-263175, mismatch: 1, identity: 0.944

agcactagcgcctcaacg	CRISPR spacer
agcaccagcgcctcaacg	Protospacer
*****.************

3. spacer 1.12|263902|18|NZ_ANEC01000030|CRT matches to position: 263062-263079, mismatch: 1, identity: 0.944

agcacaagttcttcaaca	CRISPR spacer
agcacaagtgcttcaaca	Protospacer
********* ********

4. spacer 1.14|263974|18|NZ_ANEC01000030|CRT matches to position: 263158-263175, mismatch: 1, identity: 0.944

agcaccagcgcttcaacg	CRISPR spacer
agcaccagcgcctcaacg	Protospacer
***********.******

5. spacer 1.16|264046|18|NZ_ANEC01000030|CRT matches to position: 263158-263175, mismatch: 1, identity: 0.944

agcaccagcgtctcaacg	CRISPR spacer
agcaccagcgcctcaacg	Protospacer
**********.*******

6. spacer 1.16|264046|18|NZ_ANEC01000030|CRT matches to position: 263194-263211, mismatch: 2, identity: 0.889

agcaccagcgtctcaacg	CRISPR spacer
agcactagcgcctcaacg	Protospacer
*****.****.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANEC01000030_1 1.1|263386|30|NZ_ANEC01000030|CRT 263386-263415 30 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 113178-113207 6 0.8
NZ_ANEC01000030_1 1.1|263386|30|NZ_ANEC01000030|CRT 263386-263415 30 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 55307-55336 6 0.8
NZ_ANEC01000030_1 1.1|263386|30|NZ_ANEC01000030|CRT 263386-263415 30 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 63171-63200 6 0.8
NZ_ANEC01000030_1 1.1|263386|30|NZ_ANEC01000030|CRT 263386-263415 30 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 46656-46685 6 0.8
NZ_ANEC01000030_1 1.1|263386|30|NZ_ANEC01000030|CRT 263386-263415 30 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 43635-43664 6 0.8
NZ_ANEC01000030_1 1.7|263674|30|NZ_ANEC01000030|CRT 263674-263703 30 NC_020910 Octadecabacter arcticus 238 plasmid pOA238_160, complete sequence 105422-105451 7 0.767
NZ_ANEC01000030_1 1.3|263482|30|NZ_ANEC01000030|CRT 263482-263511 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1090242-1090271 8 0.733
NZ_ANEC01000030_1 1.3|263482|30|NZ_ANEC01000030|CRT 263482-263511 30 NZ_HG938357 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence 80295-80324 8 0.733

1. spacer 1.1|263386|30|NZ_ANEC01000030|CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

---agtactagcgcttccacgtcagcaagtacc	CRISPR spacer
ctcaggcct---gcttccacgtcagcacgtacc	Protospacer
   **  **   *************** *****

2. spacer 1.1|263386|30|NZ_ANEC01000030|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

---agtactagcgcttccacgtcagcaagtacc	CRISPR spacer
ctcaggcct---gcttccacgtcagcacgtacc	Protospacer
   **  **   *************** *****

3. spacer 1.1|263386|30|NZ_ANEC01000030|CRT matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

---agtactagcgcttccacgtcagcaagtacc	CRISPR spacer
ctcaggcct---gcttccacgtcagcacgtacc	Protospacer
   **  **   *************** *****

4. spacer 1.1|263386|30|NZ_ANEC01000030|CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

---agtactagcgcttccacgtcagcaagtacc	CRISPR spacer
ctcaggcct---gcttccacgtcagcacgtacc	Protospacer
   **  **   *************** *****

5. spacer 1.1|263386|30|NZ_ANEC01000030|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 6, identity: 0.8

---agtactagcgcttccacgtcagcaagtacc	CRISPR spacer
ctcaggcct---gcttccacgtcagcacgtacc	Protospacer
   **  **   *************** *****

6. spacer 1.7|263674|30|NZ_ANEC01000030|CRT matches to NC_020910 (Octadecabacter arcticus 238 plasmid pOA238_160, complete sequence) position: , mismatch: 7, identity: 0.767

agtaccagcgcttccacaagtgcaagtacg	CRISPR spacer
gattccaacgtttccacaagtgcaagttct	Protospacer
..* ***.**.**************** * 

7. spacer 1.3|263482|30|NZ_ANEC01000030|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733

agtatgagcgcctccacaagtgcaagtatc	CRISPR spacer
aacctgagcgcctcctcaagtgcaaagagg	Protospacer
*.. *********** *********. *  

8. spacer 1.3|263482|30|NZ_ANEC01000030|CRT matches to NZ_HG938357 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141b, complete sequence) position: , mismatch: 8, identity: 0.733

agtatgagcgcctccacaagtgcaagtatc	CRISPR spacer
aacctgagcgcctcctcaagtgcaaagagg	Protospacer
*.. *********** *********. *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 162308 : 173041 16 Streptococcus_phage(84.62%) NA NA
DBSCAN-SWA_2 349122 : 359394 9 Streptococcus_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ANEC01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 179 : 37153 47 Streptococcus_phage(72.5%) portal,terminase,tail,head,holin,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ANEC01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42865 : 50852 7 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ANEC01000016
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40028 : 47232 8 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ANEC01000021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANEC01000021_1 53099-53174 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12817 : 21808 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_ANEC01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ANEC01000015.1|WP_000384271.1|64583_64910_+|hypothetical-protein 64583_64910_+ 108 aa aa AcrIIA21 NA NA No NA
8. NZ_ANEC01000028
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61887 : 87539 27 Streptococcus_phage(40.0%) protease,integrase,transposase attL 73171:73186|attR 89875:89890
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_ANEC01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113 : 37534 53 Streptococcus_phage(79.59%) tail,terminase,portal,holin,integrase,capsid attL 48:59|attR 5237:5248
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage