Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_ANCT01000063 Streptococcus agalactiae FSL S3-442 ctg120000932057, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000050 Streptococcus agalactiae FSL S3-442 ctg120000932044, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000022 Streptococcus agalactiae FSL S3-442 ctg120000932016, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000096 Streptococcus agalactiae FSL S3-442 ctg120000932090, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000058 Streptococcus agalactiae FSL S3-442 ctg120000932052, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000005 Streptococcus agalactiae FSL S3-442 ctg120000921753, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000080 Streptococcus agalactiae FSL S3-442 ctg120000932074, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000007 Streptococcus agalactiae FSL S3-442 ctg120000922046, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000004 Streptococcus agalactiae FSL S3-442 ctg120000920204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000120 Streptococcus agalactiae FSL S3-442 ctg120000932114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000013 Streptococcus agalactiae FSL S3-442 ctg120000928250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000078 Streptococcus agalactiae FSL S3-442 ctg120000932072, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000124 Streptococcus agalactiae FSL S3-442 ctg120000932118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000028 Streptococcus agalactiae FSL S3-442 ctg120000932022, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000040 Streptococcus agalactiae FSL S3-442 ctg120000932034, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000035 Streptococcus agalactiae FSL S3-442 ctg120000932029, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000102 Streptococcus agalactiae FSL S3-442 ctg120000932096, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_ANCT01000052 Streptococcus agalactiae FSL S3-442 ctg120000932046, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ANCT01000106 Streptococcus agalactiae FSL S3-442 ctg120000932100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000070 Streptococcus agalactiae FSL S3-442 ctg120000932064, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000079 Streptococcus agalactiae FSL S3-442 ctg120000932073, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000094 Streptococcus agalactiae FSL S3-442 ctg120000932088, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000086 Streptococcus agalactiae FSL S3-442 ctg120000932080, whole genome shotgun sequence 1 crisprs NA 0 6 0 0
NZ_ANCT01000087 Streptococcus agalactiae FSL S3-442 ctg120000932081, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000031 Streptococcus agalactiae FSL S3-442 ctg120000932025, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000073 Streptococcus agalactiae FSL S3-442 ctg120000932067, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000059 Streptococcus agalactiae FSL S3-442 ctg120000932053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000056 Streptococcus agalactiae FSL S3-442 ctg120000932050, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANCT01000061 Streptococcus agalactiae FSL S3-442 ctg120000932055, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ANCT01000091 Streptococcus agalactiae FSL S3-442 ctg120000932085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000115 Streptococcus agalactiae FSL S3-442 ctg120000932109, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000057 Streptococcus agalactiae FSL S3-442 ctg120000932051, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000024 Streptococcus agalactiae FSL S3-442 ctg120000932018, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000051 Streptococcus agalactiae FSL S3-442 ctg120000932045, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000107 Streptococcus agalactiae FSL S3-442 ctg120000932101, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_ANCT01000019 Streptococcus agalactiae FSL S3-442 ctg120000932013, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000047 Streptococcus agalactiae FSL S3-442 ctg120000932041, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000069 Streptococcus agalactiae FSL S3-442 ctg120000932063, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000045 Streptococcus agalactiae FSL S3-442 ctg120000932039, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000112 Streptococcus agalactiae FSL S3-442 ctg120000932106, whole genome shotgun sequence 1 crisprs csn2,cas2,cas1,cas9 2 7 0 0
NZ_ANCT01000075 Streptococcus agalactiae FSL S3-442 ctg120000932069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000036 Streptococcus agalactiae FSL S3-442 ctg120000932030, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 0 4 0 0
NZ_ANCT01000001 Streptococcus agalactiae FSL S3-442 ctg120000919431, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000054 Streptococcus agalactiae FSL S3-442 ctg120000932048, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000076 Streptococcus agalactiae FSL S3-442 ctg120000932070, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000068 Streptococcus agalactiae FSL S3-442 ctg120000932062, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000009 Streptococcus agalactiae FSL S3-442 ctg120000923504, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000098 Streptococcus agalactiae FSL S3-442 ctg120000932092, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000084 Streptococcus agalactiae FSL S3-442 ctg120000932078, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000027 Streptococcus agalactiae FSL S3-442 ctg120000932021, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000065 Streptococcus agalactiae FSL S3-442 ctg120000932059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000085 Streptococcus agalactiae FSL S3-442 ctg120000932079, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000055 Streptococcus agalactiae FSL S3-442 ctg120000932049, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000074 Streptococcus agalactiae FSL S3-442 ctg120000932068, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000088 Streptococcus agalactiae FSL S3-442 ctg120000932082, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000038 Streptococcus agalactiae FSL S3-442 ctg120000932032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000101 Streptococcus agalactiae FSL S3-442 ctg120000932095, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000123 Streptococcus agalactiae FSL S3-442 ctg120000932117, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000021 Streptococcus agalactiae FSL S3-442 ctg120000932015, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000039 Streptococcus agalactiae FSL S3-442 ctg120000932033, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000077 Streptococcus agalactiae FSL S3-442 ctg120000932071, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000060 Streptococcus agalactiae FSL S3-442 ctg120000932054, whole genome shotgun sequence 0 crisprs csa3 0 0 2 0
NZ_ANCT01000066 Streptococcus agalactiae FSL S3-442 ctg120000932060, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000037 Streptococcus agalactiae FSL S3-442 ctg120000932031, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000062 Streptococcus agalactiae FSL S3-442 ctg120000932056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000110 Streptococcus agalactiae FSL S3-442 ctg120000932104, whole genome shotgun sequence 0 crisprs DinG 0 0 1 0
NZ_ANCT01000064 Streptococcus agalactiae FSL S3-442 ctg120000932058, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000089 Streptococcus agalactiae FSL S3-442 ctg120000932083, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000119 Streptococcus agalactiae FSL S3-442 ctg120000932113, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000023 Streptococcus agalactiae FSL S3-442 ctg120000932017, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000006 Streptococcus agalactiae FSL S3-442 ctg120000921953, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000008 Streptococcus agalactiae FSL S3-442 ctg120000922399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000030 Streptococcus agalactiae FSL S3-442 ctg120000932024, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000111 Streptococcus agalactiae FSL S3-442 ctg120000932105, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANCT01000090 Streptococcus agalactiae FSL S3-442 ctg120000932084, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000011 Streptococcus agalactiae FSL S3-442 ctg120000927973, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000014 Streptococcus agalactiae FSL S3-442 ctg120000928269, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000117 Streptococcus agalactiae FSL S3-442 ctg120000932111, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000097 Streptococcus agalactiae FSL S3-442 ctg120000932091, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000108 Streptococcus agalactiae FSL S3-442 ctg120000932102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000103 Streptococcus agalactiae FSL S3-442 ctg120000932097, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000122 Streptococcus agalactiae FSL S3-442 ctg120000932116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000109 Streptococcus agalactiae FSL S3-442 ctg120000932103, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_ANCT01000083 Streptococcus agalactiae FSL S3-442 ctg120000932077, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000033 Streptococcus agalactiae FSL S3-442 ctg120000932027, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000081 Streptococcus agalactiae FSL S3-442 ctg120000932075, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000118 Streptococcus agalactiae FSL S3-442 ctg120000932112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000104 Streptococcus agalactiae FSL S3-442 ctg120000932098, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000016 Streptococcus agalactiae FSL S3-442 ctg120000929881, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000015 Streptococcus agalactiae FSL S3-442 ctg120000929450, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000017 Streptococcus agalactiae FSL S3-442 ctg120000930957, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000043 Streptococcus agalactiae FSL S3-442 ctg120000932037, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000105 Streptococcus agalactiae FSL S3-442 ctg120000932099, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000018 Streptococcus agalactiae FSL S3-442 ctg120000932012, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000093 Streptococcus agalactiae FSL S3-442 ctg120000932087, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000032 Streptococcus agalactiae FSL S3-442 ctg120000932026, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000053 Streptococcus agalactiae FSL S3-442 ctg120000932047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000026 Streptococcus agalactiae FSL S3-442 ctg120000932020, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_ANCT01000099 Streptococcus agalactiae FSL S3-442 ctg120000932093, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000010 Streptococcus agalactiae FSL S3-442 ctg120000925776, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000100 Streptococcus agalactiae FSL S3-442 ctg120000932094, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000121 Streptococcus agalactiae FSL S3-442 ctg120000932115, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000092 Streptococcus agalactiae FSL S3-442 ctg120000932086, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000003 Streptococcus agalactiae FSL S3-442 ctg120000919697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000025 Streptococcus agalactiae FSL S3-442 ctg120000932019, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000082 Streptococcus agalactiae FSL S3-442 ctg120000932076, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000012 Streptococcus agalactiae FSL S3-442 ctg120000928206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000044 Streptococcus agalactiae FSL S3-442 ctg120000932038, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000113 Streptococcus agalactiae FSL S3-442 ctg120000932107, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000046 Streptococcus agalactiae FSL S3-442 ctg120000932040, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_ANCT01000095 Streptococcus agalactiae FSL S3-442 ctg120000932089, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000020 Streptococcus agalactiae FSL S3-442 ctg120000932014, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000041 Streptococcus agalactiae FSL S3-442 ctg120000932035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000116 Streptococcus agalactiae FSL S3-442 ctg120000932110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000002 Streptococcus agalactiae FSL S3-442 ctg120000919562, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000114 Streptococcus agalactiae FSL S3-442 ctg120000932108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000067 Streptococcus agalactiae FSL S3-442 ctg120000932061, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000072 Streptococcus agalactiae FSL S3-442 ctg120000932066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000029 Streptococcus agalactiae FSL S3-442 ctg120000932023, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000034 Streptococcus agalactiae FSL S3-442 ctg120000932028, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000042 Streptococcus agalactiae FSL S3-442 ctg120000932036, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000071 Streptococcus agalactiae FSL S3-442 ctg120000932065, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000048 Streptococcus agalactiae FSL S3-442 ctg120000932042, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_ANCT01000049 Streptococcus agalactiae FSL S3-442 ctg120000932043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_ANCT01000112
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANCT01000112_1 1-493 TypeII II-A
7 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_ANCT01000112_1 1.5|296|35|NZ_ANCT01000112|CRT 296-330 35 NZ_ANCT01000086.1 9441-9475 0 1.0
NZ_ANCT01000112_1 1.14|296|30|NZ_ANCT01000112|CRISPRCasFinder 296-325 30 NZ_ANCT01000086.1 9441-9470 0 1.0

1. spacer 1.5|296|35|NZ_ANCT01000112|CRT matches to position: 9441-9475, mismatch: 0, identity: 1.0

taaccatgtacagataagcgccttgatggtgtttt	CRISPR spacer
taaccatgtacagataagcgccttgatggtgtttt	Protospacer
***********************************

2. spacer 1.14|296|30|NZ_ANCT01000112|CRISPRCasFinder matches to position: 9441-9470, mismatch: 0, identity: 1.0

taaccatgtacagataagcgccttgatggt	CRISPR spacer
taaccatgtacagataagcgccttgatggt	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANCT01000112_1 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder 362-391 30 CP033548 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence 29111-29140 6 0.8
NZ_ANCT01000112_1 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder 362-391 30 MN871509 UNVERIFIED: Pseudomonas phage pasz5, complete genome 772-801 6 0.8
NZ_ANCT01000112_1 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder 428-457 30 NC_017804 Borreliella garinii BgVir plasmid lp54, complete sequence 6331-6360 6 0.8
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NC_005250 Vibrio anguillarum 775 plasmid pJM1, complete sequence 30946-30974 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NZ_CP020532 Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence 5769-5797 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NZ_CP020532 Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence 14626-14654 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NZ_LK021128 Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence 716-744 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NZ_LK021128 Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence 58657-58685 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NC_022225 Vibrio anguillarum M3 plasmid unnamed, complete sequence 54230-54258 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NC_022225 Vibrio anguillarum M3 plasmid unnamed, complete sequence 63087-63115 7 0.759
NZ_ANCT01000112_1 1.8|98|29|NZ_ANCT01000112|PILER-CR 98-126 29 NZ_CP023210 Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence 59000-59028 7 0.759
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NC_005250 Vibrio anguillarum 775 plasmid pJM1, complete sequence 30945-30974 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NZ_CP020532 Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence 5769-5798 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NZ_CP020532 Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence 14626-14655 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NZ_LK021128 Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence 715-744 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NZ_LK021128 Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence 58656-58685 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NC_022225 Vibrio anguillarum M3 plasmid unnamed, complete sequence 54229-54258 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NC_022225 Vibrio anguillarum M3 plasmid unnamed, complete sequence 63086-63115 7 0.767
NZ_ANCT01000112_1 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder 98-127 30 NZ_CP023210 Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence 58999-59028 7 0.767
NZ_ANCT01000112_1 1.14|296|30|NZ_ANCT01000112|CRISPRCasFinder 296-325 30 MK685667 Klebsiella phage vB_KpnM_IME346, complete genome 39411-39440 8 0.733
NZ_ANCT01000112_1 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder 428-457 30 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 679795-679824 8 0.733
NZ_ANCT01000112_1 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder 428-457 30 MN882551 Butyrivibrio virus Arian, complete genome 31154-31183 8 0.733
NZ_ANCT01000112_1 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder 428-457 30 NC_016571 Pseudomonas phage OBP, complete genome 223368-223397 8 0.733
NZ_ANCT01000112_1 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder 428-457 30 MN882552 Butyrivibrio virus Bo-Finn, complete genome 30882-30911 8 0.733
NZ_ANCT01000112_1 1.1|32|35|NZ_ANCT01000112|CRT 32-66 35 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 707554-707588 9 0.743
NZ_ANCT01000112_1 1.6|362|35|NZ_ANCT01000112|CRT 362-396 35 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 707554-707588 9 0.743
NZ_ANCT01000112_1 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder 362-391 30 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 119513-119542 9 0.7
NZ_ANCT01000112_1 1.1|32|35|NZ_ANCT01000112|CRT 32-66 35 CP033548 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence 29106-29140 10 0.714
NZ_ANCT01000112_1 1.6|362|35|NZ_ANCT01000112|CRT 362-396 35 CP033548 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence 29106-29140 10 0.714

1. spacer 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder matches to CP033548 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence) position: , mismatch: 6, identity: 0.8

ccgcccataacagaagaaaaaagggataaa	CRISPR spacer
ttatccataaaagaagaagaaagggataaa	Protospacer
....****** *******.***********

2. spacer 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder matches to MN871509 (UNVERIFIED: Pseudomonas phage pasz5, complete genome) position: , mismatch: 6, identity: 0.8

ccgcccataacagaagaaaaaagggataaa	CRISPR spacer
catcgcataacagaatcaaaaagggataat	Protospacer
*  * **********  ************ 

3. spacer 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder matches to NC_017804 (Borreliella garinii BgVir plasmid lp54, complete sequence) position: , mismatch: 6, identity: 0.8

ataataaacaataatgtttgttaatctttt	CRISPR spacer
actaaaaacaataatgtcttttaatcttta	Protospacer
*. * ************.* ********* 

4. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NC_005250 (Vibrio anguillarum 775 plasmid pJM1, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

5. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NZ_CP020532 (Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

6. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NZ_CP020532 (Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

7. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NZ_LK021128 (Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

8. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NZ_LK021128 (Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

9. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NC_022225 (Vibrio anguillarum M3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

10. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NC_022225 (Vibrio anguillarum M3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

11. spacer 1.8|98|29|NZ_ANCT01000112|PILER-CR matches to NZ_CP023210 (Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence) position: , mismatch: 7, identity: 0.759

atttattcataatgcgttatcctcacaat	CRISPR spacer
tattattcatagtgcgttatcctatcctt	Protospacer
  *********.***********  *  *

12. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NC_005250 (Vibrio anguillarum 775 plasmid pJM1, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

13. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_CP020532 (Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

14. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_CP020532 (Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

15. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_LK021128 (Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

16. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_LK021128 (Vibrio anguillarum strain NB10 plasmid p67vangNB10, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

17. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NC_022225 (Vibrio anguillarum M3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

18. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NC_022225 (Vibrio anguillarum M3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

19. spacer 1.11|98|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_CP023210 (Vibrio anguillarum strain ATCC-68554 plasmid p65, complete sequence) position: , mismatch: 7, identity: 0.767

atttattcataatgcgttatcctcacaata	CRISPR spacer
tattattcatagtgcgttatcctatcctta	Protospacer
  *********.***********  *  **

20. spacer 1.14|296|30|NZ_ANCT01000112|CRISPRCasFinder matches to MK685667 (Klebsiella phage vB_KpnM_IME346, complete genome) position: , mismatch: 8, identity: 0.733

taaccatgtacagataagcgccttgatggt-	CRISPR spacer
aaaccatgtacagataagc-cccaaatacaa	Protospacer
 ****************** **. .**.   

21. spacer 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733

ataataaacaataatgtttgttaatctttt	CRISPR spacer
ctatatgccaataatgtttgttagtctttc	Protospacer
 **   . ***************.*****.

22. spacer 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder matches to MN882551 (Butyrivibrio virus Arian, complete genome) position: , mismatch: 8, identity: 0.733

ataataaacaataatgtttgttaatctttt	CRISPR spacer
ataaaaaacaataatgttttttattgcgga	Protospacer
**** ************** *** * .   

23. spacer 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder matches to NC_016571 (Pseudomonas phage OBP, complete genome) position: , mismatch: 8, identity: 0.733

ataataaacaataatgtttgttaatctttt	CRISPR spacer
aggataaagaataatgtttgttattccaaa	Protospacer
* .***** ************** **.   

24. spacer 1.16|428|30|NZ_ANCT01000112|CRISPRCasFinder matches to MN882552 (Butyrivibrio virus Bo-Finn, complete genome) position: , mismatch: 8, identity: 0.733

ataataaacaataatgtttgttaatctttt	CRISPR spacer
ataaaaaacaataatgttttttattgcgga	Protospacer
**** ************** *** * .   

25. spacer 1.1|32|35|NZ_ANCT01000112|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.743

ccgcccataacagaagaaaaaagggataaagtttt	CRISPR spacer
acgttgacaaaagaagaaaaaagagataaagttaa	Protospacer
 **.. *.** ************.*********  

26. spacer 1.6|362|35|NZ_ANCT01000112|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.743

ccgcccataacagaagaaaaaagggataaagtttt	CRISPR spacer
acgttgacaaaagaagaaaaaagagataaagttaa	Protospacer
 **.. *.** ************.*********  

27. spacer 1.15|362|30|NZ_ANCT01000112|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.7

ccgcccataacagaagaaaaaagggataaa	CRISPR spacer
gaatccatgccagaagaaaaaagggattgt	Protospacer
  ..****. ***************** . 

28. spacer 1.1|32|35|NZ_ANCT01000112|CRT matches to CP033548 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence) position: , mismatch: 10, identity: 0.714

ccgcccataacagaagaaaaaagggataaagtttt	CRISPR spacer
ttatccataaaagaagaagaaagggataaaacact	Protospacer
....****** *******.***********.. .*

29. spacer 1.6|362|35|NZ_ANCT01000112|CRT matches to CP033548 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence) position: , mismatch: 10, identity: 0.714

ccgcccataacagaagaaaaaagggataaagtttt	CRISPR spacer
ttatccataaaagaagaagaaagggataaaacact	Protospacer
....****** *******.***********.. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_ANCT01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12074 : 21062 8 Bacillus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_ANCT01000086
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANCT01000086_1 8943-9440 Orphan II-A
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 MK448790 Streptococcus phage Javan515, complete genome 1426-1455 0 1.0
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 MK448957 Streptococcus phage Javan484, complete genome 1422-1451 0 1.0
NZ_ANCT01000086_1 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9111-9140 30 MK448711 Streptococcus phage Javan235, complete genome 7584-7613 0 1.0
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448956 Streptococcus phage Javan48, complete genome 13968-13997 0 1.0
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448749 Streptococcus phage Javan39, complete genome 13968-13997 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448971 Streptococcus phage Javan52, complete genome 15323-15352 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448829 Streptococcus phage Javan7, complete genome 11857-11886 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448736 Streptococcus phage Javan35, complete genome 13006-13035 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448956 Streptococcus phage Javan48, complete genome 13910-13939 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448781 Streptococcus phage Javan5, complete genome 15028-15057 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448749 Streptococcus phage Javan39, complete genome 13910-13939 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MH853355 Streptococcus phage LF1, complete genome 2714-2743 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448938 Streptococcus phage Javan44, complete genome 13007-13036 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MH853356 Streptococcus phage LF2, partial genome 4076-4105 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448911 Streptococcus phage Javan34, complete genome 13006-13035 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448742 Streptococcus phage Javan37, complete genome 13505-13534 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MH853358 Streptococcus phage LF4, complete genome 2714-2743 0 1.0
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 MK448916 Streptococcus phage Javan36, complete genome 13006-13035 0 1.0
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448796 Streptococcus phage Javan53, complete genome 1809-1838 2 0.933
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448736 Streptococcus phage Javan35, complete genome 1709-1738 2 0.933
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448781 Streptococcus phage Javan5, complete genome 1709-1738 2 0.933
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448938 Streptococcus phage Javan44, complete genome 1709-1738 2 0.933
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448911 Streptococcus phage Javan34, complete genome 1709-1738 2 0.933
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MK448916 Streptococcus phage Javan36, complete genome 1709-1738 2 0.933
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448704 Streptococcus phage Javan213, complete genome 11298-11327 2 0.933
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448734 Streptococcus phage Javan347, complete genome 8977-9006 2 0.933
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448876 Streptococcus phage Javan214, complete genome 11800-11829 2 0.933
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448796 Streptococcus phage Javan53, complete genome 17381-17410 3 0.9
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448822 Streptococcus phage Javan629, complete genome 13388-13417 3 0.9
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448736 Streptococcus phage Javan35, complete genome 13064-13093 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448781 Streptococcus phage Javan5, complete genome 15086-15115 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448938 Streptococcus phage Javan44, complete genome 13065-13094 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 HG424323 Streptococcus phage 20617 complete prophage genome 15101-15130 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448911 Streptococcus phage Javan34, complete genome 13064-13093 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448916 Streptococcus phage Javan36, complete genome 13064-13093 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448755 Streptococcus phage Javan423, complete genome 12783-12812 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448756 Streptococcus phage Javan425, complete genome 12783-12812 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448707 Streptococcus phage Javan227, complete genome 16383-16412 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448954 Streptococcus phage Javan476, complete genome 12435-12464 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK449012 Streptococcus phage Javan94, complete genome 12477-12506 4 0.867
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448680 Streptococcus phage Javan139, complete genome 10668-10697 4 0.867
NZ_ANCT01000086_1 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9111-9140 30 MK448750 Streptococcus phage Javan393, complete genome 3056-3085 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 NC_000872 Streptococcus phage Sfi21, complete genome 36726-36755 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705251 Streptococcus phage P0091, complete genome 31406-31435 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705273 Streptococcus phage P7602, complete genome 33980-34009 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937473 Streptococcus phage CHPC929, complete genome 35982-36011 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH892360 Streptococcus phage SW11, complete genome 33275-33304 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH892353 Streptococcus phage SW2, complete genome 34246-34275 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705277 Streptococcus phage P7951, complete genome 31360-31389 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 NC_000871 Streptococcus phage Sfi19, complete genome 35421-35450 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937464 Streptococcus phage CHPC869, complete genome 34213-34242 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937480 Streptococcus phage CHPC954, complete genome 34114-34143 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448753 Streptococcus phage Javan407, complete genome 12528-12557 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937475 Streptococcus phage CHPC931, complete genome 33663-33692 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MF417967 Uncultured Caudovirales phage clone 3S_16, partial genome 7733-7762 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 AF158601 Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds 12499-12528 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705268 Streptococcus phage P7571, complete genome 32083-32112 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705269 Streptococcus phage P7572, complete genome 30586-30615 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705281 Streptococcus phage P7955, complete genome 33997-34026 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 AF115103 Streptococcus thermophilus bacteriophage Sfi21, complete genome 36726-36755 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 NC_013645 Streptococcus phage Abc2, complete genome 31500-31529 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 AF115102 Streptococcus thermophilus bacteriophage Sfi19, complete genome 35421-35450 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 FJ226752 Streptococcus phage ALQ13.2, complete genome 32704-32733 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 NC_002214 Streptococcus thermophilus bacteriophage Sfi11, complete genome 37427-37456 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705272 Streptococcus phage P7601, complete genome 32090-32119 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 KY705271 Streptococcus phage P7574, complete genome 32891-32920 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937505 Streptococcus phage CHPC1109, complete genome 30694-30723 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937469 Streptococcus phage CHPC919, complete genome 33754-33783 5 0.833
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MH937491 Streptococcus phage CHPC1037, partial genome 33178-33207 5 0.833
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_018685 Bacillus thuringiensis MC28 plasmid pMC95, complete sequence 82837-82866 6 0.8
NZ_ANCT01000086_1 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9111-9140 30 KJ018211 Shewanella sp. phage 1/40, complete genome 81048-81077 6 0.8
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448896 Streptococcus phage Javan278, complete genome 6108-6137 6 0.8
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448757 Streptococcus phage Javan427, complete genome 14224-14253 6 0.8
NZ_ANCT01000086_1 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9309-9338 30 NZ_CP010112 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence 193083-193112 6 0.8
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP034168 Enterococcus avium strain 352 plasmid unnamed, complete sequence 14259-14288 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 180131-180160 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 130740-130769 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 124624-124653 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 2565-2594 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 1843-1872 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 40599-40628 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_015417 Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence 153049-153078 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 130740-130769 7 0.767
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 MN399336 Edwardsiella phage vB_EtaM_ET-ABTNL-9, complete genome 82194-82223 7 0.767
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 NZ_CP006727 Leptospira interrogans serovar Linhai str. 56609 plasmid lcp3, complete sequence 30951-30980 7 0.767
NZ_ANCT01000086_1 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9243-9272 30 MK448885 Streptococcus phage Javan252, complete genome 13038-13067 7 0.767
NZ_ANCT01000086_1 1.7|9375|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9375-9404 30 MN602266 Bacteriophage DSS3_VP1, complete genome 51181-51210 7 0.767
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 27063-27092 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_048665 Clostridium phage phiCDHM14, complete genome 22262-22291 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 KU057941 Clostridium phage CDSH1, complete genome 28658-28687 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 MK473382 Clostridium phage JD032, complete genome 12174-12203 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 LN881738 Escherichia phage slur17, complete genome 33369-33398 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_028905 Clostridium phage phiCD111, complete genome 28432-28461 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 HG796225 Clostridium phage phiCDHM13 complete genome 21762-21791 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 LN681538 Clostridium phage phiCD481-1, complete genome 21502-21531 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 HG798901 Clostridium phage phiCDHM11 complete genome 21762-21791 8 0.733
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 NZ_MF925335 Edwardsiella tarda strain 150611-1 plasmid p150611 1B-1, complete sequence 2614-2643 8 0.733
NZ_ANCT01000086_1 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR 9177-9206 30 NC_011668 Shewanella baltica OS223 plasmid pS22302, complete sequence 56767-56796 8 0.733
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_028838 Clostridium phage phiCD506, complete genome 22083-22112 9 0.7
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 HM568888 Clostridium phage phiCD38-2, complete genome 28154-28183 9 0.7
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_028958 Clostridium phage phiCD146, complete genome 27716-27745 9 0.7
NZ_ANCT01000086_1 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder 9045-9074 30 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 640927-640956 10 0.667

1. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gatggagtgttagaagaattaaaaagaaga	Protospacer
******************************

2. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gatggagtgttagaagaattaaaaagaaga	Protospacer
******************************

3. spacer 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 0, identity: 1.0

tcaacatgcttacttagagcatctcgctga	CRISPR spacer
tcaacatgcttacttagagcatctcgctga	Protospacer
******************************

4. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatcagccacaaactgtggcactt	Protospacer
******************************

5. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatcagccacaaactgtggcactt	Protospacer
******************************

6. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

7. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

8. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

9. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

10. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

11. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

12. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

13. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

14. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

15. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

16. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

17. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

18. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

gtagtgaaaacacatattgtaaaagtatta	CRISPR spacer
gtagtgaaaacacatattgtaaaagtatta	Protospacer
******************************

19. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

20. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

21. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

22. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

23. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

24. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 2, identity: 0.933

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgaaatatcctcagaagataaaa	Protospacer
****************.**********.**

25. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 2, identity: 0.933

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatcagccacaaattgtggcacta	Protospacer
*******************.********* 

26. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448734 (Streptococcus phage Javan347, complete genome) position: , mismatch: 2, identity: 0.933

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatccgccacaaactgtggcacta	Protospacer
********** ****************** 

27. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448876 (Streptococcus phage Javan214, complete genome) position: , mismatch: 2, identity: 0.933

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatcagccacaaattgtggcacta	Protospacer
*******************.********* 

28. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.9

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagcaacaaactgtggcactt	Protospacer
**  ********* ****************

29. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448822 (Streptococcus phage Javan629, complete genome) position: , mismatch: 3, identity: 0.9

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagcaacaaactgtggcactt	Protospacer
**  ********* ****************

30. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cgtaccaatcagccacaaaccgtggcactt	Protospacer
*.  ****************.*********

31. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cgtaccaatcagccacaaaccgtggcactt	Protospacer
*.  ****************.*********

32. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cgtaccaatcagccacaaaccgtggcactt	Protospacer
*.  ****************.*********

33. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to HG424323 (Streptococcus phage 20617 complete prophage genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
aaatccaatcagccacaaattgtggaacta	Protospacer
 ******************.***** *** 

34. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cgtaccaatcagccacaaaccgtggcactt	Protospacer
*.  ****************.*********

35. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cgtaccaatcagccacaaaccgtggcactt	Protospacer
*.  ****************.*********

36. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
ctatccaatcagccacaaacttcggcacta	Protospacer
* ******************* .****** 

37. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
ctatccaatcagccacaaacttcggcacta	Protospacer
* ******************* .****** 

38. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448707 (Streptococcus phage Javan227, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacaaattgtggcacta	Protospacer
**  ***************.********* 

39. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
ctacccaatcagccacaaactgaggcacta	Protospacer
* *.****************** ****** 

40. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacaaattgtggaactt	Protospacer
**  ***************.***** ****

41. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448680 (Streptococcus phage Javan139, complete genome) position: , mismatch: 4, identity: 0.867

caatccaatcagccacaaactgtggcactt	CRISPR spacer
ctagccaatcagccacaaactgcgggactt	Protospacer
* * ******************.** ****

42. spacer 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448750 (Streptococcus phage Javan393, complete genome) position: , mismatch: 5, identity: 0.833

tcaacatgcttacttagagcatctcgctga	CRISPR spacer
tcaacatgtttacttagtgcatctcgagaa	Protospacer
********.******** ********  .*

43. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NC_000872 (Streptococcus phage Sfi21, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

44. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatccgccacaaactttggcactg	Protospacer
**  ****** ********** ******* 

45. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705273 (Streptococcus phage P7602, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

46. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

47. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH892360 (Streptococcus phage SW11, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

48. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH892353 (Streptococcus phage SW2, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacaaactgcggtacta	Protospacer
**  ******************.**.*** 

49. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705277 (Streptococcus phage P7951, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

50. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NC_000871 (Streptococcus phage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

51. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937464 (Streptococcus phage CHPC869, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

52. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937480 (Streptococcus phage CHPC954, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

53. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448753 (Streptococcus phage Javan407, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccactccgccacaaactgtggcacta	Protospacer
**  *** ** ****************** 

54. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937475 (Streptococcus phage CHPC931, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

55. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MF417967 (Uncultured Caudovirales phage clone 3S_16, partial genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatccgccacaaactgcgggattg	Protospacer
********** ***********.** *.* 

56. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to AF158601 (Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

57. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705268 (Streptococcus phage P7571, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

58. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705269 (Streptococcus phage P7572, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

59. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705281 (Streptococcus phage P7955, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

60. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to AF115103 (Streptococcus thermophilus bacteriophage Sfi21, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

61. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NC_013645 (Streptococcus phage Abc2, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
ctacccaatccgccacaaactgcggcactg	Protospacer
* *.****** ***********.****** 

62. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to AF115102 (Streptococcus thermophilus bacteriophage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

63. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to FJ226752 (Streptococcus phage ALQ13.2, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

64. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NC_002214 (Streptococcus thermophilus bacteriophage Sfi11, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

65. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705272 (Streptococcus phage P7601, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

66. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KY705271 (Streptococcus phage P7574, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

67. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937505 (Streptococcus phage CHPC1109, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

68. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937469 (Streptococcus phage CHPC919, complete genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

69. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MH937491 (Streptococcus phage CHPC1037, partial genome) position: , mismatch: 5, identity: 0.833

caatccaatcagccacaaactgtggcactt	CRISPR spacer
cataccaatcagccacatattgtggcacta	Protospacer
**  ************* *.********* 

70. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_018685 (Bacillus thuringiensis MC28 plasmid pMC95, complete sequence) position: , mismatch: 6, identity: 0.8

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aaaggaatgttagaagaattaaaaaatagt	Protospacer
.* ***.******************. ** 

71. spacer 1.3|9111|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to KJ018211 (Shewanella sp. phage 1/40, complete genome) position: , mismatch: 6, identity: 0.8

tcaacatgcttacttagagcatc-tcgctga	CRISPR spacer
tctacatgcttacttatagcatcactactg-	Protospacer
** ************* ****** ...*** 

72. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448896 (Streptococcus phage Javan278, complete genome) position: , mismatch: 6, identity: 0.8

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatcggccacaaactgcggaatga	Protospacer
**********.***********.** *.  

73. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448757 (Streptococcus phage Javan427, complete genome) position: , mismatch: 6, identity: 0.8

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccattcagccacaaacttcttaactt	Protospacer
******* ************* .   ****

74. spacer 1.6|9309|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010112 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence) position: , mismatch: 6, identity: 0.8

gtagtgaaaacacatattg----taaaagtatta	CRISPR spacer
gtagtgaaaacatatattgaaaatcaaagt----	Protospacer
************.******    * *****    

75. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP034168 (Enterococcus avium strain 352 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aatgcagtattagaagaattaaaaaccaat	Protospacer
.*** ***.****************  *. 

76. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

77. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

78. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

79. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

80. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

81. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

82. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
gaacgagtattagaagaattaaaaaaggaa	Protospacer
**  ****.****************....*

83. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
ggcgctttgttagaagagttaaaaacaaga	Protospacer
*..*   **********.******* ****

84. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MN399336 (Edwardsiella phage vB_EtaM_ET-ABTNL-9, complete genome) position: , mismatch: 7, identity: 0.767

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tcacttgtgtactatcttcagaaaacttac	Protospacer
********* * ***********.*.  * 

85. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006727 (Leptospira interrogans serovar Linhai str. 56609 plasmid lcp3, complete sequence) position: , mismatch: 7, identity: 0.767

caatccaatcagccacaaactgtggcactt	CRISPR spacer
gcttcgcatcagccacaatctttggcactt	Protospacer
   **  *********** ** ********

86. spacer 1.5|9243|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MK448885 (Streptococcus phage Javan252, complete genome) position: , mismatch: 7, identity: 0.767

caatccaatcagccacaaactgtggcactt	CRISPR spacer
caatccaatccgccacaaacttcggaatag	Protospacer
********** ********** .** *.  

87. spacer 1.7|9375|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to MN602266 (Bacteriophage DSS3_VP1, complete genome) position: , mismatch: 7, identity: 0.767

tagtatctcaaataaaattcaacttcactt	CRISPR spacer
ttgtttctcaaatgaaattcaacttgaaag	Protospacer
* ** ********.*********** *   

88. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
aatggagtgttagatgaatttaaactacag	Protospacer
.************* ***** ***  * ..

89. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

90. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

91. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

92. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

93. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_028905 (Clostridium phage phiCD111, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

94. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

95. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

96. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 8, identity: 0.733

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaaa	Protospacer
. *.. .*************.*******.*

97. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NZ_MF925335 (Edwardsiella tarda strain 150611-1 plasmid p150611 1B-1, complete sequence) position: , mismatch: 8, identity: 0.733

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
cattttgtgaaatatcttcagatgaaagtc	Protospacer
.  .****************** ** **  

98. spacer 1.4|9177|30|NZ_ANCT01000086|CRT,CRISPRCasFinder,PILER-CR matches to NC_011668 (Shewanella baltica OS223 plasmid pS22302, complete sequence) position: , mismatch: 8, identity: 0.733

tcacttgtgaaatatcttcagaagatagaa	CRISPR spacer
tggcttgtgcaatatcttcagaagtcgaat	Protospacer
* .****** ************** ...* 

99. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_028838 (Clostridium phage phiCD506, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

100. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

101. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 9, identity: 0.7

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
actaatatgttagaagaattgaaaagaaag	Protospacer
. *.. .*************.*******..

102. spacer 1.2|9045|30|NZ_ANCT01000086|CRT,CRISPRCasFinder matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 10, identity: 0.667

gatggagtgttagaagaattaaaaagaaga	CRISPR spacer
atgagagtcttagaagaattaaaaattctt	Protospacer
.  .**** ****************     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_ANCT01000060
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13781 : 29457 23 Streptococcus_phage(64.29%) integrase attL 16360:16379|attR 30292:30311
DBSCAN-SWA_2 56152 : 62106 7 Streptococcus_phage(100.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_ANCT01000111
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 42520 : 54045 8 Gordonia_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_ANCT01000102
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_ANCT01000102.1|WP_000384271.1|64637_64964_+|hypothetical-protein 64637_64964_+ 108 aa aa AcrIIA21 NA NA No NA
7. NZ_ANCT01000036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_ANCT01000036_1 28862-29355 TypeI I-C
7 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_ANCT01000036_1 1.3|29024|35|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 29024-29058 35 MK448768 Streptococcus phage Javan47, complete genome 34297-34331 0 1.0
NZ_ANCT01000036_1 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 29091-29124 34 MK448851 Streptococcus phage Javan14, complete genome 34030-34063 1 0.971
NZ_ANCT01000036_1 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 29091-29124 34 MK448796 Streptococcus phage Javan53, complete genome 38885-38918 3 0.912
NZ_ANCT01000036_1 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 29091-29124 34 MK448742 Streptococcus phage Javan37, complete genome 30083-30116 3 0.912
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 72996-73027 5 0.844
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 548430-548461 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP038623 Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence 39364-39395 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_017421 Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence 28345-28376 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_001856 Borreliella burgdorferi B31 plasmid lp38, complete sequence 28055-28086 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP019853 Borreliella burgdorferi plasmid lp38, complete sequence 28068-28099 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP019764 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence 28061-28092 6 0.812
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 484591-484622 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 AP014284 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS *** 9262-9293 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 46517-46548 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 131643-131674 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 15273-15304 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 232837-232868 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 25057-25088 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 158727-158758 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 158558-158589 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 1638-1669 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_020380 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence 13185-13216 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MH517022 Acinetobacter phage SH-Ab 15599, complete genome 51037-51068 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MK496784 Capybara microvirus Cap3_SP_414, complete genome 2372-2403 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 U72945 Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region 829-860 7 0.781
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP029456 Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence 61423-61454 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 70696-70727 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 62259-62290 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 70700-70731 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 70707-70738 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 70706-70737 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MH830339 Proteus phage Stubb, complete genome 26806-26837 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MG030347 Proteus phage PM135, complete genome 76557-76588 8 0.75
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 26007-26038 8 0.75
NZ_ANCT01000036_1 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 28958-28991 34 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 42532-42565 8 0.765
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 93170-93201 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 228972-229003 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 9883-9914 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_AP017932 Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence 5632-5663 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP025208 Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence 12385-12416 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP021933 Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence 57054-57085 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP017376 Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence 17183-17214 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP021472 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence 18052-18083 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 1046-1077 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP031209 Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence 42073-42104 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP035015 Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence 24116-24147 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 34563-34594 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 41814-41845 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP046038 Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence 31384-31415 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP017410 Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence 12201-12232 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 15266-15297 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP029967 Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence 42716-42747 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 38185-38216 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 3683-3714 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP018183 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence 17219-17250 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 MH937473 Streptococcus phage CHPC929, complete genome 34811-34842 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NC_010353 Streptococcus phage 858, complete genome 33013-33044 9 0.719
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 161310-161341 10 0.688
NZ_ANCT01000036_1 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 28958-28991 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 3102-3135 10 0.706
NZ_ANCT01000036_1 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder 28958-28991 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 17601-17634 10 0.706
NZ_ANCT01000036_1 1.1|28894|32|NZ_ANCT01000036|CRT 28894-28925 32 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 90370-90401 11 0.656

1. spacer 1.3|29024|35|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaaacggatggttgtatattgcaggctatcagcta	CRISPR spacer
aaaacggatggttgtatattgcaggctatcagcta	Protospacer
***********************************

2. spacer 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.971

tgatctaattagtgatatgctacgtctttacgac	CRISPR spacer
tgatttaattagtgatatgctacgtctttacgac	Protospacer
****.*****************************

3. spacer 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.912

tgatctaattagtgatatgctacgtctttacgac	CRISPR spacer
tgacttaattagtgatatgctacgtctttacgat	Protospacer
***..****************************.

4. spacer 1.4|29091|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.912

tgatctaattagtgatatgctacgtctttacgac	CRISPR spacer
cgacttaattagtgatatgctacgtctttacgac	Protospacer
.**..*****************************

5. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 5, identity: 0.844

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
ataatgaatttatataaaaataatacagtttt-	Protospacer
********** *** ********* ** * ** 

6. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aaaatttgctaataaaaaaataatcattaata	Protospacer
* ***  ..******************** **

7. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP038623 (Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
attatatgttaataactaaataatcattatta	Protospacer
** **. .*******  ***************

8. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_017421 (Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

9. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

10. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

11. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

ataatgaattaataaaaaaataatca-ttatta	CRISPR spacer
ataatgaataactaaaaaaataaggaggtatt-	Protospacer
********* * ***********  *  **** 

12. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781

-ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tataa-atattaataaaaaacaaatcattatct	Protospacer
 **** . ************  *********. 

13. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atccagaattaataaaaaaaaaattattagaa	Protospacer
**   *************** ***.****  *

14. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

15. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

16. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

17. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

18. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

19. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

20. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaagaaattttatact-	Protospacer
 ******************. ***. * **.* 

21. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcat-tatta	CRISPR spacer
ctaatgaattaataaaaaaggaattttatact-	Protospacer
 ******************. ***. * **.* 

22. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_020380 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta--	CRISPR spacer
ataaataattaataaaaaaataa--aacactacg	Protospacer
****  *****************  * .*.**  

23. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MH517022 (Acinetobacter phage SH-Ab 15599, complete genome) position: , mismatch: 7, identity: 0.781

ataatgaat--taataaaaaaataatcattatta	CRISPR spacer
--gacgtattataatagaaaaataatcactatta	Protospacer
  .*.* **  *****.***********.*****

24. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MK496784 (Capybara microvirus Cap3_SP_414, complete genome) position: , mismatch: 7, identity: 0.781

ataatg-aattaataaaaaaataatcattatta	CRISPR spacer
-tatcgtaattaataaaaaaatcattattacga	Protospacer
 ** .* *************** **.****. *

25. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to U72945 (Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region) position: , mismatch: 7, identity: 0.781

ataatgaattaataaaaaaataatcattatta-	CRISPR spacer
ttaaacaattaataaaaaaataatt-ttatgga	Protospacer
 ***  ******************. **** . 

26. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP029456 (Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataat-cattatta	CRISPR spacer
gaaattaattaatagaaaaataatccaatgct-	Protospacer
. *** ********.********* ** *..* 

27. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

28. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaactaataaaaaaataataaaatata	Protospacer
 ****.**.*************** *    **

29. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

30. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

31. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 8, identity: 0.75

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ttaataaattaatgaaaaaataatattaacaa	Protospacer
 ****.*******.**********  * *. *

32. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

33. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

34. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75

ataatga-----attaataaaaaaataatcattatta	CRISPR spacer
-----gagcattattaataaataaataatcataataa	Protospacer
     **     ********* ********** ** *

35. spacer 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 8, identity: 0.765

gcgttgatatgaaaggaaattatag-agatatgat	CRISPR spacer
tcgttgatctaaaaggaaattatagcactcataa-	Protospacer
 ******* *.************** *  .**.* 

36. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

37. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
ataatgaatttataaaaaaataaatttaggag	Protospacer
********** ************ . * .  .

38. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
caaaactattaatataaaagtaatcattatct	Protospacer
  **   ******* ****.**********. 

39. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_AP017932 (Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

40. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

41. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

42. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

43. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

44. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

45. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP031209 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

46. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP035015 (Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

47. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaat-taataaaaaaataatcattatta	CRISPR spacer
-tggcaggtgtaacaaaaaaattatcattatta	Protospacer
 *......* ***.******** **********

48. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

49. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP046038 (Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

50. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

51. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

52. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP029967 (Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

53. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

54. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

55. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP018183 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
aacccaatttaataaaaaaacaatgattattg	Protospacer
*   ..* ************.*** ******.

56. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

57. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 9, identity: 0.719

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
atattgaattaataaaaaagtaagtaagtaaa	Protospacer
*** ***************.*** .*     *

58. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.688

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
gaaatgaataaatgaaaaaataatctaccctt	Protospacer
. ******* ***.***********  . .* 

59. spacer 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

gcgttgatatgaaaggaaattatagagatatgat	CRISPR spacer
caaactatatgaaagaaaattataaagatataag	Protospacer
  . . *********.********.******.* 

60. spacer 1.2|28958|34|NZ_ANCT01000036|CRT,PILER-CR,CRISPRCasFinder matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

gcgttgatatgaaaggaaattatagagatatgat	CRISPR spacer
caaactatatgaaagaaaattataaagatataag	Protospacer
  . . *********.********.******.* 

61. spacer 1.1|28894|32|NZ_ANCT01000036|CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 11, identity: 0.656

ataatgaattaataaaaaaataatcattatta	CRISPR spacer
tagatgaattaataaataaatattcaaatggg	Protospacer
  .************* ***** ***     .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_ANCT01000110
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55679 : 63233 11 Streptococcus_phage(50.0%) integrase,transposase attL 54799:54812|attR 60291:60304
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage